Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2017 Dec 20;8(1):26. doi: 10.1007/s13205-017-1041-x

Improvement in xylooligosaccharides production by knockout of the β-xyl1 gene in Trichoderma orientalis EU7-22

Chuannan Long 1,2, Jingjing Cui 1,3,4, Hailong Li 3,5, Jian Liu 3, Lihui Gan 3, Bin Zeng 1,2, Minnan Long 3,✉
PMCID: PMC5736498  PMID: 29279819

Abstract

The goal of this study was to enhance the production of xylooligosaccharides (XOs) and reduce the production of xylose. We investigated β-xylosidases, which were key enzymes in the hydrolysis of xylan into xylose, in Trichoderma orientalis EU7-22. The binary vector pUR5750G/bxl::hph was constructed to knock out the β-xyl1 gene (encoding β-xylosidases) in T. orientalis EU7-22 by homologous integration, producing the mutant strain T. orientalis Bxyl-1. Xylanase activity for strain Bxyl-1 was 452.42 IU/mL, which increased by only 0.07% compared to that of parental strain EU7-22, whereas β-xylosidase activity was 0.06 IU/mL, representing a 91.89% decrease. When xylanase (200 IU/g xylan), produced by T. orientalis EU7-22 and T. orientalis Bxyl-1, was used to hydrolyze beechwood xylan, in contrast to the parental strain, the XOs were enhanced by 83.27%, whereas xylose decreased by 45.80% after 36 h in T. orientalis Bxyl-1. Based on these results, T. orientalis Bxyl-1 has great potential for application in the production of XOs from lignocellulosic biomass.

Keywords: Trichoderma orientalis, Xylanase, β-xylosidase, β-xyl1 gene, Xylooligosaccharides, Xylose

Introduction

Hemicellulose, a main element of lignocellulosic biomass, is the second most abundant polysaccharide in nature. Xylan is a major component of hemicellulose, which can be used to manufacture xylooligosaccharides (XOs) (Vazquez et al. 2000; Huang et al. 2017). However, because the xylan–lignin complex in lignocellulosic biomass resists hydrolysis, XOs are produced in two steps: alkaline extraction of xylan from lignocellulosic biomass, followed by enzymatic hydrolysis (Vazquez et al. 2000; Akpinar et al. 2007; Chapla et al. 2012). Compared to acid hydrolysis, enzymatic hydrolysis is an attractive approach, because it does not yield undesirable by-products and does not require special equipment (Chapla et al. 2012; Bosetto et al. 2016; Huang et al. 2017). Of course, complete degradation of xylan requires xylanolytic enzymes such as endo-β-1,4-xylanase, β-xylosidases, and debranching enzymes (Collins et al. 2005; Knob et al. 2010; Bosetto et al. 2016; Huang et al. 2017). The main chain of xylan is randomly degraded by endo-β-1,4-xylanase to produce oligosaccharides. Then, the XOs are further hydrolyzed into xylose by β-xylosidases. Therefore, high endo-β-1,4-xylanase activity and the production of no β-xylosidases are desirable in XO production (Chen et al. 2009; Knob et al. 2010; Sabiha-Hanim et al. 2011; Bosetto et al. 2016).

Trichoderma spp., a well-known filamentous fungi, show good capacity to degrade lignocellulosic biomass. Herrmann et al. (1997) reported that purified β-xylosidases from Trichoderma reesei were multifunctional β-d-xylan xylohydrolases. Chen et al. (2009) studied the activity of purified endo-β-1,4-xylanase in Trichoderma sp. K9301 during XO production. Choengpanya et al. (2015) reported the function of β-xylosidase in Aspergillus niger ASKU28. However, there has been no report on the effect of knocking out the β-xyl1 gene, which encodes β-xylosidases, on XO production in filamentous fungi.

In eukaryotes, DNA double-strand break (DSBs) repair mainly occurs via homologous recombination (HR) and non-homologous end-joining (NHEJ), which act independently but competitively (Dyck et al. 1999). NHEJ is the dominant pathway in many eukaryotes such as plants, mammals, insects, and filamentous fungi (Pastink et al. 2001; Tachibana 2004). Gene targeting (knockout), which can be used to delete genes and replace alleles (Feng et al. 2012), is a useful technique to study gene function in living organisms, especially in filamentous fungi (Carvalho et al. 2010; Kück and Hoff 2010). Normally, gene replacement frequencies in filamentous fungi are less than 30%, so it is a time-consuming process to generate homologous transformants (Meyer 2008; Kück and Hoff 2010).

In this study, we investigated knockout of the β-xyl1 gene (GenBank no. JQ238612) from Trichoderma orientalis EU7-22 by homologous recombination. The differences in the activities of enzymes and production of XOs between parent strains and mutant strains were determined.

Materials and methods

Strains

The hemicellulase-producing strain T. orientalis EU7-22 was used as a host for knockout of the β-xyl1 gene (GenBank no. JQ238612). Escherichia coli DH5a was used for vector construction. Agrobacterium tumefaciens AGL1 was used to mediate transformation (Long et al. 2013).

Plasmid construction and molecular analysis of the mutant strain

The T-DNA binary vector pUR5750G/bxl::hph was constructed to knock out β-xyl1 on the backbone of pUR5750G (Fig. 1a). All 2394 bp of the β-xyl1 gene was amplified by PCR using primers BXL-F & R (Fig. 1b, primers F2 and R2), with the total DNA from T. orientalis EU7-22 used as a template. The first homologous arm (fragment I = 946 bp) of the β-xyl1 gene was amplified by PCR with primers BXL-QC1F (containing KpnI) and BXL-QC1R (containing Sac I) (Fig. 1b, primers F1 and R1), and it was inserted into the KpnI/SacI site of pUR5750G. At the same time, the second homologous arm (fragment II = 925 bp) was obtained by digesting the β-xyl1 DNA fragment with XbaI/HindIII (Fig. 1b), and it was inserted into the XbaI/HindIII site of pUR5750G. The sequences of the primers used in this study are listed in Table 1.

Fig. 1.

Fig. 1

Open in a new tab

Schematic map of the vector and primer loci for knockout of the β-xyl1 gene. a pUR5750G; b F1 primer BXL-QC1F, R1 primer BXL-QC1R, F2 primer BXL-F, R2 primer BXL-R, F3 primer HtrpC-F, R3 primer BXL-YZR, F4 primer Hph-F, R4 primer Hph-R

Table 1.

Primers used in this study

Primer name Primer sequence (5′–3′) Description
BXL-QC1F CGGGGTACCGGCCCTGGCGCAAAACAATC For amplification of the 946-bp fragment I
BXL-QC1R CCGAGCTCAGCGGCAGACGACTGGTTGC
BXL-F ATGGTGAATAACGCAGCTCTTCTCG For amplification of the 2394-bp bxyl gene
BXL-R TTATGCGTCAGGTGTAGCATCCTTG
Hph-F CGACAGCGTCTCCGACCTGA For detection of the 811-bp hph gene fragment
Hph-R CGCCCAAGCTGCATCATCGAA
HtrpC-F AGGAATAGAGTAGATGCCGACC For detection of the 1748-bp knockout fragment
BXL-YZR TGTAGCATCCTTGATCTGTTGC
Open in a new tab

The binary vector pUR5750G/bxl::hph was transferred to the parental strain T. orientalis EU7-22 via A. tumefaciens-mediated transformation (ATMT) (Long et al. 2013). The mutant strain was analyzed by PCR (Fig. 2).

Fig. 2.

Fig. 2

Open in a new tab

Identification of T. orientalis Bxyl-1, Bxyl-2, Bxyl-3, Bxyl-4 transformants using a molecular method. a Primers BXL-F and BXL-R test, lanes 1–5 represent T. orientalis EU7-22 and transformants T. orientalis Bxyl-1, Bxyl-2, Bxyl-3, Bxyl-4, and total DNA as a template, respectively. b Primers HtrpC-F and BXL-YZR test, lanes 1–5 represent T. orientalis EU7-22 and transformants H. orientalis Bxyl-1, Bxyl-2, Bxyl-3, and Bxyl-4 total DNA as templates, respectively. c Primers Hph-F and Hph-R test, lanes 1–4 represent transformants T. orientalis Bxyl-1, Bxyl-2, Bxyl-3, and Bxyl-4 total DNA as templates, respectively. Ma 200 bp DNA ladder marker; Mb DL5000 DNA Marker

Enzyme production and activity assay

Experiments were conducted in 250 mL Erlenmeyer flasks with T. orientalis EU7-22 and mutant strain Bxyl-1, which were incubated on a rotary shaker (37.3 °C, 180 rpm) for 3 days). The enzyme production medium (pH 5.2) consisted of the following: 1.5% (w/v) corn cobs, 1.5% (w/v) wheat bran, 0.5% (w/v) peptone, 0.4% (w/v) Tween-80, 0.04% (w/v) CaCl2, 0.04% (w/v) FeSO4, 0.08%(w/v) MgSO4, and 2.5 g/L KH2PO4.

Crude enzyme was first centrifuged (6000 rpm) for 10 min to remove the cells and solid medium. Enzyme activity in the supernatant was determined. Xylanase activity was assayed according to the method of Bailey et al. (1992) by measuring the total reducing sugars released from 1% (w/v) beechwood xylan (Sigma, St. Louis, USA, X4252) (1.0 mL) in citrate buffer (50 mM, pH 4.8). One unit of xylanase activity was defined as the amount of enzyme that produced 1 μmol xylose per minute and was expressed in IU/mL. β-xylosidases activity was assayed with 4-nitrophenyl β-d-xylopyranoside (pNPX, 5 mM) (Sigma, St. Louis, USA, N2132) as the substrate by measuring the amount of p-nitrophenol released (Lachke 1988). The mixture was incubated at 50 °C for 30 min, and the reaction was stopped by adding Na2CO3 (0.5 M). One unit of enzyme activity was defined as the amount of enzyme needed to liberate 1 μmol p-nitrophenol per min and was expressed in IU/mL. Filter paper activities (FPA) were measured as described by Ghose (1987). One unit of enzyme activity was defined as the amount of enzyme required to liberate 1 µM of reducing sugar per minute and was expressed in IU/mL.

Xylan hydrolysis

Beechwood xylan (0.5 g) was subjected to enzymatic hydrolysis of xylanase, the enzyme produced from parent strains and mutant strains. In 100 mL Erlenmeyer flasks, a fixed volume was reached by adding 25 mL buffer. The enzymatic hydrolysis experiments were performed according to the National Renewable Energy Laboratory analytical procedures, with 2% (w/v) solids loaded with 0.05 M citrate buffer (pH 4.8) into a thermostatically controlled shaker at 50 °C and the flasks placed in an incubator with a shaking speed of 150 rpm (Selig and Weiss 2008; Sabiha-Hanim et al. 2011). To prevent possible microbial growth on the sugars generated, 100 μL of 2% sodium azide was added. Xylanase (200 IU/g xylan) was transferred to the hydrolysis broth, and samples (0.5 mL) taken after 0.5, 1, 2, 4, 6, 8, 10, 12, 24, and 36 h of hydrolysis were analyzed.

High-performance liquid chromatography (HPLC) analysis of XOs and xylose

1-Phenyl-3-methyl-5-pyrazolone (PMP) (Acrose Organics, Belgium) derivatization of saccharides was carried out as described previously with proper modification (Li et al. 2013). Briefly, individual standard saccharides, mixed standard saccharides, or hydrolysates of xylan were dissolved in 0.3 M aqueous NaOH (50 μL), and a 0.5 M methanol solution of PMP (50 μL) was added to each solution. Each mixture was allowed to react for 60 min at 70 °C, then cooled to room temperature and neutralized with 0.3 M HCl (50 μL). The resulting solution was extracted with chloroform (1 mL), and the process was repeated three times; then, the aqueous layer was filtered through a 0.22 μm membrane. Xylotetraose (X4), xylotriose (X3), and xylobiose (X2) were obtained from Megazyme (Bray, Ireland), and xylose was purchased from Merck (Germany); all were standard saccharides (mg/mL). In this study, total XOs contained xylotetraose, xylotriose and xylobiose. PMP-labeled saccharides were analyzed on an HPLC system (Thermo Scientific Ultimate 3000) using a C18 column (Dionex Bonded Silica Products) (5 μm, 120A, 4.6 × 250 mm) and a column oven at 35 °C. The wavelength for UV detection was 245 nm. The product was eluted at a flow rate of 0.5 mL/min. Mobile phase A was phosphate buffer (40 mM, pH 6.7, 70%), and mobile phase B was acetonitrile (30%). The injection volume was 10 μL. The statistical significance of differences between the parent strain and the mutant strain was assessed by one-way analysis of variance.

Results and discussion

Obtaining the ⊿β-xyl1 mutant strain

After A. tumefaciens AGL1 successfully mediated pUR5750G/bxl::hph transformation into T. orientalis EU7-22 genome, four transformants were selected after 5 days of cultivation. These transformants were designated Bxyl-1, -2, -3, and -4, and all of them were shown to retain their mitotic stability. Genomic DNA from the four transformants was tested for the presence of the hph gene by PCR using specific primers Hph-F & R (Figs. 1b, primers F4 and R4, 2c).

At the same time, primers BXL-F & R (Fig. 1b, primers F2 and R2) were used to confirm the integration of the hph cassettes (2717 bp, PgpdA-hph-TtrpC) into the β-xyl1 locus (Fig. 2a). The length of the β-xyl1 gene was 2394 bp, and the gap between homologous arm fragment I and fragment II was 380 bp (Fig. 1b). That means there were 2337 base pairs more in the positive transformants than in the parent strain T. orientalis EU7-22 (Fig. 2a, lane 1). The transformant T. orientalis Bxyl-1 met this length specification (Fig. 2a, lane 2).

Then, primers HtrpC-F and BXL-YZR (Fig. 1b, primers F3 and R3) were used to confirm that the hph cassettes were integrated into the β-xyl1 gene locus. The amplified fragments (1748 bp) contained the TrpC terminator (748 bp), the second homologous arm (fragment II = 925 bp), and sequence downstream of fragment II (75 bp). There were no bands resulting from PCR of the parental strain T. orientalis EU7-22 (Fig. 2b, lane 1) or transformant T. orientalis Bxyl-2 (Fig. 2b, lane 3) obtained by PCR. There were, however, nonspecific amplification bands resulting from PCR of the transformants T. orientalis Bxyl-3 (Fig. 2b, lane 4) and T. orientalis Bxyl-4 (Fig. 2b, lane 5). In contrast, transformant T. orientalis Bxyl-1 showed the expected band after PCR amplification (Fig. 2b, lane 2). The data indicated that the hph cassette was successfully inserted into the β-xyl1 locus of transformant Bxyl-1, but that the hph cassette was randomly inserted into another three transformants. Therefore, the homologous recombination frequency was 25%.

Effect of β-xyl1 gene deletion on enzyme production

Xylanase and β-xylosidase activities and FPA for the mutant strain T. orientalis Bxyl-1 were 0.06, 452.42, and 0.96 IU/mL, respectively, whereas, for T. orientalis EU7-22s, these activities were 0.74, 422.11, and 0.95 IU/mL, respectively. These data indicated that there was no large impact of the β-xyl1 gene deletion on FPA activity. The xylanase activity in mutant strain Bxyl-1 only increased by 0.07%, but the β-xylosidase activity decreased by 91.89%. The β-xylosidase activity decreased significantly relative to that of the parental strain (p < 0.01) (Fig. 3). As expected, the ⊿β-xyl1 mutation resulted in the repression of β-xylosidase expression. β-xylosidases exhibited high activity with the substrate pNPX. A previous study showed that GH10 endo-β-1,4-xylanase also exhibited detectable activity with pNPX (Li et al. 2015). This may be why minor beta-xylosidases activity was detected in mutant strain Bxyl-1.

Fig. 3.

Fig. 3

Open in a new tab

Enzyme production from T. orientalis EU7-22 and T. orientalis Bxyl-1. The significance of the difference from T. orientalis EU7-22 is indicated by asterisks for T. orientalis Bxyl-1 in each group. **p < 0.01)

Hydrolysis of xylan to produce xylooligosaccharides and xylose

Figure 4 illustrates XO and xylose production from beechwood xylan by xylanase prepared from T. orientalis EU7-22 and T. orientalis Bxyl-1. As observed in the hydrolysis product curves, the concentration of xylotetraose (X4) increased rapidly to its peak value in the first 0.5 h, but then decreased and disappeared after 2 h. This pattern was similar for the two strains. The concentration of xylotriose (X3) also rapidly increased to its peak value in the first 0.5 h, then decreased gradually; however, xylotriose decreased faster in strain Bxyl-1 than in EU7-22. Xylotriose content decreased significantly relative to that of the parental strain at 12, 24, and 36 h (p < 0.01) (Fig. 4b). However, the concentration of xylobiose (X2) in the two strains sharply increased in the first 2 h; it increased gradually from 2 to 12 h, then decreased in strain EU7-22 and continued to increase through time in strain Bxyl-1. Compared to strain EU7-22, xylobiose production increased by 31.89, 31.77, 76.60, and 95.18% at 6, 12, 24, and 36 h, respectively, in strain Bxyl-1. Xylobiose content increased significantly relative to that of the parental strain at 6, 8, 10, 12, 24, and 36 h (p < 0.01) (Fig. 4b).

Fig. 4.

Fig. 4

Open in a new tab

Analysis of the hydrolysis product of beechwood xylan by T. orientalis EU7-22 and T. orientalis Bxyl-1. a Sugar content of XOs and xylose in T. orientalis EU7-22 and T. orientalis Bxyl-1. b Sugar content of xylotetraose (X4), xylotriose (X3), and xylobiose (X2) in T. orientalis EU7-22 and T. orientalis Bxyl-1. The significance of the difference from T. orientalis EU7-22 is indicated by asterisks for T. orientalis Bxyl-1 in each group. *0.05 < p < 0.01, **p < 0.01)

The concentration of xylose increased in the two strains at the same velocity, but there was only a slight difference between the xylose products from strain EU7-22 and Bxyl-1 in the first 6 h. Finally, the concentration of strain Bxyl-1 was lower than that of EU7-22, which decreased by 13.61, 24.12, and 45.80% at 12, 24, and 36 h, respectively. Xylose content decreased significantly relative to that of the parental strain at 24 and 36 h (p < 0.05) (Fig. 4a). Collectively, compared to strain EU7-22, the XOs (xylobiose, xylotriose, and xylotetraose) increased by 25.99, 24.73, 64.13, and 83.27% at 6, 12, 24, and 36 h, respectively, in strain Bxyl-1. XOs content increased significantly relative to that of the parental strain at 6, 8, 10, 12, 24, and 36 h (p < 0.01) (Fig. 4a).

Endo-β-1,4-xylanases hydrolyzed the β-1,4-glycosidic linkages of the xylan backbone to produce a large amount of XOs, as well as a small amount of xylose. Endo-β-1,4-xylanases from both GH10 and GH11 were not able to hydrolyze xylobiose (Li et al. 2015). β-xylosidases attack the non-reducing ends of short xylooligosaccharides to liberate xylose (Sorensen et al. 2003; Sabiha-Hanim et al. 2011; Rasmussem et al. 2006). Therefore, the hydrolysis product of xylobiose in Bxyl-1 was more than that in EU7-22, and the amount of xylose produced in Bxyl-1 was less than that in EU7-22. These results indicate that more XOs and less xylose can be produced using mutant strain T. orientalis Bxyl-1.

Conclusions

This study focused on β-xylosidases from T. orientalis EU7-22 to examine xylooligosaccharides production. The homologous integration vector pUR5750G/bxl::hph was constructed to knock out the β-xyl1 gene. We obtained the mutant strain T. orientalis Bxyl-1, which exhibited high xylanase activity and no β-xylosidase activity. XOs and xylobiose increased by 83.27 and 95.18%, respectively, for 36 h, whereas xylose decreased by 45.80% for 36 h in T. orientalis Bxyl-1. Based on these results, the mutant strain has great potential for application in the production of XOs from lignocellulosic biomass.

Acknowledgements

This work was supported by the National Natural Science Foundation of China (Grant nos. 31170067, 31600475, 21303142), Jiangxi Province Science Foundation for Youths (Grant no. 20161BAB214177), and Natural Science Foundation of Guangdong Province (Grant no. 2016A030310124).

Compliance with ethical standards

Conflict of interest

The authors declare no conflicts of interest.

References

  1. Akpinar O, Ak O, Kavas A, Bakir U, Yilmaz L. Enzymatic production of xylooligosaccharides from cotton stalk. J Agric Food Chem. 2007;55:5544–5551. doi: 10.1021/jf063580d. [DOI] [PubMed] [Google Scholar]
  2. Bailey MJ, Biely P, Poutanen K. Interlaboratory testing of methods for assay of xylanase activity. J Biotechnol. 1992;23:257–270. doi: 10.1016/0168-1656(92)90074-J. [DOI] [Google Scholar]
  3. Bosetto A, Justo PI, Zanardi B, Venzon SS, Graciano L, dos Santos EL, Simao RDG. Research progress concerning fungal and bacterial beta-xylosidases. Appl Microbiol Biotechnol. 2016;178(4):766–795. doi: 10.1007/s12010-015-1908-4. [DOI] [PubMed] [Google Scholar]
  4. Carvalho NDSP, Arentshorst M, Kwon MJ, Meyer V, Ram AFJ. Expanding the ku70 toolbox for filamentous fungi: establishment of complementation vectors and recipient strains for advanced gene analyses. Appl Microbiol Biotechnol. 2010;87(4):1463–1473. doi: 10.1007/s00253-010-2588-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chapla D, Pandit P, Shah A. Production of xylooligosaccharides from corncob xylan by fungal xylanase and their utilization by probiotics. Bioresour Technol. 2012;115:215–221. doi: 10.1016/j.biortech.2011.10.083. [DOI] [PubMed] [Google Scholar]
  6. Chen LL, Zhang M, Zhang DH, Chen XL, Sun CY, Zhou BC, Zhang YZ. Purification and enzymatic characterization of two β-endoxylanases from Trichoderma sp. K9301 and their actions in xylooligosaccharide production. Bioresour Technol. 2009;100:5230–5236. doi: 10.1016/j.biortech.2009.05.038. [DOI] [PubMed] [Google Scholar]
  7. Choengpanya K, Arthomthurasuk S, Wattana-amorn P, Huang WT, Plengmuankhae W, Li YK, Kongsaeree PT. Cloning, expression and characterization of beta-xylosidase from Aspergillus niger ASKU28. Protein Expr Purif. 2015;115:132–140. doi: 10.1016/j.pep.2015.07.004. [DOI] [PubMed] [Google Scholar]
  8. Collins T, Gerday C, Feller G. Xylanases, xylanase families and extremophilic xylanases. FEMS Microbiol Rev. 2005;29:3–23. doi: 10.1016/j.femsre.2004.06.005. [DOI] [PubMed] [Google Scholar]
  9. Dyck EV, Stasiak AZ, Stasiak A, West SC. Binding of double strand breaks in DNA by human Rad52 protein. Nature. 1999;398(6729):728–731. doi: 10.1038/19560. [DOI] [PubMed] [Google Scholar]
  10. Feng J, Li W, Hwang SF, Gossen BD, Strelkov SE. Enhanced gene replacement frequency in KU70 disruption strain of Stagonospora nodorum. Microbiol Res. 2012;167(3):173–178. doi: 10.1016/j.micres.2011.05.004. [DOI] [PubMed] [Google Scholar]
  11. Ghose TK. Measurement of cellulase activities. Pure Appl Chem. 1987;59:257–268. [Google Scholar]
  12. Herrmann MC, Vrsanska M, Jurickova M, Hirsch J, Biely P, Kubicek CP. The β-D-xylosidase of Trichoderma reesei is a multifunctional β-D-xylan xylohydrolase. Biochem J. 1997;321:375–381. doi: 10.1042/bj3210375. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Huang D, Liu J, Qi YF, Yang KX, Xu YY, Feng L. Synergistic hydrolysis of xylan using novel xylanases, beta-xylosidases, and an alpha-l-arabinofuranosidase from Geobacillus thermodenitrificans NG80-2. Appl Microbiol Biotechnol. 2017;101(15):6023–6037. doi: 10.1007/s00253-017-8341-2. [DOI] [PubMed] [Google Scholar]
  14. Knob A, Terrasan CRF, Carmona EC. β-Xylosidases from filamentous fungi: an overview. World J Microbiol Biotechnol. 2010;26:389–407. doi: 10.1007/s11274-009-0190-4. [DOI] [Google Scholar]
  15. Kück U, Hoff B. New tools for the genetic manipulation of filamentous fungi. Appl Microbiol Biotechnol. 2010;86(1):51–62. doi: 10.1007/s00253-009-2416-7. [DOI] [PubMed] [Google Scholar]
  16. Lachke AH. 1,^$, ^$.-D-Xylan xylohydrolase of Sclerotium rolfsii. Method Enzymol. 1988;160:679–684. doi: 10.1016/0076-6879(88)60187-X. [DOI] [Google Scholar]
  17. Li HL, Long CN, Zhou J, Liu J, Wu XB, Long MN. Rapid analysis of mono-saccharides and oligo-saccharides in hydrolysates of lignocellulosic biomass by HPLC. Biotechnol Lett. 2013;35(9):1405–1409. doi: 10.1007/s10529-013-1224-4. [DOI] [PubMed] [Google Scholar]
  18. Li HL, Wu JJ, Jiang FJ, Xue Y, Liu J, Gan LH, Ali N, Long MN. Functional expression and synergistic cooperation of xylan-degrading enzymes from Hypocrea orientalis and Aspergillus niger. J Chem Technol Biot. 2015;90:2083–2091. doi: 10.1002/jctb.4521. [DOI] [Google Scholar]
  19. Long CN, Cheng YJ, Gan LH, Liu J, Long MN. Identification of a genomic region containing a novel promoter resistant to glucose repression and over-expression of β-glucosidase gene in Hypocrea orientalis EU7-22. Int J Mol Sci. 2013;14(4):8479–8490. doi: 10.3390/ijms14048479. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Meyer V. Genetic engineering of filamentous fungi progress, obstacles and future trends. Biotechnol Adv. 2008;26(2):177–185. doi: 10.1016/j.biotechadv.2007.12.001. [DOI] [PubMed] [Google Scholar]
  21. Pastink A, Eeken JCJ, Lohman PHM. Genomic integrity and the repair of double-strand DNA breaks. Mutat Res. 2001;480–481:37–50. doi: 10.1016/S0027-5107(01)00167-1. [DOI] [PubMed] [Google Scholar]
  22. Rasmussem LE, Sorensen HR, Vind J, Vikso-Nielsen A. Mode of action and properties of the β-xylosidases from Talaromyces emersonni and Trichoderma reesei. Biotechnol Bioeng. 2006;94:869–876. doi: 10.1002/bit.20908. [DOI] [PubMed] [Google Scholar]
  23. Sabiha-Hanim S, Noor MAM, Ahmad Rosma. Effect of autohydrolysis and enzymatic treatment on oil palm (Elaeis guineensis Jacq.) frond fibres for xylose and xylooligosaccharides production. Bioresour Technol. 2011;102:1234–1239. doi: 10.1016/j.biortech.2010.08.017. [DOI] [PubMed] [Google Scholar]
  24. Selig M, Weiss NYJ (2008) Enzymatic saccharification of lignocellulosic biomass. Technique report NREL/TP-510-42629
  25. Sorensen HR, Meyer AS, Pedersen S. Enzymatic hydrolysis of water-soluble wheat arabinoxylan in an industrial ethanol fermentation residue. Enzyme Microb Tech. 2003;36:773–784. doi: 10.1016/j.enzmictec.2005.01.007. [DOI] [Google Scholar]
  26. Tachibana A. Genetic and physiological regulation of nonhomologous end-joining in mammalian cells. Adv Biophys. 2004;38:21–44. doi: 10.1016/S0065-227X(04)80046-7. [DOI] [PubMed] [Google Scholar]
  27. Vazquez MJ, Alonso JL, Dominguez H, Parajó JC. Xylo-oligosaccharides: manufacture and applications. Trends Food Sci Technol. 2000;11:387–393. doi: 10.1016/S0924-2244(01)00031-0. [DOI] [Google Scholar]

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES