Skip to main content
PLOS One logoLink to PLOS One
. 2017 Dec 20;12(12):e0189728. doi: 10.1371/journal.pone.0189728

Prevalence and molecular characterization of Giardia intestinalis in racehorses from the Sichuan province of southwestern China

Lei Deng 1,#, Wei Li 1,#, Zhijun Zhong 1,#, Xuehan Liu 2,#, Yijun Chai 1, Xue Luo 1, Yuan Song 1, Wuyou Wang 1, Chao Gong 1, Xiangming Huang 3, Yanchun Hu 1, Hualin Fu 1, Min He 1, Ya Wang 1, Yue Zhang 3, Kongju Wu 3, Suizhong Cao 1, Guangneng Peng 1,*
Editor: Rodney D Adam4
PMCID: PMC5738084  PMID: 29261753

Abstract

Giardia intestinalis, a cosmopolitan zoonotic parasite, is one of the most common causes of protozoal diarrhea in both humans and animals worldwide. Although G. intestinalis has been detected in many animals, information regarding its prevalence and genotype in Chinese racehorses is scarce. In the present study, we investigated the prevalence of G. intestinalis in racehorses and performed molecular characterization of the pathogen to assess its zoonotic potential. Two hundred and sixty-four racehorse fecal samples from six equestrian clubs located in different regions of the Sichuan province of southwestern China were examined. Nested polymerase chain reaction (PCR) analysis of the gene encoding triose-phosphate isomerase (tpi) showed the prevalence of G. intestinalis to be 8.3% (22/264), and the prevalence in different clubs varied from 3.6% to 13.5%. Three assemblages were identified in the successfully sequenced samples, including the potentially zoonotic assemblages A (n = 5) and B (n = 14), the mouse-specific assemblage G (n = 3), and a mixed A and B assemblage. Sequence analysis of tpi, glutamate dehydrogenase (gdh), and beta giardin (bg) loci revealed that the majority of sequences isolated from assemblage A were identical to the subtype AIV and assemblage B isolates showed variability among the nucleotide sequences of the subtype BIV. Using the nomenclature for the multilocus genotype (MLG) model, one each of multilocus genotypes A (MLG1) and B (MLG2) were identified, with MLG2 being a novel genotype. To the best of our knowledge, this is the first study to investigate G. intestinalis in Chinese racehorses. The presence of both animal and human assemblages of G. intestinalis in racehorses indicated that these animals might constitute a potential zoonotic risk to human beings.

Introduction

Giardia intestinalis (syn. G. lamblia, G. duodenalis) is a common flagellate intestinal parasite that can infect a wide range of animals, including humans, domestic animals, and wildlife [1]. So far, at least eight assemblages or genotypes (A to H) of G. intestinalis have been described based on molecular analysis of G. intestinalis isolates from different host species [2, 3]. Among them, assemblages A and B, which are considered to be potentially zoonotic, are responsible for the majority of human/ mammalian infections, whereas the other assemblages are host-specific [4]. Generally, assemblages C and D are identified in dogs and are occasionally reported in humans [5]. Assemblage E predominantly infects ruminants and pigs, assemblage F infects cats, assemblage G infects mice and rats, and assemblage H infects marine mammals [68].

Giardiasis is transmitted mainly through ingestion of food or water contaminated with Giardia cysts [9]. Domestic animals (including race-horses) who frequently feed in pastures irrigated with contaminated water or drink water from contaminated sources may became infected with human Giardia. The clinical symptoms of giardiasis are quite variable, and range from acute or chronic diarrhea to a complete absence of symptoms [10]. Giardia species could cause dehydration, abdominal pain, weight loss, and mal-absorption in children or young animals; it has also been reported to cause no or mild symptoms in healthy individuals [11]. Every year, approximately 2.8 × 108 cases of human giardiasis are reported worldwide, and the prevalence rates are 8–30% in developing countries [4, 12]. The World Health Organization (WHO), therefore, classified giardiasis as a neglected tropical disease in 2004 [11].

Giardia was first reported in South African horses [13]; since then, this parasite has been identified in horses in other countries, including China [14]. Although Giardia causes diarrhea in horses [15, 16], most infected horses do not show any clinical signs, and subclinical effects have also been reported [17]. Assemblages A, B, and E of G. intestinalis have been detected in horses [17], suggesting that horses might be a potential reservoir of G. intestinalis that can infect humans or other animals. However, there has been only one study on G. intestinalis in grazing horses in Xinjiang, China, and very little is known about its prevalence in Chinese racehorses. Therefore, the present study aimed to investigate the prevalence and assemblages of G. intestinalis in Chinese racehorses to assess their potential for zoonotic transmission.

Materials and methods

Ethics statement

The present study protocol was reviewed and approved by the Research Ethics Committee and the Animal Ethical Committee of the Sichuan Agricultural University. All fecal specimens were collected from animals with the permission of the club owners.

Sample collection

Two hundred and sixty-four fecal samples were collected from racehorses of six equestrian clubs located in different regions of the Sichuan province in southwestern China, between June 2016 and March 2017 (Table 1). There are about 911,000 horses in Sichuan province, and the racehorses have more contact with humans due to they are mainly used for horseback riding, racing and show jumping. Clubs were selected based on the owners’ willingness to participate and the accessibility of animals for sampling. Each racehorse was raised alone in a barn, and the fecal sample was collected separately with sterile gloves after defecation onto the ground, placed into ice-boxes, and transported to the laboratory immediately.

Table 1. Prevalence and distribution of Giardia intestinalis in different regions of the Sichuan province of southwestern China.

Clubs (region ID) Regions No. examined No. positive (%) Assemblages (No.)
Club1 (A) Pixian 48 4(8.3%) A (1), B (3)
Club2 (B) Qingbaijiang 52 7(13.5%) A (2), B (5)
Club3 (C) Shuangliu 56 2(3.6%) B (2)
Club4 (D) Longquan 16 1(6.3%) B (1)
Club5 (E) Wenjiang 58 6(10.3%) A (2), B (1), G (3)
Club6 (F) Dujiangyan 34 2(5.9%) B (2)
Total 264 22(8.3%) A (5), B (14), G(3)

DNA extraction and PCR amplification

Genomic DNA was extracted directly from each fecal sample using the Stool DNA kit (OMEGA, Norcross, GA, USA) according to the manufacturer’s instructions. The genomic DNA was stored at -20°C until polymerase chain reaction (PCR) amplification. The prevalence and assemblages of G. intestinalis were determined using nested PCR amplification of the gene encoding triose-phosphate isomerase (tpi). Furthermore, tpi-positive specimens were analyzed by PCR amplification of the genes encoding beta giardin (bg) and glutamate dehydrogenase (gdh) [1820]. The primers and annealing temperatures for the three genes are listed in Table 2. TaKaRa Taq™ DNA polymerase (TaKaRa Bio, Otsu, Japan) was used for all PCR amplifications. Positive and negative controls were included in all PCR tests. All secondary PCR products were subjected to electrophoresis on a 1% agarose gel with ethidium bromide.

Table 2. Primer sequences and annealing temperatures of the genes used in this study, as well as the fragment lengths of the PCR products.

Gene Primer Sequence (5'-3') Annealing temperature (°C) Fragment length (bp) Reference
tpi F1 AAATIATGCCTGCTCGTCG 50 530 18
R1 CAAACCTTITCCGCAAACC
F2 CCCTTCATCGGIGGTAACTT 50
R2 GTGGCCACCACICCCGTGCC
bg F1 AAGCCCGACGACCTCACCCGCAGTGC 65 530 19
R1 GAGGCCGCCCTGGATCTTCGAGACGAC
F2 GAGGCCGCCCTGGATCTTCGAGACGAC 65
R2 CATAACGACGCCATCGCGGCTCTCAGGAA
gdh F1 TTCCGTRTYCAGTACAACTC 50 511 20
R1 ACCTCGTTCTGRGTGGCGCA
F2 ATGACYGAGCTYCAGAGGCACGT 50
R2 GTGGCGCARGGCATGATGCA

DNA sequence analyses

The secondary PCR products of the expected sizes were directly sequenced by Life Technologies (Guangzhou, China) using a BigDye® Terminator v3.1 cycle sequencing kit (Applied Biosystems, Carlsbad, CA, USA). Bidirectional sequencing was performed to confirm the accuracy of these sequences. To identify the assemblages and subtypes, the nucleotide sequences obtained in the present study were aligned with the G. intestinalis reference nucleotide sequences from GenBank and analyzed using BLAST (http://www.ncbi.nlm.nih.gov/BLAST/) and Clustal X 1.83.

Statistical analysis

The relationship between the prevalence of G. intestinalis-infected horses and different clubs was analyzed using the chi-square test of the SPSS version 22.0 software (SPSS Inc., Chicago, IL, USA). Differences were considered significant when P < 0.05.

Nucleotide sequence accession numbers

All nucleotide sequences were submitted to the National Center for Biotechnology Information (NCBI) GenBank database under the following accession numbers: MF169200-MF169206 for tpi, MF169193-MF169196 for bg, and MF169197-MF169199 for gdh.

Results

Prevalence and distribution of the assemblages of G. intestinalis in different horse clubs

The total prevalence of G. intestinalis was 8.3% (22/264). All the tested clubs were Giardia-positive, and the infection rate ranged from 3.6% to 13.5% for the different clubs. The highest prevalence was in Club 2 (7/52, 13.5%), followed by Club 5 (6/58, 10.3%), Club 1 (4/48, 8.3%), Club 4 (1/16, 6.3%), Club 6 (2/34, 5.9%), and Club 3 (2/56, 3.6%) (Table 1).

Among all clubs, 63.6% (14/22) of the G. intestinalis-positive samples were infected with assemblage B, whereas 22.7% (5/22) were infected with assemblage A and 13.6% (3/22) were infected with assemblage G. Assemblage B was the most common genotype identified in all tested clubs; assemblage A was found in three of six clubs (Clubs 1, 2, and 5), and assemblage G was found only in Club 5 (Table 1).

Molecular characterization and polymorphisms in G. intestinalis amplified products

All 22 G. intestinalis-positive specimens were detected based on three loci, tpi, bg, and gdh. Twenty-two tpi, 10 bg, and 7 gdh sequences were obtained, and four samples were sequenced for all three genes (Table 3). Three G. intestinalis assemblages (A, B, and G) were revealed for the tpi locus; 14 were identified as assemblage B (three different sequences), 5 as assemblage A (two different sequences), and 3 as assemblage G (two different sequences). Of the 5 assemblage A tpi nucleotide sequences, three (A7, B34, and B46) were identical to the sequence of KP780964 and the sub-assemblage was AIV (prairie dog from USA); the other two assemblage A (AV) nucleotide sequences (E29 and E34) were identical and showed 100% similarity (509/509 base pairs) with the reference sequence (GenBank accession number KP780973). Of the 14 assemblage B tpi nucleotide sequences, genetic polymorphisms were observed at two nucleotide sites (positions 276 and 371) using KM926534 as a reference sequence (Table 4). In the 3 assemblage G tpi nucleotide sequences, four base variations were noted at three nucleotide sites compared to the nucleotide sequence JX571041 of a Spanish rodent (positions 165, 228, and 277) (Table 4).

Table 3. Assemblages of Giardia intestinalis and the distribution of tpi, bg, and gdh sequences for each positive racehorse and multilocus characterization.

Horse ID tpi (subtype) bg (subtype) gdh (subtype) MLGs
A7 Assemblage A (IV) Assemblage A (IV-novel-1)
A15 Assemblage B (IV)
A17 Assemblage B (IV)
A40 Assemblage B (IV-novel-1) Assemblage A (I-novel-1) Assemblage B (IV-novel-2)
B15 Assemblage B (IV-novel-1) Assemblage B (IV-novel-1)
B30 Assemblage B (IV) Assemblage B (IV-novel-1)
B34 Assemblage A (IV) Assemblage A Assemblage A (IV) MLG1
B39 Assemblage B (IV-novel-2)
B46 Assemblage A (IV) Assemblage A Assemblage A (IV) MLG1
B48 Assemblage B (IV-novel-1) Assemblage B Assemblage B (IV-novel-1) MLG2
B51 Assemblage B (IV) Assemblage B
C11 Assemblage B (IV) Assemblage B
C14 Assemblage B (IV-novel-2)
D5 Assemblage B (IV-novel-2) Assemblage B
E26 Assemblage G (novel-1)
E27 Assemblage G (novel-1)
E28 Assemblage G (novel-2)
E29 Assemblage A (V) Assemblage A
E34 Assemblage A (V) Assemblage A
E42 Assemblage B (IV-novel-1) Assemblage B (IV-novel-1)
F9 Assemblage B (IV-novel-1)
F12 Assemblage B (IV-novel-1)

Table 4. Variations in tpi, gdh and bg nucleotide sequences among the different subtypes in assemblages A, B, and G of G. intestinalis.

Gene Subtype (n) Nucleotide at position GenBank accession no.
tpi 276 371
Ref. sequence G G KM926534
BIV (n = 5) G G MF169201
BIV-novel-1 (n = 6) G A MF169200
BIV-novel-2 (n = 3) A G MF169202
165 228 277
Ref. sequence C G G JX571041
G-novel-1 (n = 2) T T G MF169204
G-novel-2 (n = 1) C T A MF169205
bg 63 293
Ref. sequence A C KM190700
AI-novel-1 (n = 2) G T MF169195
gdh 112 298 398
Ref. sequence G C A KP687770
BIV-novel-1 (n = 4) G T A MF169197
BIV-novel-2 (n = 1) A T G MF169198

Among the 10 bg locus sequences, two were assemblage A sequences (n = 6) and one was assemblage B sequence (n = 4). The assemblage A sequences (B34, B46, E29, and E34) were identical to the sequence of KM190700 (from water in Canada), and the other two amplified products (A7 and A40) had two base variations compared to the sequence of KM190700 (Table 4). The assemblage B sequences (B48, B51, C11, and D5) were identical to the reference sequences KT948089 (from children in Ethiopian) and KU504731 (from human in Brazil).

Among the 7 sequences of the gdh locus, two (B34 and B46) were identified as assemblage A; these sequences were identical to a reference sequence from a cat in Brazil (EF507600). Two of the other 5 amplified products were identified assemblage B sequences, which differed by two and three bases from the reference sequence KP687770 (from a beaver in Canada) (Table 4).

Discussion

To our knowledge, this study is the first to confirm the presence of G. intestinalis in racehorses in China; this was determined to be 8.3%. The prevalence of G. intestinalis in horses shows a wide country-specific variation (0–35%). The prevalence of this parasite has additionally been reported in horses in Brazil (0.5%), Germany (5.4%), grazing horses of Xinjiang (1.5%) [14, 21, 22] and in foals in Netherlands (11.4%), the USA (13%), Belgium (14.2%), Colombia (17.4%), and the Czech Republic (35%) [17, 2327]. Previous studies have shown that the prevalence of G. intestinalis in dairy cattle was affected by climate, with significantly higher prevalence in winter than in other seasons [4, 7]. Other studies have also shown that the prevalence of G. intestinalis was associated with infection of children and foals [24, 28]. The difference between the prevalence of G. intestinalis obtained in this study and that in other countries may be affected by many factors, such as the examination method, animal age, sample size, management system, timing of specimen collection, and climate.

Although G. intestinalis occurs in a variety of hosts worldwide, data regarding molecular characterization of the species of equine origin is limited. In previous studies, G. intestinalis was detected in horses mainly by microscopy or direct immunofluorescence microscopy (DFA) [2123, 2931]; however, light microscopy cannot identify trophozoites or cysts of different species [32]. Specific PCR of the tpi, gdh, and bg genetic loci have been used to characterize and classify the genotypes/assemblages of Giardia species [3, 6, 33]. So far, horses from 12 countries have been reported to be infected with G. intestinalis, and assemblages A and B are the most commonly identified assemblages [14, 17]. Assemblages A and B are mainly responsible for human giardiasis; they have also been found in a wide range of animals in China, including dairy cattle, laboratory macaques, sheep, goat, rabbits, dogs, donkeys, and horses, as well as in raw urban wastewater [3438]. These results suggested that interspecies transmission of G. intestinalis might be common in China, and horses might be a source of giardiasis outbreaks.

In the present study, assemblage B was found to be more prevalent than assemblage A. Similar results were reported in a previous study in New York State and Western Australia [39]. In contrast, in another study in Italy, 16 and 11 equine specimens were identified to be of assemblages A and B, respectively, and a study in China identified one horse specimen each to be those of assemblages A and B [14, 26]. Interestingly, a recent study reported a horse sample infected with mixed A and B assemblages in Italy [26], which was consistent with the results of this study. Assemblage G is primarily rodent-specific, and has been identified in rodents in Spain, and in mice and rats in Sweden [40, 41]. For the first time, the present study showed that horses could also harbor this assemblage. Furthermore, four G. intestinalis isolates were amplified at all three loci, forming two multilocus genotypes (MLG1-2). MLG1 (n = 2) was identified as assemblage A and MLG2 was identified as assemblage B. These results indicated the genetic diversity of G. intestinalis assemblages A and B in Chinese horses.

Conclusions

In conclusion, the present study is the first to demonstrate the prevalence (8.3%, 22/264) of G. intestinalis in racehorses of the Sichuan province of southwestern China. We detected the potentially zoonotic assemblages A and B of G. intestinalis, and identified the mouse-specific assemblage G in racehorses for the first time. Multilocus sequence analysis revealed genetic diversity in assemblages A and B. These results provide basic data on the molecular characterization of the parasite in this region, and further systematic studies are required to investigate the transmission of giardiasis between humans and animals. Moreover, the presence of both animal and human assemblages of G. intestinalis in racehorses indicated that racehorses might serve as a potential source of infection for human giardiasis, and effective strategies and measures should be implemented to control its transmission from racehorses to humans.

Data Availability

All relevant data are available from the National Center for Biotechnology Information (NCBI) GenBank database (accession numbers: MF169193-MF169206).

Funding Statement

The study was financially supported by the Chengdu Giant Panda Breeding Research Foundation CPF2014-10. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Xiao L, Fayer R. Molecular characterisation of species and genotypes of Cryptosporidium and Giardia and assessment of zoonotic transmission. Int J Parasitol. 2008;38(11):1239–55. doi: 10.1016/j.ijpara.2008.03.006 [DOI] [PubMed] [Google Scholar]
  • 2.Sprong H, Cacci SM, Giessen JWBVD. Identification of Zoonotic Genotypes of Giardia duodenalis. PloS Negl Trop Dis. 2009;3(12):e558 doi: 10.1371/journal.pntd.0000558 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Ryan U, Cacciò SM. Zoonotic potential of Giardia. Int J Parasitol. 2013;43(12–13):943–56. doi: 10.1016/j.ijpara.2013.06.001 [DOI] [PubMed] [Google Scholar]
  • 4.Zhang XX, Tan QD, Zhao GH, Ma JG, Zheng WB, Ni XT, et al. Prevalence, Risk Factors and Multilocus Genotyping of Giardia intestinalis in Dairy Cattle, Northwest China. J Eukaryot Microbiol. 2016;63(4):498 doi: 10.1111/jeu.12293 [DOI] [PubMed] [Google Scholar]
  • 5.Ballweber LR, Xiao L, Bowman DD, Kahn G, Cama VA. Giardiasis in dogs and cats: update on epidemiology and public health significance. Trends Parasitol. 2010;26(4):180 doi: 10.1016/j.pt.2010.02.005 [DOI] [PubMed] [Google Scholar]
  • 6.Yaoyu Feng, Lihua Xiao. Zoonotic Potential and Molecular Epidemiology of Giardia Species and Giardiasis. Clin Microbiol Rev. 2011;24(1):110–40. doi: 10.1128/CMR.00033-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Wang H, Zhao G, Chen G, Jian F, Zhang S, Feng C, et al. Multilocus Genotyping of Giardia duodenalis in Dairy Cattle in Henan,China. PLoS One. 2013;9(6):e100453. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Zhang W, Shen Y, Wang R, Liu A, Hong L, Li Y, et al. Cryptosporidium cuniculus and Giardia duodenalis in Rabbits: Genetic Diversity and Possible Zoonotic Transmission. PloS One. 2012;7(2):e31262 doi: 10.1371/journal.pone.0031262 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Karanis P, Kourenti C, Smith H. Waterborne transmission of protozoan parasites: a worldwide review of outbreaks and lessons learnt. J Water Health. 2007;5(1):1–38. [DOI] [PubMed] [Google Scholar]
  • 10.Cacciò SM, Ryan U. Molecular epidemiology of giardiasis. Mol Bioche Parasitol. 2008;160(2):75–80. [DOI] [PubMed] [Google Scholar]
  • 11.Savioli L, Smith H, Thompson A. Giardia and Cryptosporidium join the 'Neglected Diseases Initiative'. Trends Parasitol. 2006;22(5):203 doi: 10.1016/j.pt.2006.02.015 [DOI] [PubMed] [Google Scholar]
  • 12.Fletcher SM, Stark D, Harkness J, Ellis J. Enteric Protozoa in the Developed World: a Public Health Perspective. Clin Microbiol Rev. 2012;25(3):420–49. doi: 10.1128/CMR.05038-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Fantham HB. Some Parasitic Protozoa found in South Africa. IV. South African J Sci. 1924:164–70. [Google Scholar]
  • 14.Meng Q, Zhou H, Wang H, Wang R, Xiao L, Arrowood MJ, et al. Molecular identification of Cryptosporidium spp. and Giardia duodenalis in grazing horses from Xinjiang, China. Vet Parasitol. 2015;209(3–4):169–72. doi: 10.1016/j.vetpar.2015.02.030 [DOI] [PubMed] [Google Scholar]
  • 15.Manahan FF. Diarrhoea in horses with particular reference to a chronic diarrhoea syndrome. Aust Vet J 1970;46(5):231–4. [DOI] [PubMed] [Google Scholar]
  • 16.Kirkpatrick CE, Skand DL. Giardiasis in a horse. J Am Vet Med Associat. 1985;187(2):163–4. [PubMed] [Google Scholar]
  • 17.Santín M, Cortés Vecino JA, Fayer R. A large scale molecular study of Giardia duodenalis in horses from Colombia. Vet Parasitol. 2013;196(1–2):31–6. doi: 10.1016/j.vetpar.2013.02.006 [DOI] [PubMed] [Google Scholar]
  • 18.Cacciò SM, De GM, Pozio E. Sequence analysis of the beta-giardin gene and development of a polymerase chain reaction-restriction fragment length polymorphism assay to genotype Giardia duodenalis cysts from human faecal samples. Int J Parasitol. 2002;32(8):1023–30. [DOI] [PubMed] [Google Scholar]
  • 19.Liu A, Zhang X, Zhang L, Wang R, Li X, Shu J, et al. Occurrence of bovine giardiasis and endemic genetic characterization of Giardia duodenalis isolates in Heilongjiang Province, in the Northeast of China. Parasitol Res. 2012;111(2):655–61. doi: 10.1007/s00436-012-2883-0 [DOI] [PubMed] [Google Scholar]
  • 20.Cacciò SM, Beck R, Lalle M, Marinculic A, Pozio E. Multilocus genotyping of Giardia duodenalis reveals striking differences between assemblages A and B. Int J Parasitol. 2008;38(13):1523–31. doi: 10.1016/j.ijpara.2008.04.008 [DOI] [PubMed] [Google Scholar]
  • 21.De Souza PN, Bomfim TC, Huber F, Abboud LC, Gomes RS. Natural infection by Cryptosporidium sp., Giardia sp. and Eimeria leuckarti in three groups of equines with different handlings in Rio de Janeiro, Brazil. Vet Parasitol. 2009;160(3–4):327–33. doi: 10.1016/j.vetpar.2008.10.103 [DOI] [PubMed] [Google Scholar]
  • 22.Beelitz P, Göbel E, Gothe R. Spectrum of species and incidence of endoparasites in foals and their mother mares from breeding farms with and without anthelmintic prophylaxis in upper Bavaria. Tierarztl Prax. 1996;24(1):48–54. [PubMed] [Google Scholar]
  • 23.Xiao L, Herd RP. Epidemiology of equine Cryptosporidium and Giardia infections. Equine Vet J. 1994;26(1):14 [DOI] [PubMed] [Google Scholar]
  • 24.Veronesi F, Passamonti F, Cacciò S, Diaferia M, Fioretti DP. Epidemiological survey on equine Cryptosporidium and Giardia infections in Italy and molecular characterization of isolates. Zoonoses Public Health. 2010;57(7–8):510–7. doi: 10.1111/j.1863-2378.2009.01261.x [DOI] [PubMed] [Google Scholar]
  • 25.Kostopoulou D, Casaert S, Tzanidakis N, Van DD, Demeler J, Von S-HG, et al. The occurrence and genetic characterization of Cryptosporidium and Giardia species in foals in Belgium, The Netherlands, Germany and Greece. Vet Parasitol. 2015;211(3–4):170–4. doi: 10.1016/j.vetpar.2015.04.018 [DOI] [PubMed] [Google Scholar]
  • 26.Traversa D, Otranto D, Milillo P, Latrofa MS, Giangaspero A, Di CA, et al. Giardia duodenalis sub-Assemblage of animal and human origin in horses. Infect Gene Evol. 2012;12(8):1642–6. [DOI] [PubMed] [Google Scholar]
  • 27.Pavlásek I, Hess L, Stehlík I, Stika V. The fist detection of Giardia spp. in horses in the Czech Republic. Vet Med. 1995;40(3):81. [PubMed] [Google Scholar]
  • 28.García-Cervantes PC, Báez-Flores ME, Delgado-Vargas F, Ponce-Macotela M, Nawa Y, De-La-Cruz-Otero MD, et al. Giardia duodenalis genotypes among schoolchildren and their families and pets in urban and rural areas of Sinaloa, Mexico. J Infect Dev Ctries. 2017;11(2):180 doi: 10.3855/jidc.8223 [DOI] [PubMed] [Google Scholar]
  • 29.Gomes AD, Barretta C, Ziegler DP, Sausen L, Stoever N, Sangioni LA, et al. Prevalência de Cryptosporidium spp e Giardia sp em eqüinos estabulados no Jockey Club de Santa Maria—RS, Brasil. Ciência Rural. 2008;38(9):2662–5. [Google Scholar]
  • 30.Johnson E, Atwill ER, Filkins ME, Kalush J. The prevalence of shedding of Cryptosporidium and Giardia spp. based on a single fecal sample collection from each of 91 horses used for backcountry recreation. J Vet Diagn Invest. 1997;9(1):56–60. doi: 10.1177/104063879700900110 [DOI] [PubMed] [Google Scholar]
  • 31.Atwill ER, Mcdougald NK, Perea L. Cross-sectional study of faecal shedding of Giardia duodenalis and Cryptosporidium parvum among packstock in the Sierra Nevada Range. Equine Vet J. 2010;32(3):247–52. [DOI] [PubMed] [Google Scholar]
  • 32.Koehler AV, Jex AR, Haydon SR, Stevens MA, Gasser RB. Giardia/giardiasis—a perspective on diagnostic and analytical tools. Biotechnol Adv. 2014;32(2):280 doi: 10.1016/j.biotechadv.2013.10.009 [DOI] [PubMed] [Google Scholar]
  • 33.Liu D. Molecular detection of human parasitic pathogens: CRC Press/Taylor Francis; 2013. 295–302 p. [Google Scholar]
  • 34.Ye J, Xiao L, Li J, Huang W, Amer SE, Guo Y, et al. Occurrence of human-pathogenic Enterocytozoon bieneusi, Giardia duodenalis and Cryptosporidium genotypes in laboratory macaques in Guangxi, China. Parasitol Int. 2014;63(1):132–7. doi: 10.1016/j.parint.2013.10.007 [DOI] [PubMed] [Google Scholar]
  • 35.Zhang W, Zhang X, Wang R, Liu A, Shen Y, Ling H, et al. Genetic Characterizations of Giardia duodenalis in Sheep and Goats in Heilongjiang Province, China and Possibility of Zoonotic Transmission. PLoS Negl Trop Dis. 2012;6(9):e1826 doi: 10.1371/journal.pntd.0001826 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Liu A, Ji H, Wang E, Liu J, Xiao L, Shen Y, et al. Molecular identification and distribution of Cryptosporidium and Giardia duodenalis in raw urban wastewater in Harbin, China. Parasitol Res. 2011;109(3):913–8. doi: 10.1007/s00436-011-2333-4 [DOI] [PubMed] [Google Scholar]
  • 37.Li J, Zhang P, Wang P, Alsarakibi M, Zhu H, Liu Y, et al. Genotype identification and prevalence of Giardia duodenalis in pet dogs of Guangzhou, Southern China. Vet Parasitol. 2012;188(3–4):368–71. doi: 10.1016/j.vetpar.2012.04.004 [DOI] [PubMed] [Google Scholar]
  • 38.Zhang XX, Zhang FK, Li FC, Hou JL, Zheng WB, Du SZ, et al. The presence of Giardia intestinalis in donkeys, Equus asinus, in China. Parasites Vectors. 2017;10(1):3 doi: 10.1186/s13071-016-1936-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Traub R, Wade S, Read C, Thompson A, Mohammed H. Molecular characterization of potentially zoonotic isolates of Giardia duodenalis in horses. Vet Parasitol. 2005;130(3–4):317 doi: 10.1016/j.vetpar.2005.02.011 [DOI] [PubMed] [Google Scholar]
  • 40.Fernándezálvarez Á, Martínalonso A, Abreuacosta N, Feliu C, Hugot JP, Valladares B, et al. Identification of a novel assemblage G subgenotype and a zoonotic assemblage B in rodent isolates of Giardia duodenalis in the Canary Islands, Spain. Parasitol. 2014;141(2):206. [DOI] [PubMed] [Google Scholar]
  • 41.Lebbad M, Mattsson JG, Christensson B, Ljungström B, Backhans A, Andersson JO, et al. From mouse to moose: multilocus genotyping of Giardia isolates from various animal species. Vet Parasitol. 2010;168(3–4):231–9. doi: 10.1016/j.vetpar.2009.11.003 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All relevant data are available from the National Center for Biotechnology Information (NCBI) GenBank database (accession numbers: MF169193-MF169206).


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES