ABSTRACT
The EmbCAB proteins have been considered a target for ethambutol (EMB). Mutations in embCAB are known to confer most EMB resistance. However, the knowledge about the effects of embCAB mutations on the EMB resistance level and about the role of mutation-mutation interactions is limited in China. Here, we sequenced embCAB among 125 Mycobacterium tuberculosis isolates from China and quantified their EMB MICs by testing growth at 10 concentrations. Furthermore, a multivariate regression model was established to assess the effects of both individual mutations and multiple mutations. Our results revealed that in China, 82.6% of EMB-resistant isolates (71/86 isolates) harbored at least one mutation within embCAB. Most of the mutations were located in the embB and embA upstream region. Several individual mutations and multiple mutations within this region contributed to the different levels of EMB resistance. Their effects were statistically significant. Additionally, there was an association between high-level EMB resistance and multiple mutations.
KEYWORDS: ethambutol, Mycobacterium tuberculosis, embCAB, mutation, MIC
INTRODUCTION
Tuberculosis (TB) remains a major public health problem in China. In 2014, an estimated 930,000 people developed TB, and 38,000 died from this disease (1). It has become the second leading cause of death from infectious disease in China. The emergence of drug-resistant TB, especially multidrug-resistant TB (MDR-TB), makes TB control more challenging. According to the national baseline survey on TB (2), the observed prevalences of MDR-TB among new patients and previously treated patients were 5.7% and 25.6%, respectively, and there were 110,000 incident cases of MDR-TB.
EMB is a first line anti-TB drug routinely recommended in combination with other drugs to treat TB and drug-resistant TB. It is also contained in second-line regiments for MDR-TB when susceptibility is revealed. Thus, the rapid detection of ethambutol (EMB) susceptibility is essential to optimize an appropriate treatment regimen and prevent treatment failure. Molecular methods for the detection of EMB resistance have been increasingly used and have the potential to dramatically reduce delay. However, these methods require precise knowledge of the genetic changes involved in the development of EMB resistance.
Numerous reports indicated that the targets for EMB were membrane-associated arabinosyl transferases encoded by the embCAB operon (including embC, embA, and embB) (3–5), which are involved in the biosynthesis of arabinan, a component of arabinogalactan present in cell walls. Mutations in the embCAB operon (mainly embB) were most commonly associated with EMB resistance, with variations of codon embB 306, 406, and 497 as the hot spots for mutations (6–9). However, information on the correlation between EMB resistance and embCAB mutations was scarce until now in China (9), with most studies investigating mutations only in embB (10–13). Furthermore, studies often reported aggregate test performance containing sensitivity and specificity (8, 9, 11, 12, 14) and infrequently report on EMB MIC measurements. To improve the accuracy of the molecular diagnostic, a detailed analysis of the differential effects of the embCAB mutations on EMB resistance is necessary. Although the detection of more than one mutation in embCAB in the clinical isolates was not uncommon (7–9), the role of additive mutation effects among the isolates was rarely referred to. Considering the knowledge of the incorporation of additive effects could enhance the prediction of EMB resistance from mutations in embCAB, we sought to systematically explore these associations in 125 clinical Mycobacterium tuberculosis isolates from China. In this study, we quantitated EMB resistance with MIC measurements and analyzed the targeted sequences of the embCAB operon.
RESULTS
MIC results.
The EMB MICs of all 125 M. tuberculosis clinical isolates were measured and are listed in Table 1. According to the MICs, each isolate was classified into one of three EMB MIC categories, namely, a susceptible group (MIC, ≤2 μg/ml), a low-level resistant group (MIC, 4 to 16 μg/ml), and a high-level resistant group (MIC, ≥32 μg/ml), which contained 39, 72, and 14 isolates, respectively.
TABLE 1.
Mutations in embCAB among 125 M. tuberculosis isolates
| embC | embA | embB | No. of isolates at MICs of (μg/ml): |
|||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ≤0.25 | 0.5 | 1.0 | 2.0 | 4.0 | 8.0 | 16.0 | 32.0 | 64.0 | ≥128.0 | |||
| Asp329Glua | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | ||
| G(−43)C | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | ||
| C(−11)T | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | ||
| C(−16)G | Met306Ile | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | |
| C(−16)T | Met306Ile | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | |
| C(−16)A | Met306Ile | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | |
| Met306Ile/Gly406Asp | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | ||
| Met306Ile/Gly406Ser | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | ||
| Met306Ile | 0 | 1 | 0 | 1 | 4 | 2 | 2 | 0 | 0 | 0 | ||
| G(−5)Aa | Met306Leu | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | |
| Met306Leu | 0 | 0 | 1 | 0 | 0 | 1 | 2 | 0 | 0 | 0 | ||
| G(−43)C | Met306Val | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | |
| C(−16)G | Met306Val | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | |
| C(−12)T | Met306Val | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | |
| C(−11)A | Met306Val | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | |
| Thr270Ile-Asn394Asp | Val18Phea | Met306Val/Glu378Ala | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 |
| Met306Val/Gln497His | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | ||
| Met306Val | 0 | 0 | 0 | 1 | 6 | 18 | 3 | 1 | 1 | 1 | ||
| Tyr319Cys | 0 | 0 | 0 | 0 | 0 | 2 | 1 | 0 | 0 | 0 | ||
| Asp328Tyr | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | ||
| Tyr334His | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | ||
| Asp354Ala | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | ||
| C(−12)T | Gly406Ala | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | |
| Gly406Ala | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | ||
| Gly406Asp | 0 | 0 | 0 | 2 | 0 | 0 | 0 | 0 | 0 | 0 | ||
| Ser412Pro | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | ||
| Gln497Arg | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | ||
| NMb | NM | NM | 15 | 5 | 8 | 5 | 9 | 3 | 1 | 1 | 1 | 0 |
Mutation not previously reported.
NM, no mutation.
Mutations in embCAB.
DNA sequencing revealed that a total of 77 clinical isolates, including 6 susceptible isolates, 59 low-level EMB-resistant isolates, and 12 high-level EMB-resistant isolates, harbored at least one mutation within the sequenced embCAB (Table 1). When all of the mutations were considered, 26 distinct genotype patterns were detected; 3 were located in embC, 9 were in embA, and 14 were in embB. Since mutations embC Thr270Ile and embB Glu378Ala are known as phylogenetic markers, they were not considered further when describing the sequencing results of the embCAB region.
Overall, 74 isolates (containing 6 susceptible isolates, 56 low-level EMB-resistant isolates, and 12 high-level EMB-resistant isolates) harbored mutations in embB (Table 1). All embB mutations presented in the region between codon 306 and 497. The most prevalent mutation was at codon 306 in 60 isolates, followed by mutations at codons 406 and 319 in 7 and 3 isolates, respectively. Met306 was replaced by Val (39 isolates), Ile (16 isolates), and Leu (5 isolates); Gly406 was replaced by Ala (3 isolates), Asp (3 isolates), and Ser (1 isolate); Tyr319 was replaced by Cys (3 isolates). Other mutations were also detected in codons 328 (2 isolates), 497 (2 isolates), 334 (1 isolate), 354 (1 isolate), and 412 (1 isolate).
Fifteen EMB-resistant isolates (including 8 low-level resistant isolates and 7 high-level resistant isolates) carried mutations within embA (Table 1). The majority of embA mutations were located in its upstream region (UR), including at −43, −16, −12, −11, and −5 bp sites. These mutations were presented in 14 isolates, of which 5 carried mutations at position −16 bp. A mutation in the open reading frame (ORF) of embA occurred in only one isolate harboring Val18Phe. It was notable that most mutations in embA were combined with other mutations in embB. Only two isolates with nucleotide changes at −43 bp and −11 bp carried no other mutations.
Two variable mutations within embC were observed in two resistant isolates (Table 1). A single mutation, Asp329Glu, was observed in one low-level resistant isolate (MIC, 4 μg/ml), whereas another mutation, Asn394Asp, accompanying additional mutations within embA and embB, occurred in one high-level resistant isolate (MIC, 64 μg/ml).
Multiple mutations within embCAB occurred in 16 isolates (Table 1). In one isolate, three different mutations were observed: one mutation each in embC, embB, and embA ORFs. Twelve isolates were each observed to have one mutation in embB as well as one in embA UR. The other three isolates had two mutations in embB.
Association between the mutation and EMB MIC.
The mutations in embCAB that most strongly correlated with EMB resistance on univariate analyses were embB Met306Val and embB Met306Ile, which were associated with median MICs of 8 μg/ml (Table 2).
TABLE 2.
Mutations in embCAB by EMB and their univariate association P value with the Wilcoxon rank sum test
| Gene | Mutation | No. of isolates | MIC (μg/ml) |
P value | |
|---|---|---|---|---|---|
| Median (IQRa) | Range | ||||
| embB | Met306Val | 39 | 8 (8–16) | 2 to ≥128.0 | <0.0001b |
| embB | Met306Ile | 16 | 8 (4–16) | 0.5–64 | <0.0001b |
| embB | Met306Leu | 5 | 8 (8–16) | 1–16 | 0.0116 |
| embB | Gly406Ala | 3 | 16 (12–40) | 8–64 | 0.009b |
| embB | Gly406Asp | 3 | 2 (2–9) | 2–16 | 0.1652 |
| embB | Tyr319Cys | 3 | 8 (8–12) | 8–16 | 0.0144 |
| embB | Asp328Tyr | 2 | 10 | 4–16 | 0.0811 |
| embA | G(−43)C | 2 | 36 | 8–64 | 0.0318 |
| embA | C(−16)G | 2 | 16 | 16–16 | 0.0318 |
| embA | C(−16)T | 2 | 36 | 8–64 | 0.0318 |
| embA | C(−12)T | 2 | 20 | 8–32 | 0.0361 |
| embA | C(−11)A | 2 | 48 | 32–64 | 0.0216 |
| embB | Gly406Ser | 1 | 8 | 0.17 | |
| embB | Gln497His | 1 | ≥128.0 | 0.0897 | |
| embB | Gln497Arg | 1 | 16 | 0.1294 | |
| embB | Tyr334His | 1 | 8 | 0.17 | |
| embB | Asp354Ala | 1 | 4 | 0.3473 | |
| embB | Glu378Ala | 1 | 64 | 0.0967 | |
| embB | Ser412Pro | 1 | 32 | 0.1121 | |
| embA | C(−16)A | 1 | 8 | 0.17 | |
| embA | C(−11)T | 1 | 8 | 0.17 | |
| embA | G(−5)A | 1 | 8 | 0.17 | |
| embA | Val18Phe | 1 | 64 | 0.0967 | |
| embC | Thr270Ile | 1 | 64 | 0.0967 | |
| embC | Asp329Glu | 1 | 4 | 0.3473 | |
| embC | Asn394Asp | 1 | 64 | 0.0967 | |
IQR, interquartile range.
Significant at the 0.01 threshold.
As 20.8% (16/77) of isolates with embCAB mutations carried more than one mutation, a multivariate regression was used to estimate the effects of the mutations on EMB MICs. In the multivariate analysis, single mutations Met306Val and Met306Ile within embB were significantly associated with an increase in the EMB MICs (Table 3). Forward selection, backward elimination, and stepwise regression all yielded this result. Met306Val was the more common mutation, which was present in 39 isolates. Of them, 29 (74.4% [29/39]) were low-level resistant isolates and 9 (23.1% [9/39]) were high-level resistant isolates. Of these 38 EMB-resistant isolates, 78.9% (30/38) harbored single Met306Val mutations. Mutation Met306Ile occurred in 16 isolates, which included 13 low-level resistant isolates (81.2% [13/16]) and 1 (6.3% [1/16]) high-level resistant isolate. Among 14 EMB-resistant isolates, only 8 (57.1% [8/14]) isolates carried single Met306Ile mutations.
TABLE 3.
Linear regression multivariate model for log2-transformed MICs
| Mutation(s) | Log2 MIC change (95% CI) | P value |
|---|---|---|
| embB Met306Val | 2.8 (2.0 to 3.6) | <0.0001a |
| embB Met306Ile | 2.0 (0.9 to 3.1) | 0.0008a |
| embB Met306Leu | 2.3 (0.6 to 4.0) | 0.0109 |
| embB Gly406Ala | 3.8 (1.6 to 6.0) | 0.0009a |
| embB Tyr319Cys | 2.8 (0.6 to 5.0) | 0.0134 |
| embB Asp328Tyr | 2.5 (−0.2 to 5.2) | 0.0707 |
| embA G(−43)C | 2.6 (−0.1 to 5.2) | 0.0606 |
| embA C(−16)G | 1.1 (−1.6 to 3.8) | 0.4346 |
| embA C(−12)T and embB Met306Val | 3.5 (0.8 to 6.2) | 0.0118 |
| embA C(−11)A and embB Met306Val | 5.0 (2.3 to 7.7) | 0.0004a |
| embA C(−16)T and embB Met306Ile | 4.0 (1.3 to 6.7) | 0.0041a |
Significant at the 0.01 threshold.
The embB mutation Gly406Ala, although infrequent, was strongly associated with a higher MIC in either the univariate or multivariate analysis. This mutation was observed in only 3 isolates. Two of them harbored a Gly406Ala mutation alone and had low EMB MICs of 8 and 16 μg/ml. The third isolate with Gly406Ala carried embA C(−12)T and had a high EMB MIC of 32 μg/ml.
Multiple mutations, embA C(−11)A with embB Met306Val and embA C(−16)T with embB Met306Ile, were also associated with significant effects on the MICs (Table 3). These two multiple mutations had larger effects on the EMB MICs (log2 MIC changes of 5.0 and 4.0, respectively) than a single mutation within embB (log2 MIC changes of 2.8 and 2.0, respectively).
There were still 6 susceptible isolates that contained mutations within embCAB. Of them, 4 isolates (66.7%) had MICs of 2 μg/ml. The proportion of mutants in susceptible isolates (15.4% [6/39]) was significantly lower than that in low-level (81.9% [59/72], P < 0.0001) and high-level (85.7% [12/14], P < 0.0001) EMB-resistant isolates. However, none of the susceptible isolates harbored multiple mutations, which occurred only in EMB-resistant isolates. The frequency of multiple mutations in high-level resistant isolates was >4 times that in low-level resistant isolates (66.7% versus15.4%, respectively). A statistical analysis indicated that multiple mutations were associated with high-level EMB resistance (P < 0.0001) (Table 4).
TABLE 4.
EMB MIC distributions in the isolates with variable mutations in embCAB
| Classificationa | No. of isolates (%) |
P valueb | ||
|---|---|---|---|---|
| All | Single mutation | Multiple mutations | ||
| S | 6 (100.0) | 6 (100.0) | 0 (0.0) | <0.0001 |
| LLR | 59 (100.0) | 51 (86.4) | 8 (13.6) | |
| HLR | 12 (100.0) | 4 (33.3) | 8 (66.7) | |
S, susceptible; LLR, low-level resistance; HLR; high-level resistance.
Trend chi-square test.
Among 14 isolates with high EMB MICs, mutations in embCAB were present in 12 (85.7%). All these 12 isolates carried embB mutations. Five isolates (41.7% [5/12]) harbored embB mutations alone. The other 7 (58.3% [7/12]) isolates with embB mutations harbored additional mutations in embA, with one isolate also harboring a mutation in embC. Eleven (91.7% [11/12]) isolates carried embB mutations that were associated with resistance in the multivariate analysis (Met306Val, Met306Ile, and Gly406Ala). None of the high-level EMB-resistant isolates had a single mutation in embA or embC.
DISCUSSION
It was well reported that the arabinosyltransferases encoded by embCAB are targets for EMB and that amino acid replacements in these proteins could confer EMB resistance (3, 4, 15). This study revealed that in China, 81.9% (59/72) of low-level EMB-resistant isolates and 85.7% (12/14) of high-level EMB-resistant isolates harbored at least one mutation in embCAB. Among these resistant isolates, considerably fewer distinct amino acid replacements were detected in embC (n = 2) compared to the numbers detected in embA (n = 15) and embB (n = 68). One possibility was that EMB treatment led to less selective pressure on embC relative to that on embA and embB.
Our data also support that mutations within embB were prevalent in 79.1% of EMB-resistant isolates (68/86). These mutations were concentrated in a small region (codons 306 to 497). Overall, 8 distinct codons in embB were identified in this study that had mutations leading to amino acid changes. Most mutations were observed in embB codon 306 (n = 56) and embB codon 406 (n = 5), resulting in three different amino acid changes. Several reports noted a strong correlation between EMB MICs and mutations within embB (16). Accordingly, we also found that the embB mutations Met306Val, Met306Ile, and Gly406Ala were associated with marked elevations in EMB MICs. However, in this study, the number of Gly406Ala and Met306Ile mutants was significantly fewer than that of Met306Val. Considering the difference in numbers, the sizes of the isolates may affect the statistical analysis, and further studies containing more isolates with these two mutations are needed. Mutations in codon 319, which is a scarce codon site within embB conferring EMB resistance, according to prior data (17), were detected in 3 of the low-level EMB-resistant isolates. This finding indicated that the embB codon 319 mutation may more frequently contribute to low-level EMB resistance in China. Notably, isolates carrying both embB Met306Val and embA C(−11)A or both embB Met306Ile and embA C(−16)T had higher MICs than isolates carrying the embB mutation alone, suggesting that interactions between embB and embA UR influenced the EMB MICs. Nevertheless, we observed these mutation combinations in a small number of isolates. Additionally, two isolates with embA C(−16)T and embB Met306Ile mutations had EMB MICs of 8 and 64 μg/ml, respectively. Therefore, additional investigations that include a substantial panel of isolates with combined mutations will be required in the future.
Fifteen EMB-resistant isolates harbored mutations in embA. Almost all embA mutations were located in UR, and only one mutation was located in the ORF. A previous report revealed that isolates with embA UR mutations had much higher levels of embA and embB mRNAs as well as higher MICs to EMB (18). Our data showed that single mutations in embA UR occurred in low-level EMB-resistant isolates. High-level EMB-resistant isolates with embA UR mutations always carried the additional mutation within embB.
Mutations within embC were detected rarely in our EMB-resistant isolates (n = 2), indicating that embC mutations were less important for EMB resistance in China.
Our data confirmed that EMB-susceptible isolates also harbored mutations in embB (6 isolates) (9, 19–21). However, the mutation frequency in susceptible isolates was significantly lower than that in EMB-resistant isolates. Interestingly, among 6 mutated EMB-susceptible isolates, 4 (66.7%) had MICs of 2.0 μg/ml, which is close to the breakpoint MIC definition of EMB resistance. These results implied that some embB mutations likely conferred a small increase in the MIC. Yet, these mutations may be important, as they represent the first step on the path to EMB resistance.
A prior report suggested that mutations at embB codon 306 appeared to be necessary, but not sufficient, to produce high-level EMB resistance (22). However, in the current study, only 10 of 14 (71.4%) high-level EMB-resistant isolates harbored embB306 mutations. Among the other four isolates, two harbored mutations at codons 406 and 412 of embB, and two harbored no mutation in embCAB. Our results also showed that isolates with high-level resistance were more likely to carry multiple mutations in embCAB and that there was a strong association between multiple mutations and high-level EMB resistance. All these findings support the idea that this type of resistance might be complex, involving multiple mutations in one or several genes that interact to produce the high-level MICs (5).
Three novel mutations, embC Asp329Glu, embA G(−5)A, and embA Val18Phe, were identified in EMB-resistant isolates of this study. However, two embA mutations were accompanied by the additional mutation within embB. Thus, their relevance for EMB resistance was uncertain and needs further investigation. Moreover, there were still 13 low-level EMB-resistant isolates and 2 high-level EMB-resistant isolates lacking the mutation in the embCAB analyzed, suggesting that resistance in these isolates may be due to mutations outside the sequenced region or in other genes, such as embR, ubiA, and aftA (8, 23, 24).
In summary, most EMB-resistant isolates from China harbored mutations within embCAB, principally in the embB and embA UR. Single mutations, such as embB Met306Val, embB Met306Ile, and embB Gly406Ala, as well as multiple mutations, including embA C(−11)A with embB Met306Val and embA C(−16)T with embB Met306Ile, could increase EMB MIC levels. High-level EMB-resistant isolates were correlated with multiple mutations. Moreover, there were still some EMB-resistant TB isolates harboring no mutation within the sequenced area of embCAB. Further studies aimed at novel targets detected by genomic approaches will be necessary to better understand the mechanisms of EMB resistance.
MATERIALS AND METHODS
Ethics statement.
This study was approved by the ethics committee of National Institute for Communicable Disease Control and Prevention, Chinese Center for Disease Control and Prevention. The TB patients included in the present research were given a subject information form, and they all gave written informed consent to participate in the study.
Mycobacterium tuberculosis isolates.
A total of 125 M. tuberculosis isolates collected from 125 epidemiologically unrelated adult patients with pulmonary tuberculosis from China were included in this study. All the isolates were maintained on Lowenstein-Jensen (L-J) medium and freshly subcultured before being used for MIC testing.
EMB MIC testing.
EMB MICs were determined by a microplate alamarBlue assay (MABA) as described previously (25, 26). Briefly, a 100-μl volume of Middlebrook 7H9 broth was dispensed in each well of the plate. EMB concentrations prepared directly in 7H9 broth were 0.25, 0.5, 1, 2, 4, 8, 16, 32, 64, and 128 μg/ml. The inoculum was prepared from fresh L-J medium in 7H9 broth, and then adjusted to a McFarland no. 1 turbidity standard and diluted 1:20; 100-μl inoculums were used to inoculate each well of the plate. Plates were sealed and incubated at 37°C for 1 week. Twenty-five microliters of 0.02% resazurin solution was added to each well, and plates were reincubated for an additional 2 days. Each isolate was tested in two independent repeat tests. If the result of retesting conflicted with the initial result, a third round of testing was conducted, with the final result representing the result of two of the three tests. The breakpoint MIC was taken as 4 μg/ml (27).
DNA extraction, PCR, and DNA sequencing.
Genomic DNA was extracted from M. tuberculosis isolates with a traditional cetyltrimethylammonium bromide (CTAB) method (28) and stored at −20°C for PCR amplification.
The hot regions conferring EMB resistance, including embC (codons 208 to 428), embA (145 bp of the upstream sequence to codon 164), and embB (codons 159 to 518), of all isolates were amplified with primers embC-F (CACCGGGTCTGAGCTTCTC), embC-R (CAAGGCACCGATGATGCAG), embA-F (AACCTAGGAACGGTGACT), embA-R (CAACCTGTGGCTTCTTCT), embB-F (AACTTCGTCGGGCTCAAG), and embB-R (TAACGCAGGTTCTCGGTATA). The PCR conditions consisted of a denaturation step at 94°C for 5 min, followed by 30 cycles of denaturation at 94°C for 40 s, primer annealing at 58°C for 40 s, and extension at 72°C for 1 min, and a final extension step at 72°C for 8 min. All amplified products were purified, dried, and loaded onto an ABI 3730XL DNA analyzer (Applied Biosystems, Foster City, CA). The sequences generated were aligned with BioEdit version 7.05.3 and compared with the published sequences (GenBank accession number NC_000962).
Statistical analysis.
The univariate associations of the embCAB mutations with the MICs were assessed using a Wilcoxon rank sum test. As MIC distributions gave good fits to a Gaussian distribution on a 2-fold log scale (29), the MIC values were transformed to the log2 scale and subjected to linear regression. A multiplicative interaction term was added for each pair of mutations only if two or more strains harbored the mutation pair. Forward selection, backward elimination, and stepwise regression were applied to arrive at the final model. A linear trend between mutated type (single mutation or multiple mutations) and EMB MIC category was evaluated using the exact Cochran-Armitage test. A P value of less than 0.01 was considered to be statistically significant. All statistical data were performed using SAS (version 9.3) software (SAS Institute, Cary, NC).
ACKNOWLEDGMENTS
This study was supported by the National Natural Science Foundation of China (grant no. 81201348) and the National Basic Research Program of China (973 program, grant no. 2015CB554202). The funders had no role in the study design, data collection and analysis, decision to publish, or manuscript preparation.
All authors have no competing interests.
REFERENCES
- 1.World Health Organization. 2015. Global tuberculosis report. WHO/HTM/TB/2015.11. World Health Organization, Geneva, Switzerland. [Google Scholar]
- 2.Zhao Y, Xu S, Wang L, Chin DP, Wang S, Jiang G, Xia H, Zhou Y, Li Q, Ou X, Pang Y, Song Y, Zhao B, Zhang H, He G, Guo J, Wang Y. 2012. National survey of drug-resistant tuberculosis in China. N Engl J Med 366:2161–2170. doi: 10.1056/NEJMoa1108789. [DOI] [PubMed] [Google Scholar]
- 3.Telenti A, Philipp WJ, Sreevatsan S, Bernasconi C, Stockbauer KE, Wieles B, Musser JM, Jacobs WR Jr. 1997. The emb operon, a gene cluster of Mycobacterium tuberculosis involved in resistance to ethambutol. Nat Med 3:567–570. doi: 10.1038/nm0597-567. [DOI] [PubMed] [Google Scholar]
- 4.Mikusova K, Slayden RA, Besra GS, Brennan PJ. 1995. Biogenesis of the mycobacterial cell wall and the site of action of ethambutol. Antimicrob Agents Chemother 39:2484–2489. doi: 10.1128/AAC.39.11.2484. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Safi H, Lingaraju S, Amin A, Kim S, Jones M, Holmes M, McNeil M, Peterson SN, Chatterjee D, Fleischmann R, Alland D. 2013. Evolution of high-level ethambutol-resistant tuberculosis through interacting mutations in decaprenylphosphoryl-beta-d-arabinose biosynthetic and utilization pathway genes. Nat Genet 45:1190–1197. doi: 10.1038/ng.2743. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Huang WL, Chi TL, Wu MH, Jou R. 2011. Performance assessment of the GenoType MTBDRsl test and DNA sequencing for detection of second-line and ethambutol drug resistance among patients infected with multidrug-resistant Mycobacterium tuberculosis. J Clin Microbiol 49:2502–2508. doi: 10.1128/JCM.00197-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Plinke C, Cox HS, Zarkua N, Karimovich HA, Braker K, Diel R, Rusch-Gerdes S, Feuerriegel S, Niemann S. 2010. embCAB sequence variation among ethambutol-resistant Mycobacterium tuberculosis isolates without embB306 mutation. J Antimicrob Chemother 65:1359–1367. doi: 10.1093/jac/dkq120. [DOI] [PubMed] [Google Scholar]
- 8.Brossier F, Sougakoff W, Bernard C, Petrou M, Adeyema K, Pham A, Amy de la Breteque D, Vallet M, Jarlier V, Sola C, Veziris N. 2015. Molecular analysis of the embCAB locus and embR gene involved in ethambutol resistance in clinical isolates of Mycobacterium tuberculosis in France. Antimicrob Agents Chemother 59:4800–4808. doi: 10.1128/AAC.00150-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Zhao LL, Sun Q, Liu HC, Wu XC, Xiao TY, Zhao XQ, Li GL, Jiang Y, Zeng CY, Wan KL. 2015. Analysis of embCAB mutations associated with ethambutol resistance in multidrug-resistant Mycobacterium tuberculosis isolates from China. Antimicrob Agents Chemother 59:2045–2050. doi: 10.1128/AAC.04933-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Shi D, Li L, Zhao Y, Jia Q, Li H, Coulter C, Jin Q, Zhu G. 2011. Characteristics of embB mutations in multidrug-resistant Mycobacterium tuberculosis isolates in Henan, China. J Antimicrob Chemother 66:2240–2247. doi: 10.1093/jac/dkr284. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Li Y, Wang Y, Zhang Z, Gao H, Wang H, Cao J, Zhang S, Liu Y, Lu J, Xu Z, Dai E. 2016. Association between embB codon 306 mutations, phenotypic resistance profiles, and genotypic characterization in clinical Mycobacterium tuberculosis isolates from Hebei, China. Antimicrob Agents Chemother 60:7295–7302. doi: 10.1128/AAC.00532-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Zhang Z, Wang Y, Pang Y, Kam KM. 2014. Ethambutol resistance as determined by broth dilution method correlates better than sequencing results with embB mutations in multidrug-resistant Mycobacterium tuberculosis isolates. J Clin Microbiol 52:638–641. doi: 10.1128/JCM.02713-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Shi R, Zhang J, Otomo K, Zhang G, Sugawara I. 2007. Lack of correlation between embB mutation and ethambutol MIC in Mycobacterium tuberculosis clinical isolates from China. Antimicrob Agents Chemother 51:4515–4517. doi: 10.1128/AAC.00416-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Campbell PJ, Morlock GP, Sikes RD, Dalton TL, Metchock B, Starks AM, Hooks DP, Cowan LS, Plikaytis BB, Posey JE. 2011. Molecular detection of mutations associated with first- and second-line drug resistance compared with conventional drug susceptibility testing of Mycobacterium tuberculosis. Antimicrob Agents Chemother 55:2032–2041. doi: 10.1128/AAC.01550-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Ramaswamy SV, Amin AG, Goksel S, Stager CE, Dou SJ, El Sahly H, Moghazeh SL, Kreiswirth BN, Musser JM. 2000. Molecular genetic analysis of nucleotide polymorphisms associated with ethambutol resistance in human isolates of Mycobacterium tuberculosis. Antimicrob Agents Chemother 44:326–336. doi: 10.1128/AAC.44.2.326-336.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Srivastava S, Ayyagari A, Dhole TN, Nyati KK, Dwivedi SK. 2009. emb nucleotide polymorphisms and the role of embB306 mutations in Mycobacterium tuberculosis resistance to ethambutol. Int J Med Microbiol 299:269–280. doi: 10.1016/j.ijmm.2008.07.001. [DOI] [PubMed] [Google Scholar]
- 17.Plinke C, Rusch-Gerdes S, Niemann S. 2006. Significance of mutations in embB codon 306 for prediction of ethambutol resistance in clinical Mycobacterium tuberculosis isolates. Antimicrob Agents Chemother 50:1900–1902. doi: 10.1128/AAC.50.5.1900-1902.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Cui Z, Li Y, Cheng S, Yang H, Lu J, Hu Z, Ge B. 2014. Mutations in the embC-embA intergenic region contribute to Mycobacterium tuberculosis resistance to ethambutol. Antimicrob Agents Chemother 58:6837–6843. doi: 10.1128/AAC.03285-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Brossier F, Veziris N, Aubry A, Jarlier V, Sougakoff W. 2010. Detection by GenoType MTBDRsl test of complex mechanisms of resistance to second-line drugs and ethambutol in multidrug-resistant Mycobacterium tuberculosis complex isolates. J Clin Microbiol 48:1683–1689. doi: 10.1128/JCM.01947-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Lee AS, Othman SN, Ho YM, Wong SY. 2004. Novel mutations within the embB gene in ethambutol-susceptible clinical isolates of Mycobacterium tuberculosis. Antimicrob Agents Chemother 48:4447–4449. doi: 10.1128/AAC.48.11.4447-4449.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Mokrousov I, Otten T, Vyshnevskiy B, Narvskaya O. 2002. Detection of embB306 mutations in ethambutol-susceptible clinical isolates of Mycobacterium tuberculosis from Northwestern Russia: implications for genotypic resistance testing. J Clin Microbiol 40:3810–3813. doi: 10.1128/JCM.40.10.3810-3813.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Safi H, Sayers B, Hazbon MH, Alland D. 2008. Transfer of embB codon 306 mutations into clinical Mycobacterium tuberculosis strains alters susceptibility to ethambutol, isoniazid, and rifampin. Antimicrob Agents Chemother 52:2027–2034. doi: 10.1128/AAC.01486-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.He L, Wang X, Cui P, Jin J, Chen J, Zhang W, Zhang Y. 2015. ubiA (Rv3806c) encoding DPPR synthase involved in cell wall synthesis is associated with ethambutol resistance in Mycobacterium tuberculosis. Tuberculosis (Edinb) 95:149–154. doi: 10.1016/j.tube.2014.12.002. [DOI] [PubMed] [Google Scholar]
- 24.Seidel M, Alderwick LJ, Birch HL, Sahm H, Eggeling L, Besra GS. 2007. Identification of a novel arabinofuranosyltransferase AftB involved in a terminal step of cell wall arabinan biosynthesis in Corynebacterianeae, such as Corynebacterium glutamicum and Mycobacterium tuberculosis. J Biol Chem 282:14729–14740. doi: 10.1074/jbc.M700271200. [DOI] [PubMed] [Google Scholar]
- 25.Kumar M, Khan I, Verma V, Qazi G. 2005. Microplate nitrate reductase assay versus Alamar blue assay for MIC determination of Mycobacterium tuberculosis. Int J Tuberc Lung Dis 9:939–941. [PubMed] [Google Scholar]
- 26.Leonard B, Coronel J, Siedner M, Grandjean L, Caviedes L, Navarro P, Gilman RH, Moore DA. 2008. Inter-and intra-assay reproducibility of microplate Alamar blue assay results for isoniazid, rifampicin, ethambutol, streptomycin, ciprofloxacin, and capreomycin drug susceptibility testing of Mycobacterium tuberculosis. J Clin Microbiol 46:3526–3529. doi: 10.1128/JCM.02083-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Montoro E, Lemus D, Echemendia M, Martin A, Portaels F, Palomino JC. 2005. Comparative evaluation of the nitrate reduction assay, the MTT test, and the resazurin microtitre assay for drug susceptibility testing of clinical isolates of Mycobacterium tuberculosis. J Antimicrob Chemother 55:500–505. doi: 10.1093/jac/dki023. [DOI] [PubMed] [Google Scholar]
- 28.Somerville W, Thibert L, Schwartzman K, Behr MA. 2005. Extraction of Mycobacterium tuberculosis DNA: a question of containment. J Clin Microbiol 43:2996–2997. doi: 10.1128/JCM.43.6.2996-2997.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Turnidge J, Kahlmeter G, Kronvall G. 2006. Statistical characterisation of bacterial wild-type MIC value distributions and the determination of epidemiological cut-off values. Clin Microbiol Infect 12:418–425. doi: 10.1111/j.1469-0691.2006.01377.x. [DOI] [PubMed] [Google Scholar]