Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2017 Dec 13.
Published in final edited form as: Cell Rep. 2017 Nov 21;21(8):2147–2159. doi: 10.1016/j.celrep.2017.10.085

SUMOylation Promotes Nuclear Import and Stabilization of Polo-Like Kinase 1 to Support its Mitotic Function

Donghua Wen 1,2, Jianguo Wu 1,2, Lei Wang 1, Zheng Fu 1,3,*
PMCID: PMC5728694  NIHMSID: NIHMS917238  PMID: 29166606

SUMMARY

As a pivotal mitotic regulator, polo-like kinase 1 (PLK1) is under highly coordinated and multilayered regulation. However, the pathways that control PLK1’s activity and function have just begun to be elucidated. PLK1 has recently been shown to be functionally modulated by post-translational modifications (PTMs), including phosphorylation and ubiquitination. Herein, we report that a novel PTM, SUMOylation, plays an essential role in regulating PLK1’s mitotic function. We found that Ubc9 was recruited to PLK1, upon initial phosphorylation and activation by CDK1/cyclin B. By in vivo and in vitro SUMOylation assays, PLK1 was identified as a physiologically relevant SUMO-targeted protein, preferentially modified by SUMO-1. We further showed that K492 on PLK1 is essential for SUMOylation. SUMOylation causes PLK1’s nuclear import and significantly increases its protein stability, both of which are critical for normal mitotic progression and genomic integrity. Our findings suggest that SUMOylation is another important regulatory mechanism governing PLK1’s mitotic function.

Graphical Abstract

graphic file with name nihms917238u1.jpg

INTRODUCTION

Mammalian polo-like kinase 1 (PLK1) belongs to a family of 5 serine/threonine kinases (de Carcer et al., 2011). It consists of a kinase domain (KD) at the N-terminus and a highly conserved polo-box domain (PBD) composed of 2 polo boxes near the C-terminus. The PBD is a phosphopeptide-binding domain that is required for the recruitment of PLK1 to substrates that have been primed by phosphorylation at specific docking sites (Park et al., 2010). Studies have demonstrated that the PBD plays a crucial role in substrate binding and regulation of kinase activity (Lowery et al., 2005). As a master regulator of cell division, PLK1 functions in almost every stage of cell division including mitotic entry, centrosome maturation, bipolar spindle formation, chromatid segregation, mitotic exit, and cytokinesis (de Carcer et al., 2011). Moreover, its role is not limited to mitosis and cytokinesis. PLK1 also regulates transcription, translation, p53 regulation, DNA replication, microtubule dynamics, checkpoint recovery, epithelial-to-mesenchymal transition, and cell motility (Cholewa et al., 2013; Fu et al., 2008; Liu et al., 2010; van Vugt et al., 2004; Wu et al., 2016).

As a key serine/threonine kinase, much PLK1 research has focused on identifying and characterizing its substrates, such as BubR1 (Elowe et al., 2007), FOXO1 (Yuan et al., 2014), and FoxM1 (Fu et al., 2008). PLK1 itself is under highly coordinated and multi-layered regulation. However, the regulatory pathways that control PLK1’s activity and function are not yet fully explored. Recent studies have revealed that PLK1 is subjected to post-translation modifications (PTMs), including phosphorylation and ubiquitination. For instance, Aurora-A and Bora cooperatively activate PLK1 by phosphorylating threonine 210 (T210) in its activation loop (T-loop) (Macurek et al., 2008; Seki et al., 2008). Mono-ubiquitination of K492 is important for PLK’s disassociation from the kinetochore during metaphase-anaphase transition (Beck et al., 2013). Poly-ubiquitination of PLK1, mediated by anaphase-promoting complex/cyclosome (APC/C) and Cdh1, promotes subsequent degradation of PLK1 in anaphase (Lindon and Pines, 2004). No other PTMs of PLK1 have been identified yet.

SUMOylation is a dynamic, reversible process involving the covalent PTM of specific lysine (K) residues on target proteins with SUMO (small ubiquitin-related modifier) via enzymatic cascade reactions that closely mimic ubiquitination. This modification process involves the SUMO-activating enzyme SAE1/SAE2, the sole SUMO-conjugating E2 enzyme Ubc9, and an E3 ligation enzyme (Wilkinson and Henley, 2010). Although the E2 enzyme is sufficient for SUMOylation as long as the consensus sequence is present, E3 ligases enhance the efficiency of the process. Mammals express 4 SUMO isoforms: SUMO-1, -2, -3, and -4 (Hay, 2005). SUMO-1 shares more than 45% amino acid identity with SUMO-2. However, SUMO-2 and SUMO-3 share more than 96% amino acid identity and antibodies cannot distinguish the 2 isoforms. As such, they are often referred to collectively as SUMO-2/3 and are commonly examined in conjunction. While SUMO-1 and SUMO-2/3 are ubiquitously expressed, SUMO-4 is found predominantly in the kidneys and immune system (Hay, 2005). It remains unclear whether SUMO-4 is processed or conjugated to cellular proteins like the other paralogs.

SUMO conjugation is an important regulatory mechanism for protein stability, subcellular localization, protein-protein interactions, and transcriptional regulation (Muller et al., 2001; Wilson and Rangasamy, 2001), and thus plays a critical role in the cell cycle, DNA repair, transcription, signal transduction, and chromatin remodeling (Hay, 2005; Johnson, 2004; Muller et al., 2001; Seeler and Dejean, 2003), as well as in cancer pathogenesis (Kim and Baek, 2006; Seeler et al., 2007). Genetic studies have established an essential role for SUMOylation in G2/M phase, and perturbations to the SUMO machinery are linked to a range of mitotic defects (Bettermann et al., 2012; Dasso, 2008). For example, in S. cerevisiae, Ubc9-deficient cells displayed defects in chromosome segregation and reduced cell growth (Seufert et al., 1995). Ubc9-null embryos died at the early post-implantation stage and E3.5 blastocysts exhibited massive mitotic defects (Nacerddine et al., 2005).

In our previous studies, we performed yeast two-hybrid screening to identify PLK1-interacting proteins. Intriguingly, we found that PLK1 interacts with Ubc9, the sole SUMO-conjugating enzyme (Schwarz et al., 1998), suggesting that PLK1 may be regulated by SUMO conjugation. In this present study, we verified that interaction between PLK1 and Ubc9 did occur in the cell, following the initial phosphorylation and activation of Ubc9 by CDK1/cyclin B. Furthermore, Ubc9 positively regulates the protein stability of PLK1. By in vivo and in vitro SUMOylation assays, PLK1 was identified as an authentic and physiologically relevant SUMO-targeted protein. SUMO modification promotes PLK1’s nuclear import and suppresses its ubiquitin-mediated proteasomal degradation. Blocking the SUMO acceptor site on PLK1 led to numerous mitotic aberrations, including prolonged mitotic progression and misaligned and/or mis-segregated chromosomes. Such defects can be rescued by reintroducing SUMO modification to PLK1. Therefore, this study reveals for the first time a novel PTM—SUMOylation, which plays an important role in regulating PLK1’s function in M phase to ensure normal mitotic progression and genomic integrity.

RESULTS

Ubc9 Is a Novel Physiological Binding Partner of PLK1 and Positively Regulates its Protein Stability

In previous studies, we used a yeast two-hybrid system to identify binding partners of PLK1 (Fu et al., 2008). We found that Ubc9 is one of the binding partners of PLK1 (data not shown). Ubc9 is the sole SUMO-conjugating enzyme required for SUMOylation. There is increasing evidence supporting a major role of Ubc9 in mitosis (Nacerddine et al., 2005). In an attempt to understand the molecular link for the crosstalk between SUMOylation and mitosis, Su et al. found that the master mitotic kinase CDK1/cyclin B phosphorylates Ubc9 at serine 71, leading to its enhanced SUMOylation activity and hence elevated SUMOylation, which plays a vital role during G2/M transition and mitotic progression (Su et al., 2012). To verify our yeast two-hybrid results, we performed a reciprocal co-immunoprecipitation (Co-IP) to immunoprecipitate endogenous PLK1 and Ubc9 in HeLa cells. Indeed, endogenous Ubc9 and PLK1 formed a complex (Figure 1A). The PLK1/Ubc9 interaction preferentially occurred in G2/M phase, indicating that PLK1 interacts with Ubc9 in a cell cycle-dependent manner (Figure 1A). In vitro translated Ubc9 associated with GST-fused PLK1 (GST–PLK1), but not with GST (Figure 1B), indicating that Ubc9 binds directly to PLK1. Interestingly, wild-type (WT) Ubc9 bound GST-PLK1 PBD WT, but not the PBD mutant that is deficient in phosphopeptide binding (Elia et al., 2003), suggesting that the Ubc9/PLK1 interaction is phosphorylation-dependent. To determine whether CDK1/cyclin B-mediated phosphorylation of Ubc9 at serine 71 creates a docking site, allowing subsequent binding to the PBD of PLK1, we generated a series of Ubc9 mutants by mutating the CDK1/cyclin B phosphorylation site to alanine (Ubc9-S71A) or aspartate (Ubc9-S71D) to either block or mimic CDK1/cyclin B phosphorylation. We then examined their effects on Ubc9’s association with PLK1. Compared to WT Ubc9, the phospho-mimicking mutant Ubc9-S71D showed significant enhancement in affinity for PLK1; however, blocking CDK1/cyclin B-mediated phosphorylation abolished this interaction (Figure 1C), suggesting that CDK1/cyclin B-mediated phosphorylation of Ubc9 is a prerequisite for subsequent PLK1 binding. Furthermore, immunofluorescence (IF) staining showed that PLK1 co-localizes with Ubc9 in U2OS cells (Figure S1), suggesting that Ubc9 may act as a regulator of PLK1.

Figure 1.

Figure 1

Ubc9 interacts with PLK1 in a phosphorylation-dependent manner. (A) Reciprocal co-immunoprecipitation of endogenous PLK1 and Ubc9 from HeLa cell lysates untreated or treated with nocodazole. (B) In vitro translated Ubc9 was used in a pull-down assay with either GST or GST-PLK1 immobilized on agarose beads (upper panel). Loading controls are shown below (CBB, Coomassie blue staining). (C) 293T cells were transfected with plasmids encoding Myc-tagged WT Ubc9 (Ubc9-WT) or mutant Ubc9 (Ubc9-S71A, or Ubc9-S71D). Cell lysates were subjected to pull-down assays using beads coated with GST–PLK1 PBD WT or a mutant (MUT) deficient in phosphopeptide binding. Beads coated with GST alone were used as a negative control. (D) Ponceau S staining was used to indicate equal loading of the assays. See also Figure S1.

Interestingly, overexpression of Ubc9 in U2OS cells significantly increased the level of endogenous PLK1 protein, but had no effect on PLK1 mRNA (Figure 2A and data not shown). In contrast, when we depleted Ubc9 with 2 different shRNAs that target the 3′-UTR of Ubc9, endogenous PLK1 was dramatically decreased (Figure 2B), and this was rescued by reintroducing Ubc9 (Figure 2C). These results demonstrate that Ubc9 indeed positively regulates PLK1 protein levels.

Figure 2.

Figure 2

Ubc9 positively regulates PLK1’s protein stability. (A) U2OS cells were transfected with increasing amounts of pCMV-Myc-Ubc9 (0, 0.5, 1, and 2 μg). 48 h post-transfection, cells were harvested for Western blot using indicated antibodies. (B) U2OS cells were infected with lentiviral shRNA constructs that target either the 3′-UTR of endogenous Ubc9 (#1 and #2) or serve as a control (shCTL). Protein levels of PLK1, Ubc9, and β-actin were examined by Western blot. (C) U2OS cells with stable Ubc9 knockdown were transfected with increasing amounts of pCMV-myc-Ubc9 (0, 0.5, 1, 2, 3, and 4 μg) and lysates were subjected to Western blot. SE: shorter exposure; LE: longer exposure. (D) U2OS cells were transfected with pCMV-Myc-Ubc9 or empty vector for 24 h and then treated with either DMSO or 2 μM MG132 for 16 h. (E) U2OS cells with stable Ubc9 knockdown were treated with DMSO or 2 μM MG132 for 16 h. Cells were harvested for Western blot. (F) Control (CTL), and Ubc9-overexpressing U2OS cells were treated with nocodazole for 16 h, mitotic cells were collected by shake-off and replated in fresh medium in the presence or absence of 20 μg/mL cycloheximide (CHX) for the indicated times, and endogenous PLK1 protein levels were monitored by immunoblotting (left panel). (G) Control (shCTL) and Ubc9 knockdown U2OS cells were treated as described in (F), and PLK1 protein levels were monitored by immunoblotting (left panel). Quantification of endogenous PLK1 protein levels relative to β-actin expression is shown in the right panel. The data are presented as the mean ± s.e.m. *, p<0.05.

To determine how Ubc9 modulates PLK1 protein levels, U2OS cells were transfected with a vector or Myc-Ubc9, and then treated with either the vehicle (DMSO) or the proteasome inhibitor MG132 to block proteasomal degradation. MG132 treatment led to dramatically increased protein levels of PLK1 in control U2OS cells, but not in U2OS cells overexpressing Myc-Ubc9 (Figure 2D). Moreover, treatment with MG132 increased the expression of PLK1 protein in Ubc9-knockdown cells (Figure 2E). These data indicate that Ubc9 regulates PLK1 by protecting the protein from proteasomal degradation. To further validate these results, we examined the decay rate of PLK1 in cells overexpressing Ubc9 and in cells with Ubc9 knocked down during M phase. U2OS cells expressing Myc-Ubc9 or shUbc9 along with control cells were first arrested at M phase, and then released in fresh medium in the presence or absence of CHX (a protein translation inhibitor) for different times (0, 1, 2, 3, or 4 h), and the protein levels of endogenous PLK1 were evaluated by Western blot analysis (Figure 2F–G). Results from 3 independent experiments were quantified. Consistently, the stability of PLK1 protein substantially increased upon Ubc9 overexpression and decreased with Ubc9 knockdown (Figure 2F–G). Taken together, these results demonstrate that Ubc9 positively regulates the stability of PLK1 protein by preventing its proteasomal degradation during M phase.

PLK1 Is a Physiologically Relevant SUMO-Targeted Protein and K492 Is its SUMO Acceptor Site

Because Ubc9 is the sole SUMO-conjugating enzyme, we examined whether PLK1 is subject to SUMOylation. Indeed, a slower migrating band was recognized by anti-Myc (PLK1) antibody in cells co-transfected with Myc-tagged PLK1 and HA-tagged SUMO-1, or -2 in the presence of Flag-tagged Ubc9 (Figure 3A). These higher molecular weight PLK1 species reacted with anti-HA antibodies, confirming their identity. Moreover, PLK1 is preferentially SUMOylated by SUMO-1, compared to SUMO-2 (Figure 3A). Consistently, IF staining showed that PLK1 co-localized with SUMO-1 (Figure S2A). An in vitro SUMOylation assay showed that PLK1 can be SUMOylated by WT SUMO-1 but not a SUMO-1 mutant that has deletion of the 2 C-terminal glycine residues required for its conjugation to target proteins (Figure 3B). Next, we transfected T7-tagged SUMO-1 (T7-SUMO-1) with or without Myc-Ubc9 into U2OS cells. Endogenous SUMOylated PLK1 was detected using an anti-PLK1 antibody and verified with an anti-T7 antibody (Figure 3C). Ubc9 overexpression significantly enhanced the levels of PLK1 SUMOylation (Figure 3C, compare lanes 3 and 5). In addition, His-tagged SUMO-1 WT or MUT were co-transfected with Ubc9 into 293T cells. His-SUMO-1 conjugated proteins were pulled down using Ni-NTA beads and subjected to Western blot. SUMO-1-conjugated endogenous PLK1 was detected using an anti-PLK1 antibody (Figure S2B).

Figure 3.

Figure 3

PLK1 is subject to SUMO modification. (A) U2OS cells were transfected with Myc-PLK1, Flag-Ubc9, and HA-SUMO-1 or HA-SUMO-2 for 48 h, and then harvested for IP using anti-Myc antibody. The immunoprecipitated products were subjected to Western blot using the indicated antibodies. * indicates non-specific protein bands. (B) In vitro SUMOylation assays were performed by incubating bacterially expressed PLK1 with the SUMO-conjugation machinery: Aos1/Uba2, Ubc9, and SUMO-1. A SUMO-1 mutant (MUT) with deletion of the 2 C-terminal glycine residues required for its conjugation was included as a negative control. The SUMOylation status of PLK1 was examined by Western blot. (C) U2OS cells were transfected with the indicated constructs. After 48 h, the cells were lysed, immunoprecipitated using anti-PLK1 antibody, and immunoblotted with the indicated antibodies. (D) 293T cells were lysed under denaturing conditions, immunoprecipitated using anti-SUMO-1 antibody, and immunoblotted with anti-PLK1 antibody. (E) U2OS cells were transfected with indicated constructs, lysed, immunoprecipitated using anti-Myc antibody, and immunoblotted with the indicated antibodies. (F) Alignment of PLK1 regions containing the identified SUMO acceptor site K492 from multiple species. See also Figure S2.

To determine whether PLK1 SUMOylation is physiologically relevant, we took advantage of a recently developed method that allows high enrichment of rare endogenous SUMO targets under close to physiological conditions (Barysch et al., 2014). Briefly, a large number of 292T cells were lysed under denaturing conditions (to inactivate SUMO isopeptidases). The lysate was diluted with non-denaturing lysis buffer and subjected to IP using a validated monoclonal anti-SUMO-1 antibody (SUMO-1 21C7) from the Developmental Studies Hybridoma Bank at the University of Iowa. SUMOylated endogenous PLK1 was examined by Western blot analysis using an anti-PLK1 antibody. Importantly, we detected endogenous SUMOylated PLK1without overexpression of SUMO machinery (Figure 3D). These results convincingly indicate, for the first time, that SUMO modification of PLK1 indeed occurs in the cell, and further strengthens the importance and physiological relevance of PLK1 SUMOylation. To investigate the kinetics of PLK1 SUMOylation during cell cycle progression, U2OS cells were transfected with Ubc9 and SUMO-1 and then synchronized at difference phases of the cell cycle using L-mimosine (blocking cells at later G1 phase), fluorouracil (blocking cells at S phase), Taxol (blocking cells at M phase), or nocodazole (blocking cells at M phase). The synchronous cells were subjected to IP using anti-PLK1 (Figure S2C) or -SUMO-1 antibodies (Figure S2D). As shown in Figure S2C–D, SUMOylation of endogenous PLK1 mainly occurred in M phase, when maximal interaction between PLK1 and Ubc9 was detected. PLK1 does not contain a strict SUMOylation consensus motif, but the SUMOplot™ program predicted 6 SUMOylation sites. We mutated each lysine residue (at positions 178, 191, 265, 358, 492, and 601) to R and demonstrated that only the K492R mutant abolished SUMO conjugation to PLK1 (Figure 3E), indicating that K492 in PLK1 is a major SUMO acceptor site. Importantly, the K492 residue in PLK1 is conserved from fission yeast to humans (Figure 3F), suggesting that SUMOylation of that site may have an evolutionarily conserved role in regulating PLK1’s function.

SUMOylation of PLK1 Regulates its Nuclear Import

The level of PLK1 is low in G1 and PLK1 starts to accumulate in both the nucleus and the cytoplasm during S and G2 phases (Liu et al., 2004). At prophase, the protein level of PLK1 is maximal and it is localized to both the nucleus and, to a lesser extent, the cytoplasm (Figures S1 and S2A (Taniguchi et al., 2002)). Nuclear localization or nucleocytoplasmic translocation is thought to be crucial for its function (Taniguchi et al., 2002). Disruption of nuclear localization signals (NLSs) on PLK1 causes defects in the mitotic process (Lee et al., 2009; Taniguchi et al., 2002). The critical SUMOylation site K492 on PLK1 is close to a NLS (residues 396–433) in the PLK1 PBD, suggesting that SUMO modification may play a role in the subcellular localization of PLK1.

To understand whether and how SUMOylation regulates PLK1 function, we first determined whether SUMO conjugation modulates PLK1’s subcellular localization. We performed IF to visualize the subcellular localization of endogenous PLK1 in cells with Ubc9 knockdown. Interestingly, cells expressing shUbc9 exhibited a dramatic reduction of nuclear PLK1 when compared to the control cells (Figure 4A). IF staining was also performed in cells expressing Flag-tagged PLK1 WT and a SUMO mutant K492R (defective in SUMO conjugation). Consistently, the PLK1 K492R mutant was mainly present in the cytoplasm, whereas WT PLK1 resided in both the nucleus and the cytoplasm (Figure 4C). To further confirm that a lack of SUMOylation leads to impaired subcellular localization of PLK1, SUMO-1 was fused to the C-terminus of the PLK1 K492R mutant (a construct named SUMO-1-K492R). The covalent attachment of SUMO by linear gene fusion has been found to mimic the activity of SUMO conjugation (Holmstrom et al., 2003; Ross et al., 2002; Yurchenko et al., 2006). In addition, we employed a Ubc9 fusion-directed SUMOylation (UFDS) system to allow efficient and selective in vivo SUMOylation of PLK1 (Jakobs et al., 2007a; Jakobs et al., 2007b). Ubc9 was fused to the C-terminus of WT PLK1 (a construct named Ubc9-WT) and the PLK1 K492R mutant (a construct named Ubc9-K492R). Remarkably, both SUMO-1-K492R and Ubc9-WT mutants were predominantly localized to the nucleus (Figure 4C). Subcellular fractionation assays further confirmed these results (Figure 4B and 4D). In contrast, the Ubc9-K492R mutant and the PLK1 K492R mutant exhibited similar aberrant subcellular localizations (Figure S3). Furthermore, the nuclear export inhibitor leptomycin B (LMB) (Wolff et al., 1997) sequestered PLK1 WT, SUMO-1-K492R, and Ubc9-WT in the nucleus, but not the PLK1 K492R mutant (Figure 4E), suggesting that SUMO modification is important for nuclear import of PLK1.

Figure 4.

Figure 4

SUMOylation regulates PLK1’s nuclear import. (A) The cellular localization of endogenous PLK1 in control (shCTL) and Ubc9 knockdown (shUbc9) U2OS cells was examined by immunofluorescence (IF) staining using anti-PLK1 antibody (red). Similar results were obtained from 3 independent experiments. Scale bar = 10 μm. (B) An additional set of samples was subjected to subcellular fractionation. The levels of endogenous PLK1 in nuclear and cytoplasmic fractions were determined by immunoblotting with anti-PLK1 antibody. The relative purity of the nuclear and cytoplasmic fractions was confirmed by sequential probing for the nuclear marker lamin A/C and the cytoplasmic marker α-tubulin. W, whole cell lysate; N, nucleus; C, cytoplasm. (C) U2OS cells were transfected with Flag-tagged PLK1 WT or a Flag-tagged mutant PLK1 (K492R, SUMO-1-K492R, or Ubc9-WT). The cellular localization of ectopically expressed WT and mutant PLK1 was examined by IF using anti-Flag antibody (green). Similar results were obtained from 3 independent experiments. Scale bar = 10 μm. (D) An additional set of samples was subjected to subcellular fractionation. The levels of exogenous PLK1 in nuclear and cytoplasmic fractions were determined by immunoblotting with anti-Flag antibody. The relative purity of the nuclear and cytoplasmic fractions was confirmed as indicated in (B). (E) The same set of cells as in (D) were treated with 5 ng/mL leptomycin B (LMB) for 16 h and subjected to subcellular fractionation. See also Figures S3–S4.

Previous studies demonstrate that the K492 site of PLK1 is also subject to mono-ubiquitination by the cullin 3 (CUL3)-based E3 ubiquitin ligase, containing the Bric-a-brac/Tramtrack/Broad complex (BTB) adaptor KLHL22 (Beck et al., 2013). To determine whether mono-ubiquitination of PLK1 at K492 also contributes to cytoplasmic-nuclear shuttling, we examined the subcellular localization of endogenous PLK1 in cells with KLHL22 knockdown. As shown in Figure S4, downregulation of KLHL22 by siRNA had no measurable effect on subcellular localization of PLK1, which excludes the possibility of K492 mono-ubiquitination being involved in regulating PLK1’s subcellular localization.

SUMOylation of PLK1 Enhances its Protein Stability

Given our observation that Ubc9 positively regulates PLK1 protein stability by protecting it from proteasomal degradation (Figure 2), we next examined whether Ubc9 executes such a function via SUMO modification of PLK1. Mitotic cells expressing PLK1 WT, K492R, or SUMO-1-K492R were collected by a gentle shake-off and replated in the presence of CHX for 0, 1, 2, 3, 4, or 5 h. The decay rates of WT and mutant PLK1 were compared. Results from 3 independent experiments were quantified (Figure 5A–B). Compared to WT PLK1, the protein stability of the PLK1 K492R mutant was significantly decreased, whereas the protein stability of the SUMO-1-K492R was increased (Figure 5A–B). To determine whether PLK1 SUMOylation suppresses its ubiquitination and subsequent degradation, U2OS cells were transfected with PLK1 WT or mutant (K492R or SUMO-1-K492R) along with ubiquitin, and then arrested in the late stages of M phase (Hauf et al., 2003), followed by IP analysis. The PLK1 K492R mutant, which is deficient in SUMO conjugation, showed a higher level of ubiquitination compared to WT PLK1 (Figure 5C). In contrast, the ubiquitination of PLK1 decreased after SUMO-1 fused to PLK1 K492R (SUMO-1-K492R) (Figure 5C). These results suggest that PLK1 SUMOylation suppresses the ubiquitin-mediated degradation of PLK1 in M phase.

Figure 5.

Figure 5

SUMOylation of PLK1 enhances its protein stability. (A–B) U2OS cells expressing Myc-tagged PLK1 WT or a Myc-tagged mutant PLK1 (K492R, or SUMO-1-K492R) were treated with nocodazole for 16 h and mitotic cells were collected by shake-off and replated in fresh medium in the presence or absence of 20 μg/mL cycloheximide (CHX) for the indicated times. Ectopically expressed WT and mutant PLK1 protein levels were monitored by immunoblotting (A). Quantification of exogenous protein levels relative to β-actin expression is shown in (B). The data are presented as the mean ± s.e.m. *, p<0.05. (C) U2OS cells were transfected with PLK1 WT or mutant PLK1 (K492R, or SUMO-1-K492R) along with ubiquitin, and then synchronized at the late stage of M phase by treating with Taxol for 16 h and subsequently released in the presence of hesperidin, an Aurora B inhibitor, for 45 min. Cell lysates were subjected to immunoprecipitation with anti-Myc antibody, and blotted with the indicated antibodies. (D) U2OS cells expressing Myc-tagged PLK1 WT, K492R, or SUMO-1-K492R were treated with Taxol for 16 h. Half of the cells were then released in the presence of hesperidin for 45 min to enrich cells at the later stage of M phase. Cell lysates were subject to IP, followed by Western blot.

Beck et al. previously reported that the K492 site of PLK1 is subject to mono-ubiquitination, but not poly-ubiquitination (Beck et al., 2013), which excludes the possibility that SUMOylation stabilizes the PLK1 protein by competing with poly-ubiquitination of the same lysine residue K492. It was reported that the degradation of PLK1 is mediated by APC/Ccdh1 (Lindon and Pines, 2004). We, therefore, hypothesized that SUMOylation may regulate the interaction between PLK1 and its E3 ubiquitin ligase. To test this hypothesis, U2OS cells expressing PLK1 WT or a mutant (K492R or SUMO-1-K492R) were arrested in the early (Taxol) or late (Taxol + hesperadin [an Aurora B inhibitor] (Hauf et al., 2003)) stages of M phase, followed by Co-IP analysis. We found that Cdh1 preferentially bound to PLK1 K492R compared to PLK1 WT, or SUMO-1-K492R in the late stage of M phase (Figure 5D). Taken together, these results suggest that SUMOylation positively regulates the stability of PLK1 by reducing its interaction with APC/Ccdh1, and thereby protecting it from ubiquitin-mediated proteasomal degradation in M phase.

SUMOylation of PLK1 Contributes to Normal Cell Cycle Progression and Genome Stability

We next investigated the effect of PLK1 SUMOylation on normal cell cycle progression. U2OS cells stably expressing PLK1 WT or K492R were infected with lentivirus encoding shRNA targeting the 3′-UTR of endogenous PLK1, as described previously (Wu et al., 2016). Cell cycle distribution was determined by flow cytometry analysis. We observed an increase (~2-fold) of the 4N population in cells expressing PLK1 K492R compared to cells expressing WT PLK1 (Figure 6A), suggesting that PLK1 SUMOylation is important in the late phases of cell cycle progression. To investigate the cause of the increased 4N population in cells expressing PLK1 K492R, we compared the mitotic index, as indicated by positive phospho-histone H3 (Ser10) staining, in cells expressing PLK1 WT or mutant (K492R, SUMO-1-K492R, or Ubc9-WT) with endogenous PLK1 knockdown. Flow cytometry analysis indicated that there was a significant increase in PLK1 K492R mitotic cells compared to PLK1 WT, SUMO-1-K492R, or Ubc9-WT mitotic cells (Figure 6B). Furthermore, time-lapse imaging analysis was performed to monitor cell cycle progression and to score other mitotic defects in living cells. Remarkably, blocking the SUMO acceptor site K492 led to numerous mitotic defects, including misaligned and/or mis-segregated chromosomes, and prolonged early mitotic progression (Figure 6C). The majority of cells expressing PLK1 K492R exhibited prolonged progression time from nuclear envelope breakdown (NEBD) to anaphase onset (Figure 6D). Consistently, U2OS cells with Ubc9 knocked down also showed similar mitotic defects (Figure S5A–B). However, fusion of SUMO-1 to PLK1 K492R (SUMO-1-K492R) or Ubc9 to PLK1 WT (Ubc9-WT), but not to PLK1 K492R (Ubc9-K492R), totally abrogated the mitotic defects observed in PLK1 K492R-expressing cells (Figure 6B–D, Figure S6). These results strongly suggest that PLK1 SUMOylation plays an important role in normal cell cycle progression and genomic integrity.

Figure 6.

Figure 6

SUMOylation of PLK1 contributes to normal cell cycle progression and genome stability. (A) U2OS cells stably expressing PLK1 WT or K492R were infected with lentivirus encoding shRNA targeting the 3′-UTR of endogenous PLK1. Cell cycle distribution was determined by flow cytometry. The expression of exogenous PLK1 was analyzed by Western blots. (B) Endogenous PLK1 was knocked down in U2OS cells stably expressing PLK1 WT, K492R, SUMO-1-K492R, or Ubc9-WT constructs. Cells were stained with anti-pH3 antibody and PI and analyzed by flow cytometry. (C-D) The same set of cells as described in (B) were infected with lentiviral H2B-mGFP constructs and subjected to time-lapse imaging. Representative time-lapse images are shown with the acquisition time relative to the onset of mitosis indicated on each image (C). White arrows indicate misaligned chromosomes or lagging chromosomes. Scale bar = 10 μm. The duration of nuclear envelope breakdown (NEBD) to anaphase onset in each cell line is summarized in (D). Fifty cells per cell line were monitored. *, p<0.05. See also Figures S5–S6.

DISCUSSION

PLK1 has recently attracted considerable attention due to its paramount functions in the regulation of cell division. As a key mitotic regulator, PLK1 itself is under highly coordinated and multi-layered regulation. Recent studies have begun to shed some light on the regulatory pathways that control PLK1’s activity and function. Several papers have reported that PTMs, including phosphorylation and ubiquitination, play an important role in modulating the activity and function of PLK1 (Beck et al., 2013; Jang et al., 2002; Macurek et al., 2008; Tang et al., 2008; Tsvetkov and Stern, 2005). In our present study, we showed that a novel PTM, SUMOylation, functionally regulates PLK1. During G2/M transition, CDK1/cyclin B phosphorylates Ubc9, which not only enhances the SUMOylation activity of Ubc9 but also creates a docking site for PLK1. Subsequently, Ubc9 binds to and promotes PLK1 SUMO conjugation. This PTM causes PLK1’s nuclear import and significantly increases protein stability, both of which allow for rapid change in the function of preexisting PLK1 during M phase, ensuring normal mitotic progression and genomic integrity (Figure 7).

Figure 7.

Figure 7

Model for SUMOylation-mediated regulation of PLK1’s function.

Our study is the first to demonstrate that PLK1 is subject to SUMO-mediated regulation. SUMOylation represents a reversible process that covalently links SUMO moiety to lysine residues on target proteins via an enzymatic cascade. SUMOylation of a target protein can influence protein stability, subcellular localization, protein-protein interactions, and/or transcriptional activity (Muller et al., 2001; Wilson and Rangasamy, 2001). Consequently, SUMOylation regulates a multitude of cellular processes, such as cell cycle progression, signal transduction, and DNA replication/repair (Hay, 2005; Johnson, 2004; Muller et al., 2001; Seeler and Dejean, 2003). Many important cell cycle regulators, including Aurora B (Fernandez-Miranda et al., 2010), BUBR1 (Yang et al., 2012; Zhang et al., 2008), and FoxM1 (Zhang et al., 2015), have been shown to be SUMOylated. We have provided in vitro and in vivo evidence that PLK1 can be SUMOylated, preferentially by SUMO-1 (Figures 3 and S2). The SUMOylation event occurs mainly in M phase (Figure S2), when the maximal interaction between PLK1 and Ubc9 was detected (Figure 1A). Importantly, by taking advantage of a newly developed method that allows high enrichment of rare endogenous SUMO targets under close to normal physiological conditions (Barysch et al., 2014), we were able to detect endogenous SUMOylated PLK1 without ectopically expressing SUMO machinery (Figure 3D). These results exclude the possibility of artificial effect and provide convincing evidence that PLK1 SUMOylation indeed occurs in the cell.

Although ubiquitin-conjugating enzymes generally require an E3 ligase to convey substrate specificity, SUMO E2 is unique because it is capable of specifically recognizing and conjugating SUMO to some substrates in the absence of an E3 ligase. SUMO E3 ligases often facilitate SUMO conjugation and enhance the efficiency of the process. Accumulating observations indicate that the RanBP2 protein has an important mitotic role by promoting SUMO conjugation as a SUMO ligase (Azuma and Dasso, 2002). For example, RanBP-mediated SUMOylation of Topoisomerase IIα is essential for resolution of sister centromeres (Dawlaty et al., 2008). RanBP2 insufficiency led to anaphase bridges (Dawlaty et al., 2008), resembling the mitotic defects that we observed in cells expressing a SUMO-deficient mutant (Figure 6). RanBP2 also stimulates SUMO modification of borealin, a component of the chromosomal passage complex, whose activity is involved in chromosome congression, the spindle assembly checkpoint, and cytokinesis (Klein et al., 2009). Therefore, it is attractive to speculate that RanBP2 may function as a specific SUMO E3 ligase for PLK1. Our future endeavors will provide a definitive answer.

What are the biological functions of PLK1 SUMOylation? We have observed that SUMO modification of PLK1 leads to a multitude of functional effects. It has been established that nuclear-cytoplasmic shuttling of PLK1 is critical for the execution of its function (Lee et al., 2009; Taniguchi et al., 2002). Disruption of NLSs on PLK1 could lead to cytoplasmic accumulation of PLK1 and mitotic aberrations. In this study, we demonstrate that SUMOylation modulates PLK’s cellular trafficking. Either downregulating Ubc9 or blocking the SUMO acceptor site (K492) on PLK1 caused cytoplasmic retention of PLK1 (Figure 4). These results suggest that PLK1 SUMOylation plays a critical role in regulating its subcellular localization. A recent study has reported that the same lysine residue, K492, is subject to mono-ubiquitination by a CUL3-based E3 ubiquitin ligase, which is important for its disassociation from the kinetochore during metaphase-anaphase transition (Beck et al., 2013). To corroborate that the absence of SUMO modification accounts for the mitotic defects that we observed in cells expressing the PLK1 K492R mutant, we took the following 3 approaches. 1) Blocking any modification on K492 and mimicking SUMO modification by fusing SUMO-1 at the C-terminus of the PLK1 K492R mutant. 2) Enhancing the efficiency of SUMO conjugation by fusing Ubc9 to the C-terminus of WT PLK1. Fusion of Ubc9 to C-terminus of the PLK1 K492R mutant was included as a control. 3) Knocking down KLHL22 in the cells to hamper mono-ubiquitination at K492. Excitingly, both SUMO-1-K492R and Ubc9-WT mutants were predominantly localized to the nucleus (Figure 4). In contrast, the Ubc9-K492 mutant exhibited a similar subcellular localization as the PLK1 K492R mutant (Figure S3). Consistent with this notion, subcellular localization of PLK1 was not affected upon depletion of KLHL22 (Figure S4). These results unambiguously demonstrate that SUMO modification of PLK1 is crucial for its nuclear import and exclude the possibility that mono-ubiquitination at the K492 site participates in the process.

Two NLSs in PLK1 have been identified so far (Lee et al., 2009; Taniguchi et al., 2002). One is located in its KD (residues 134–146), while the other one resides in its PBD (residues 396–433), which is proximal to the SUMO acceptor site on PLK1. It is likely that SUMO modification may well position PLK’s NLS for interaction with the nuclear import transporters, thereby facilitating its nuclear import. Nevertheless, further investigation is needed to elucidate the exact mechanism by which SUMOylation influences the intracellular trafficking of PLK1. Enhancing nuclear import of PLK1 could have at least 2 effects on PLK1. First, nuclear translocation allows for rapid accumulation of PLK1, which could greatly facilitate its nuclear functions. Second, a recent study demonstrates that cytoplasmic PLK1 is ubiquitinated and subsequently degraded by the SCFβ– TrCP/proteasome (Giraldez et al., 2017). Translocation of PLK1 to the nucleus would thus prevent cytoplasmic degradation of PLK1. These 2 effects would permit rapid changes in the distribution and function of PLK1 during M phase.

In addition, SUMOylation of PLK1 regulates PLK1’s protein stability during M phase. Gain- and loss-of-function analyses demonstrate that Ubc9 positively regulates PLK1 protein stability by protecting it from proteasomal degradation (Figure 2). Our subsequent characterization revealed that Ubc9 executes this function via SUMO modification of PLK1 (Figures 3 and 5). Previous studies have shown that PLK1 is actively degraded during exit from mitosis via ubiquitination by the APC/Ccdh1 ubiquitin ligase (Lindon and Pines, 2004). Our observation that Cdh1 preferentially binds to PLK1 K492R compared to PLK1 WT, or SUMO-1-K492R in late mitosis (Figure 5D) supports the notion that covalent attachment of the SUMO moiety remodels PLK1, providing new protein-protein interaction interfaces, which results in a reduction in its association with APC/Ccdh1 and thereby protects it from proteasome-mediated degradation.

SUMO modification of PLK1 also plays an important role in cell cycle progression and genomic integrity. We observed numerous mitotic defects, including misaligned and/or mis-segregated chromosomes, and prolonged early mitotic progression, in cells expressing PLK1 K492R or with Ubc9 knocked down, which can be reversed by fusing PLK1 K492R with SUMO-1 to mimic SUMOylation or by fusing PLK1 WT, but not K492R mutant, with Ubc9 to enhance SUMO conjugation (Figures 6C–D, S5, and S6). Our results clearly indicate that a lack of SUMO modification is sufficient to cause the effects observed with the K492R mutant. With respect to the underlying mechanisms, SUMOylation-mediated nuclear import and stabilization of the PLK1 protein could account for most of the biological functions of SUMOylated PLK1. However, other mechanisms may also be involved. For instance, SUMO conjugation of PLK1 may modulate the interactions between PLK1 and its mitotic substrates. Further investigations are warranted to fully explore the functional effects of SUMO modification on PLK1.

It has been reported in previous studies that inactivating CUL3-KLHL22 or blocking the PTM at the K492 residue on PLK1 results in accumulation of PLK1 at kinetochores and subsequent activation of spindle assembly checkpoint (SAC) (Beck et al., 2013). Together with our exciting findings reported here, we hypothesize that the residue K492 on PLK1 is a critical regulatory site, which is differentially regulated by different PTMs (SUMOylation and mono-ubiquitination), leading to diverse cellular functions. While mono-ubiquitination of K492 controls the dynamics of PLK1-kinetochore association, SUMOylation of that site dominates PLK1’s nuclear importing, its protein stability, and thereby the mitotic function of PLK1. Further studies are needed to provide a definitive answer.

In summary, our data have identified and characterized another important regulatory mechanism governing PLK1’s function. We show that PTM of PLK1 by SUMO-1 conjugation can promote its nuclear translocation and enhance its protein stability, which are required for normal cell cycle progression and genomic integrity. Uncovering this important regulatory pathway provides new insights into the biology of PLK1, which is essential for exploring PLK1’s potential as an important target for cancer therapy.

EXPERIMENTAL PROCEDURES

Plasmids and Small Hairpin RNAs

pCMV-Myc-Ubc9 was a generous gift from Dr. W. T. Beck (University of Illinois). pRc/CMV-Myc-PLK1 WT was a gift from Dr. E. A. Nigg (Max Planck Institute of Biochemistry). pCGT-T7-SUMO-1 was kindly provided by Dr. H. Yokosawa (Hokkaido University). pcDNA3.1-HA-SUMO-1, pcDNA3.1-HA-SUMO2, pSG5-His-SUMO-1, and mcherry-H2B plasmids were purchased from Addgene. pRc/CMV-Flag-Myc-PLK1 K19R, K156R, K178R, K191R, K265R, K358R, K492R, and K601R mutants were generated by PCR-based mutagenesis (Stratagene). cDNA encoding SUMO-1 was amplified by PCR and subcloned in-frame to the 3′ end of the PLK1 K492R cDNA to generate pRc/CMV-Flag-Myc-K492R-SUMO-1. The sequences of primers were as follows: forward, CGTCTCAAGGCCTCCTCAGAGATTGTACAGAATATTTC; reverse, GAAATATTCTGTACAATCTCTGAGGAGGCCTTGAGACG. cDNA encoding Ubc9 was amplified by PCR and subcloned in-frame to the 3′ end of the PLK1 WT or K492R cDNA to generate pRc/CMV-Flag-Myc-WT-Ubc9 and pRc/CMV-Flag-Myc-K492R-Ubc9, respectively. The sequences of primers were as follows: forward, AGCTAAGCTTATGGATTACAAGGATGACGATG; reverse, AGCTTCTAGATTATGAGGGCGCAAACTTCTT. MISSION lentiviral shRNA for PLK1 (TRCN0000121072; Clone ID: NM_005030.3-1893s1c1) was from Sigma-Aldrich, as described previously (Wu et al., 2016). Lentiviral shRNAs for Ubc9 (1#: Clone ID: V2LHS_171781; 2#: Clone ID: V2LHS_254973) were from Open Biosystems. Pooled siRNA duplexes against human KLHL22 (access no. M-015847-01-0005) and control siRNA (accession no. D-001810-10-05) were purchased from Dharmacon.

Immunoprecipitation, Western blot, and Antibodies

Cells were harvested and washed twice with cold PBS. Collected cells were lysed with NETN lysis buffer (150 mM NaCl, 1 mM EDTA, 20 mM Tris [pH 8], 0.5% Nonidet P-40) containing a protease inhibitor cocktail (Sigma-Aldrich). For the SUMOylation assay, 1% SDS and 20 mM NEM were also added. Next, cell lysates were sonicated and then cleared using centrifugation (4°C, 20,000 g, 10 min, twice). The supernatant was then incubated with an antibody/bead conjugate at 4°C for 4 h. Immunoprecipitates were then subjected to immunoblot analysis with the indicated antibodies. The following antibodies were used in the study: anti-PLK1 (Thermo Fisher Scientific), anti-Flag (Sigma-Aldrich), anti–β-actin (Sigma-Aldrich), anti-Ubc9 (Abcam), anti-Myc (BD), anti-HA (Vandenise), anti-T7 (Novagen), anti-SUMO-1 (Invitrogen), anti-His (Cell Signaling), anti-α-tubulin (Sigma-Aldrich), anti-ubiquitin (Upstate), anti-lamin A/C (Assay Biotech), anti-GAPDH (Santa Cruz Biotechnology), anti-cdh1 (Santa Cruz Biotechnology), anti-cyclin B1 (Santa Cruz Biotechnology), and anti-KLHL22 (Proteintech).

Immunofluorescence Staining

Cells grown on coverslips were fixed with 4% paraformaldehyde solution for 15 min at room temperature, and then permeabilized with 0.5% Triton X-100 for 5 min. After being washed 3 times with PBS, cells were blocked with 3% bovine serum albumin at room temperature for 30 min and then incubated with anti-PLK1, anti-SUMO-1, anti-Ubc9, or anti-Flag antibody for 1 h at room temperature. Cells were then washed 3 times with PBS before being incubated with fluorescent-labeled secondary antibodies. Cells were washed 3 more times, mounted on slides with Prolong Gold Antifade (Life Technologies), and then examined using a Zeiss LSM700 laser scanning confocal microscope (Carl Zeiss).

Cell Culture and Transfection

U2OS cells, HeLa cells, and 293T cells (purchased from ATCC) were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) with 10% fetal bovine serum (Gibco), Antibiotic-Antimycotic solution (Gibco), and MEM Non-Essential Amino Acids Solution (Gibco) in a humidified, 5% CO2 atmosphere at 37°C. Transient transfection of U2OS and 293T cells was performed with lipofectamine 3000 according to the manufacturer’s instructions.

Synchronization and Reagents

To synchronize HeLa and U2OS cells at the G1/S boundary, cells were treated with 2 mM thymidine for 18 h, released for 10 h, and then treated with 2 μg/mL aphidicolin for 18 h (Yuan et al., 2014). The inhibitors used included CHX, fluorouracil, MG132, nocodazole, leptomycin B, L-mimosine, and thymidine, aphidicolin, Taxol (Sigma-Aldrich), and hesperidin (MedChem Express).

Lentivirus Preparation and Infection

To produce lentivirus, a lentiviral vector containing shRNA (shRNA PLK1 3′-UTR, shRNA Ubc9-1 and 2) or a transgene (mcherry-H2B) along with packing (psPAX2) and envelope (pMD2.G) vectors were transfected into 293T cells using lipofectamine 2000. The supernatants were collected after transfection for 48 h and 72 h, filtrated with 0.44 μm filters, and concentrated by ultracentrifugation at 28,000 rpm at 4°C for 2 h. Resuspended viral pellets were used to infect cells in the presence of 8 μg/mL polybrene.

GST Pull-Down

To generate Ubc9 protein, pCDNA3-Ubc9 was expressed through in vitro translation using the TNT T7 Quick Coupled Transcription/Translation System (Promega) according to the manufacturer’s instructions. To generate GST, GST-PLK1, GST PBD WT and MUT, pGEX-4T-1, pGEX-4T-1-PLK1, pGEX-4T-1-PBD WT and pGEX-4T-1-PBD MUT were transduced into BL21 complete cells. Protein expression was induced by IPTG. GST-PLK1 and GST were purified and bound to glutathione-sepharose resins. Resins were incubated with in vitro translated Ubc9 for 1 h at 4°C and washed at least 4 times using NETN buffer. Resin-bound complexes were eluted by boiling and subjected to Western blot.

In Vitro SUMOylation Assay

SUMOylation reactions were carried out using an in vitro SUMOylation kit from Active Motif. Each reaction included 500 ng commercial PLK1, 1 μL E1, 2 μL E2, and 3 μL SUMO-1 WT or SUMO-1 MUT at 30°C for 3 h. Reactions were stopped by adding an equal volume of 2×SDS-PAGE loading buffer and boiling for 5 min at 100°C. The reaction products were subjected to Western blot. A more detailed protocol can be found in the manufacturer’s instructions (Active Motif).

Subcellular Protein Fractionation

Cells were washed twice and lysed in hypotonic buffer (10 mM HEPES-KOH, 10 mM KCl, 1.5 mM MgCl2, 0.2 mM PEFA1023 [pH 7.9], 0.5% Nonidet P-40, 20 mM NEM, and protease inhibitor cocktail). Cell lysates were centrifuged at 4°C for 10 min at 16,000g. Supernatants were collected as cytoplasmic extracts, and pellets were washed twice with hypotonic buffer before being lysed with high-salt buffer (450 mM NaCl, 50 mM Tris-HCl, 2 mM DTT, 1% NP-40, 20 mM NEM, and protease inhibitor cocktail) at 4°C on a rotator for 10 min. Cell lysates were centrifuged at 4°C for 15 min at 16,000g, and supernatants were collected as nuclear extracts. Equal amounts of cytoplasmic and nuclear extracts were subjected to Western blot (Zhang et al., 2015).

Cell Cycle Analysis by Flow Cytometry

Cells were detached from dishes using trypsin, centrifuged, and fixed using 75% ethanol for at least 1 h. Cells were then washed 3 times in PBS, treated with 20 μg/mL RNase and 50 μg/mL propidium iodide (PI) at 37°C for 30 min, and analyzed on a FACScan flow cytometer (Becton Dickinson). For phospho-histone H3 (Ser10) detection, cells were washed and permeabilized using 0.5% triton X-100, incubated with anti-phospho-Histone H3 (Ser10) antibody (Millipore, 1:1000) for 1 h at room temperature and then secondary antibody before RNase treatment and PI staining.

Time-lapse Microscopy Assay

Endogenous PLK1 was knocked down in U2OS cells stably expressing PLK1 WT, K492R, SUMO-1-K492R, Ubc9-WT, or Ubc9-K492R constructs by targeting the endogenous 3′-UTR on PLK1. The cells were infected with lentiviral H2B-mGFP constructs, and synchronized at G1/S phase as described previously (Yuan et al., 2014), and then released and imaged for 9 h at 3-min time intervals. For all time-lapse recordings, the culture dish was placed in a microincubator to maintain proper environmental conditions (37°C, pH7.4). All images were acquired using a Zeiss Cell Observer Spinning Disc confocal microscope.

Statistical Analysis

All experiments were performed at least 3 times in triplicates for each group. All statistical tests were performed using GraphPad Prism version 6.02 for Windows (GraphPad Software). Quantitative data are presented as mean ± s.e.m, and p<0.05 was considered statistically significant. A two-tailed Student’s t-test was used to compare differences between treated groups and their paired controls.

Supplementary Material

supplement

Acknowledgments

This work was supported by grants from the American Cancer Society (ACS Research Scholar Grant 127626-RSG-15-005-01-CCG to Z.F.), and the National Institutes of Health (NIH R01 CA191002 to Z.F.). The authors thank Heidi Sankala Bauer for editorial assistance with the manuscript.

Footnotes

AUTHOR CONTRIBUTIONS

D.W. performed the experiments, analyzed and interpreted data, and drafted the article. J.W. performed the experiments, and analyzed and interpreted data. L.W. performed the experiments. Z.F. designed experiments, performed the experiments, analyzed and interpreted data, and drafted and revised the article.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Azuma Y, Dasso M. A new clue at the nuclear pore: RanBP2 is an E3 enzyme for SUMO1. Dev Cell. 2002;2:130–131. doi: 10.1016/s1534-5807(02)00124-7. [DOI] [PubMed] [Google Scholar]
  2. Barysch SV, Dittner C, Flotho A, Becker J, Melchior F. Identification and analysis of endogenous SUMO1 and SUMO2/3 targets in mammalian cells and tissues using monoclonal antibodies. Nat Protoc. 2014;9:896–909. doi: 10.1038/nprot.2014.053. [DOI] [PubMed] [Google Scholar]
  3. Beck J, Maerki S, Posch M, Metzger T, Persaud A, Scheel H, Hofmann K, Rotin D, Pedrioli P, Swedlow JR, et al. Ubiquitylation-dependent localization of PLK1 in mitosis. Nat Cell Biol. 2013;15:430–439. doi: 10.1038/ncb2695. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bettermann K, Benesch M, Weis S, Haybaeck J. SUMOylation in carcinogenesis. Cancer Lett. 2012;316:113–125. doi: 10.1016/j.canlet.2011.10.036. [DOI] [PubMed] [Google Scholar]
  5. Cholewa BD, Liu X, Ahmad N. The role of polo-like kinase 1 in carcinogenesis: cause or consequence? Cancer Res. 2013;73:6848–6855. doi: 10.1158/0008-5472.CAN-13-2197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Dasso M. Emerging roles of the SUMO pathway in mitosis. Cell Div. 2008;3:5. doi: 10.1186/1747-1028-3-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Dawlaty MM, Malureanu L, Jeganathan KB, Kao E, Sustmann C, Tahk S, Shuai K, Grosschedl R, van Deursen JM. Resolution of sister centromeres requires RanBP2-mediated SUMOylation of topoisomerase IIalpha. Cell. 2008;133:103–115. doi: 10.1016/j.cell.2008.01.045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. de Carcer G, Manning G, Malumbres M. From Plk1 to Plk5: functional evolution of polo-like kinases. Cell Cycle. 2011;10:2255–2262. doi: 10.4161/cc.10.14.16494. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Elia AE, Cantley LC, Yaffe MB. Proteomic screen finds pSer/pThr-binding domain localizing Plk1 to mitotic substrates. Science. 2003;299:1228–1231. doi: 10.1126/science.1079079. [DOI] [PubMed] [Google Scholar]
  10. Elowe S, Hummer S, Uldschmid A, Li X, Nigg EA. Tension-sensitive Plk1 phosphorylation on BubR1 regulates the stability of kinetochore microtubule interactions. Genes Dev. 2007;21:2205–2219. doi: 10.1101/gad.436007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Fernandez-Miranda G, Perez de Castro I, Carmena M, Aguirre-Portoles C, Ruchaud S, Fant X, Montoya G, Earnshaw WC, Malumbres M. SUMOylation modulates the function of Aurora-B kinase. J Cell Sci. 2010;123:2823–2833. doi: 10.1242/jcs.065565. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Fu Z, Malureanu L, Huang J, Wang W, Li H, van Deursen JM, Tindall DJ, Chen J. Plk1-dependent phosphorylation of FoxM1 regulates a transcriptional programme required for mitotic progression. Nat Cell Biol. 2008;10:1076–1082. doi: 10.1038/ncb1767. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Giraldez S, Galindo-Moreno M, Limon-Mortes MC, Rivas AC, Herrero-Ruiz J, Mora-Santos M, Saez C, Japon MA, Tortolero M, Romero F. G1/S phase progression is regulated by PLK1 degradation through the CDK1/betaTrCP axis. Faseb J. 2017:30. doi: 10.1096/fj.201601108R. [DOI] [PubMed] [Google Scholar]
  14. Hauf S, Cole RW, LaTerra S, Zimmer C, Schnapp G, Walter R, Heckel A, van Meel J, Rieder CL, Peters JM. The small molecule Hesperadin reveals a role for Aurora B in correcting kinetochore-microtubule attachment and in maintaining the spindle assembly checkpoint. J Cell Biol. 2003;161:281–294. doi: 10.1083/jcb.200208092. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hay RT. SUMO: a history of modification. Mol Cell. 2005;18:1–12. doi: 10.1016/j.molcel.2005.03.012. [DOI] [PubMed] [Google Scholar]
  16. Holmstrom S, Van Antwerp ME, Iniguez-Lluhi JA. Direct and distinguishable inhibitory roles for SUMO isoforms in the control of transcriptional synergy. Proc Natl Acad Sci U S A. 2003;100:15758–15763. doi: 10.1073/pnas.2136933100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Jakobs A, Himstedt F, Funk M, Korn B, Gaestel M, Niedenthal R. Ubc9 fusion-directed SUMOylation identifies constitutive and inducible SUMOylation. Nucleic Acids Res. 2007a;35:20. doi: 10.1093/nar/gkm617. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Jakobs A, Koehnke J, Himstedt F, Funk M, Korn B, Gaestel M, Niedenthal R. Ubc9 fusion-directed SUMOylation (UFDS): a method to analyze function of protein SUMOylation. Nat Methods. 2007b;4:245–250. doi: 10.1038/nmeth1006. [DOI] [PubMed] [Google Scholar]
  19. Jang YJ, Ma S, Terada Y, Erikson RL. Phosphorylation of threonine 210 and the role of serine 137 in the regulation of mammalian polo-like kinase. J Biol Chem. 2002;277:44115–44120. doi: 10.1074/jbc.M202172200. [DOI] [PubMed] [Google Scholar]
  20. Johnson ES. Protein modification by SUMO. Annu Rev Biochem. 2004;73:355–382. doi: 10.1146/annurev.biochem.73.011303.074118. [DOI] [PubMed] [Google Scholar]
  21. Kim KI, Baek SH. SUMOylation code in cancer development and metastasis. Mol Cells. 2006;22:247–253. [PubMed] [Google Scholar]
  22. Klein UR, Haindl M, Nigg EA, Muller S. RanBP2 and SENP3 function in a mitotic SUMO2/3 conjugation-deconjugation cycle on Borealin. Mol Biol Cell. 2009;20:410–418. doi: 10.1091/mbc.E08-05-0511. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Lee MS, Huang YH, Huang SP, Lin RI, Wu SF, Li C. Identification of a nuclear localization signal in the polo box domain of Plk1. Biochim Biophys Acta. 2009;10:23. doi: 10.1016/j.bbamcr.2009.07.005. [DOI] [PubMed] [Google Scholar]
  24. Lindon C, Pines J. Ordered proteolysis in anaphase inactivates Plk1 to contribute to proper mitotic exit in human cells. J Cell Biol. 2004;164:233–241. doi: 10.1083/jcb.200309035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Liu X, Zhou T, Kuriyama R, Erikson RL. Molecular interactions of Polo-like-kinase 1 with the mitotic kinesin-like protein CHO1/MKLP-1. J Cell Sci. 2004;117:3233–3246. doi: 10.1242/jcs.01173. [DOI] [PubMed] [Google Scholar]
  26. Liu XS, Song B, Liu X. The substrates of Plk1, beyond the functions in mitosis. Protein Cell. 2010;1:999–1010. doi: 10.1007/s13238-010-0131-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Lowery DM, Lim D, Yaffe MB. Structure and function of Polo-like kinases. Oncogene. 2005;24:248–259. doi: 10.1038/sj.onc.1208280. [DOI] [PubMed] [Google Scholar]
  28. Macurek L, Lindqvist A, Lim D, Lampson MA, Klompmaker R, Freire R, Clouin C, Taylor SS, Yaffe MB, Medema RH. Polo-like kinase-1 is activated by aurora A to promote checkpoint recovery. Nature. 2008;455:119–123. doi: 10.1038/nature07185. [DOI] [PubMed] [Google Scholar]
  29. Muller S, Hoege C, Pyrowolakis G, Jentsch S. SUMO, ubiquitin’s mysterious cousin. Nat Rev Mol Cell Biol. 2001;2:202–210. doi: 10.1038/35056591. [DOI] [PubMed] [Google Scholar]
  30. Nacerddine K, Lehembre F, Bhaumik M, Artus J, Cohen-Tannoudji M, Babinet C, Pandolfi PP, Dejean A. The SUMO pathway is essential for nuclear integrity and chromosome segregation in mice. Dev Cell. 2005;9:769–779. doi: 10.1016/j.devcel.2005.10.007. [DOI] [PubMed] [Google Scholar]
  31. Park JE, Soung NK, Johmura Y, Kang YH, Liao C, Lee KH, Park CH, Nicklaus MC, Lee KS. Polo-box domain: a versatile mediator of polo-like kinase function. Cell Mol Life Sci. 2010;67:1957–1970. doi: 10.1007/s00018-010-0279-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Ross S, Best JL, Zon LI, Gill G. SUMO-1 modification represses Sp3 transcriptional activation and modulates its subnuclear localization. Mol Cell. 2002;10:831–842. doi: 10.1016/s1097-2765(02)00682-2. [DOI] [PubMed] [Google Scholar]
  33. Schwarz SE, Matuschewski K, Liakopoulos D, Scheffner M, Jentsch S. The ubiquitin-like proteins SMT3 and SUMO-1 are conjugated by the UBC9 E2 enzyme. Proc Natl Acad Sci U S A. 1998;95:560–564. doi: 10.1073/pnas.95.2.560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Seeler JS, Bischof O, Nacerddine K, Dejean A. SUMO, the three Rs and cancer. Curr Top Microbiol Immunol. 2007;313:49–71. doi: 10.1007/978-3-540-34594-7_4. [DOI] [PubMed] [Google Scholar]
  35. Seeler JS, Dejean A. Nuclear and unclear functions of SUMO. Nat Rev Mol Cell Biol. 2003;4:690–699. doi: 10.1038/nrm1200. [DOI] [PubMed] [Google Scholar]
  36. Seki A, Coppinger JA, Jang CY, Yates JR, Fang G. Bora and the kinase Aurora a cooperatively activate the kinase Plk1 and control mitotic entry. Science. 2008;320:1655–1658. doi: 10.1126/science.1157425. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Seufert W, Futcher B, Jentsch S. Role of a ubiquitin-conjugating enzyme in degradation of S- and M-phase cyclins. Nature. 1995;373:78–81. doi: 10.1038/373078a0. [DOI] [PubMed] [Google Scholar]
  38. Su YF, Yang T, Huang H, Liu LF, Hwang J. Phosphorylation of Ubc9 by Cdk1 enhances SUMOylation activity. PLoS One. 2012;7:3. doi: 10.1371/journal.pone.0034250. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Tang J, Yang X, Liu X. Phosphorylation of Plk1 at Ser326 regulates its functions during mitotic progression. Oncogene. 2008;27:6635–6645. doi: 10.1038/onc.2008.262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Taniguchi E, Toyoshima-Morimoto F, Nishida E. Nuclear translocation of plk1 mediated by its bipartite nuclear localization signal. J Biol Chem. 2002;277:48884–48888. doi: 10.1074/jbc.M206307200. [DOI] [PubMed] [Google Scholar]
  41. Tsvetkov L, Stern DF. Phosphorylation of Plk1 at S137 and T210 is inhibited in response to DNA damage. Cell Cycle. 2005;4:166–171. doi: 10.4161/cc.4.1.1348. [DOI] [PubMed] [Google Scholar]
  42. van Vugt MA, Bras A, Medema RH. Polo-like kinase-1 controls recovery from a G2 DNA damage-induced arrest in mammalian cells. Mol Cell. 2004;15:799–811. doi: 10.1016/j.molcel.2004.07.015. [DOI] [PubMed] [Google Scholar]
  43. Wilkinson KA, Henley JM. Mechanisms, regulation and consequences of protein SUMOylation. Biochem J. 2010;428:133–145. doi: 10.1042/BJ20100158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Wilson VG, Rangasamy D. Intracellular targeting of proteins by sumoylation. Exp Cell Res. 2001;271:57–65. doi: 10.1006/excr.2001.5366. [DOI] [PubMed] [Google Scholar]
  45. Wolff B, Sanglier JJ, Wang Y. Leptomycin B is an inhibitor of nuclear export: inhibition of nucleo-cytoplasmic translocation of the human immunodeficiency virus type 1 (HIV-1) Rev protein and Rev-dependent mRNA. Chem Biol. 1997;4:139–147. doi: 10.1016/s1074-5521(97)90257-x. [DOI] [PubMed] [Google Scholar]
  46. Wu J, Ivanov AI, Fisher PB, Fu Z. Polo-like kinase 1 induces epithelial-to-mesenchymal transition and promotes epithelial cell motility by activating CRAF/ERK signaling. Elife. 2016;22:10734. doi: 10.7554/eLife.10734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Yang F, Hu L, Chen C, Yu J, O’Connell CB, Khodjakov A, Pagano M, Dai W. BubR1 is modified by sumoylation during mitotic progression. J Biol Chem. 2012;287:4875–4882. doi: 10.1074/jbc.M111.318261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Yuan C, Wang L, Zhou L, Fu Z. The function of FOXO1 in the late phases of the cell cycle is suppressed by PLK1-mediated phosphorylation. Cell Cycle. 2014;13:807–819. doi: 10.4161/cc.27727. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Yurchenko V, Xue Z, Sadofsky MJ. SUMO modification of human XRCC4 regulates its localization and function in DNA double-strand break repair. Mol Cell Biol. 2006;26:1786–1794. doi: 10.1128/MCB.26.5.1786-1794.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Zhang J, Yuan C, Wu J, Elsayed Z, Fu Z. Polo-like kinase 1-mediated phosphorylation of Forkhead box protein M1b antagonizes its SUMOylation and facilitates its mitotic function. J Biol Chem. 2015;290:3708–3719. doi: 10.1074/jbc.M114.634386. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Zhang XD, Goeres J, Zhang H, Yen TJ, Porter AC, Matunis MJ. SUMO-2/3 modification and binding regulate the association of CENP-E with kinetochores and progression through mitosis. Mol Cell. 2008;29:729–741. doi: 10.1016/j.molcel.2008.01.013. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

supplement

RESOURCES