Skip to main content
NCBI home page
Cell Stress & Chaperones logoLink to Cell Stress & Chaperones
. 2017 Jul 13;23(1):91–100. doi: 10.1007/s12192-017-0826-5

The purine-rich element-binding protein ChPur-α negatively regulates Hsc70 transcription in Crassostrea hongkongensis

Delin Xu 1, Di Wang 1, Miao Cui 1, Qizhong Zhang 1,✉
PMCID: PMC5741584  PMID: 28702780

Abstract

ChPur-α, a purine-rich element-binding protein, was discovered showing affinity to the ChHsc70 promoter in Crassostrea hongkongensis by DNA affinity purification and mass spectrometry analysis. Direct interaction between purified ChPur-α and the ChHsc70 promoter region was demonstrated by electrophoretic mobility shift assay in vitro. ChPur-α reduction led to clear enhancements of ChHsc70 transcription in the hemocytes of C. hongkongensis. Consistently, ChPur-α overexpression in heterologous HEK293T cells correlated with repressive phenotype in ChHsc70 promoter expression. ChHsc70 transcription was responsive to heat shock or CdCl2 stress by RT-PCR, signifying an inducible feature of ChHsc70 transcription by physical/chemical stress despite its constitutive nature. ChPur-α transcription was also induced by the two stressors. This indicates a plausible association between ChHsc70 and ChPur-α in the stress-induced genetic regulatory pathway. This study discovered a negatively regulatory role of ChPur-α in controlling ChHsc70 transcription in C. hongkongensis, and contributed to better understanding the regulatory mechanisms in control of Hsc70 transcription.

Electronic supplementary material

The online version of this article (doi:10.1007/s12192-017-0826-5) contains supplementary material, which is available to authorized users.

Keywords: Pur-α, Crassostrea hongkongensis, Hsc70, Transcriptional regulator, Negative regulation

Introduction

Molecular chaperones of HSP70 family are conserved stress proteins and ubiquitously present in the entire spectrum of organisms from bacteria to humans (Saibil 2013; Whitley et al. 1999). They are composed of both stress-inducible (Hsp70) and constitutive (Hsc70) forms and essential for survival and repair of stress-induced damage as well as during normal cellular homeostasis (Whitley et al. 1999). Hsp70 synthesis is rapidly and strongly induced from basal level by a variety of stressors so as to restore the proper folding of impaired proteins and thus prevent the formation of cytotoxic aggregates, whereas Hsc70 is synthesized at relative higher level under normal conditions and most dedicated to housekeeping functions such as assisting the correct folding of newly synthesized polypeptides, refolding or elimination of aberrant proteins, and transport of proteins into cellular organelles (Deshaies et al. 1988). Hsc70 expression has been previously acknowledged to change little upon burden of stressors (Giebel et al. 1988); however, there are a few of reports arguing their stress-inducible feature despite its constitutive nature. For instance, Hsc70 transcription in Chinese hamster cells was demonstrated to increase at least tenfold after a mild heat shock (Chen et al. 1996). Lencioni et al. recently reported a time-dependent upregulation of midge Hsc70 upon pesticide exposure regardless of pesticide concentration (Lencioni et al. 2016). These pieces of evidence indicate that the response manner of the Hsc70 to external stresses is host-dependent and plausibly involves distinct regulatory mechanisms.

The mechanisms triggering the Hsp70 induction has been extensively investigated at the transcriptional level, involving the combined regulation from both general regulators, such as GAGA factor, TBP (TATA-binding protein), STAT (signal transducer and activator of transcription), and gene-specific regulators like HSF-1 (heat shock factor 1) (Mason and Lis 1997; Pirkkala et al. 2001). In contrast, presumably due to the low sensitivity to stress, the reports regarding the regulation of Hsc70 expression are relatively less despite its physiological importance, although putative transcriptional elements have been demonstrated to be conservatively present in Hsc70 promoter region, which include TATA box, CAT box, and heat shock elements (HSEs) (Chen et al. 1996). The latter is supposed to be recognized by HSF-1 trimer upon stressed conditions, so as to fulfill the transcription activation (Stephanou et al. 1999). Only few transcription factors have been reported to participate in the Hsc70 expression regulation so far, including Sp1-like protein and KLF4 (Liu et al. 2008; Wilke et al. 2000). Sp1 was shown to specifically bind to the Hsc70 promoter at the Sp1 site so as to mediate ethanol induction of Hsc70 in neural cells (Wilke et al. 2000). KLF4 was discovered to perform a positive regulatory role on Hsc70 expression in murine myoblast cells (Liu et al. 2008), while whether the regulation is through direct protein-DNA interaction was not determined yet. The above information indicates that despite physiological and biological significance of Hsc70, the regulatory mechanisms governing its expression, particularly its host-dependent stress response, remain largely unknown.

In this study, transcriptional factors that show affinity to the ChHsc70 promoter region were isolated from gills of Crassostrea hongkongensis, the economically valuable oysters inhabiting mainly in the coast and estuary of south China. Purine-rich element-binding protein ChPur-α was identified, and its specific interaction with ChHsc70 promoter region was demonstrated in vitro. A negative regulatory role of ChPur-α on ChHsc70 messenger RNA (mRNA) expression was discovered in oyster native host as well as in heterologous HEK293T cells. Both ChHsc70 and ChPur-α transcriptions were induced by external physical or chemical stresses, and distinct induction patterns were shown.

Materials and methods

Oyster maintenance and treatment

One-year-old oysters (C. hongkongensis) with a mean shell length of 9 ± 1 cm were collected from a farm located in the Yangxi suburb, in Guangdong, China. The oysters were allowed to acclimate for 2 weeks in aerated artificial seawater as described previously (Miao et al. 2016). For heavy metal stress treatment, the oysters were selected at random and evenly transferred to 25-l plastic tanks filled with artificial sea water complemented either with CdCl2 at 50 μg/l or with no supplements. The seawater was renewed every other day with the original CdCl2 concentration. For thermal stress treatment, the acclimated oysters were relocated to a 37 °C water bath and kept for 1 h, followed by recovery under the original conditions for 3 h.

DNA affinity purification

DNA affinity purification was performed as described previously (Miao et al. 2016). Briefly, biotin-labeled ChHsc70 promoter that was amplified from C. hongkongensis genomic DNA using primers C70 promoter up and C70 promoter down (Table 1) was designed according to the ChHsc70 sequences deposited in GenBank with accession number KY906022. The resulting DNA products were immobilized to streptavidin-coated magnetic beads (Cat. No. 88816; Thermo) in DNA-binding buffer (10 mM Tris-HCl, 1 mM EDTA, and 2 M NaCl, pH 7.5) following the manufacturer’s instructions. After the washing steps, the nuclear protein extracts that were previously prepared from the gills of the stressed and the control oysters were introduced individually. Then, the reaction mixtures were incubated at room temperature for 15 min. After a second washing step, high-salt buffer (25 mM Tris-HCl and 200 mM NaCl, pH 7.5) was applied and the proteins showing affinity to the promoter were eluted. The latter was then subject to SDS-PAGE analysis. The identity of the band of interest was clarified by mass spectrometry as described in the supplementary materials.

Table 1.

Oligonucleotides used in this study

Primers name Sequence 5′ → 3′ Start site to end site Usage
Oligo(dT)18 TTTTTTTTTTTTTTTTT Reverse transcription
C70 promoter up ATCATTCACAGATCTAGAGGGGGG −457 to −480 Used to amplify ChHsc70 promoter fragment for DNA affinity purification and EMSA
C70 promoter down TTTCTTCCCCTTTCCCCTTTACT +19 to +41
ChPur-α-up ATGTCGGATAGAGAGAG 1~17 Used to amplify ChPur-α fragment for RACE
ChPur-α-down CTACTGACTTTCTTCACC 730~747
UP CGGCAGTGGTATCAACGCAGAGTAC Used with 3GSP2 and 5GSP2, UP (universal primer)
UP(dT) CGGCAGTGGTATCAACGCAGAGTAC(T)18 Synthesis of first-strand cDNA for 3′ RACE
3GSP 1 CAGATGACCATGAGGGACAGAATG 485~508 Used with 3-Down (dT) for first PCR of 3′ RACE
3GSP 2 CGTGGTGTGTACCTCAGAATTTCTGAAGT 577~605 Used with UP for nested PCR of 3′ RACE
UP(dG) CGGCAGTGGTATCAACGCAGAGTAC(G)10 Used for first PCR of 5′ RACE
5GSP 1 GTCCCTCATGGTCATCTGTCC 482~502 Used with UP for nested PCR of 5′ RACE
5GSP 2 CTGAGCAGGAATGGCAATCTGAGAGC 407~432
ChPur-α-F-NdeI ATAAAACATATGTCGGATAGAGAGAGTGGGGAC 4~24 Used to amplify ChPur-α fragment for clone and expression
ChPur-α-R-HindIII ATAAAAAAGCTTCTGACTTTCTTCACCCCCT 726~744
C70-F-KpnI ATAAAAGGTACCATCATTCACAGATCTAGAGG −457 to −476 Used to amplify ChHsc70 promoter fragment for Dual-luciferase reporter assay
C70-R-XhoI ATAAAACTCGAGTTTCTTCCCCTTTCCCCT +24 to +41
ChPur-α-F-KpnI ATAAAAGGTACCATGTCGGATAGAGAGAGTGG 1~20 Used to amplify ChPur-α fragment for Dual-luciferase reporter assay
ChPur-α-R-XhoI ATAAAACTCGAGCTACTGACTTTCTTCACCCC 728~747
Actin-Up CTGTGCTACGTTGCCCTGGACTT +701 to +723 Used to amplify β-actin fragment for real-time PCR
Actin-Down TGGGCACCTGAATCGCTCGTT +829 to +849
RT-C-Up GGACAAGGCCCAGATCCACGACA 993~1015 Used to amplify ChHsc70 fragment for real-time PCR
RT-C-Down CAGAATGGCGGCCTGGACAGCT 1134~1155
RT-P-Up TGGATCAAACAGACGTGGTGTG 564~585 Used to amplify ChPurα fragment for real-time PCR
RT-P-Down AGCCCCTGCACTGGGTTTAC 701~720
Open in a new tab

Full-length ChPur-α cDNA sequencing

Total RNA was isolated from oyster gills by the TRIzol (Cat. No. 15596-026; Invitrogen) following the manufacturer’s instructions. First-strand complementary DNA (cDNA) was synthesized from 2 μg of total RNA using oligo(dT) primer at 55 °C for 30 min with 200 U M-MLV Reverse Transcriptase (Promega). The resultant cDNA pool was then used as template to amplify the ChPur-α coding sequence with the ChPur-α-up and ChPur-α-down primers (Table 1). The resulting products were ligated into the pMD18-T (TaKaRa) vector, and the inserted ChPur-α coding sequence was confirmed by nucleotide sequencing (Liuhe BGI). The 5′ and 3′ cDNA end sequence of ChPur-α was determined using RACE technology as described previously (Zhang and Zhang 2012).

Electrophoretic mobility shift assay

The ChPur-α coding sequence was amplified from the cDNA pool of C. hongkongensis using ChPur-α-F-NdeI and ChPur-α-R-HindIII primers by PCR. The PCR product was cloned into the pET22b(+) vector, and the resulting recombinant plasmid was transformed into E. coli BL21. The 6-histidine-tagged ChPur-α (His6 -ChPur-α) was overexpressed and purified as described previously (Xu et al. 2010). The 5′ FITC-labeled ChHsc70 promoter region (−457 to +41 relative to the predicted transcriptional start as +1) was amplified from C. hongkongensis genomic DNA by PCR using primers C70 promoter up and C70 promoter down. The labeled DNA probe was incubated with purified His6 -ChPur-α at various concentrations for 15 min at room temperature in binding buffer (10 mM Tris-HCl, 50 mM KCl, and 1 mM DTT, pH 7.5). Extra reactions were set in parallel using excess amounts of unlabeled ChHsp70 promoter and irrelevant DNA probes that act as specific and non-specific competitors, respectively. After incubation, the complexes were resolved on a 4% native polyacrylamide gel that had been pre-run at 100 V for 30 min and then subsequently run for 90 min at 100 V. The DNA bands were visualized by fluorescence imaging using an UVI Alliance 4.7 imager (UK).

ChPur-α knockdown

Approximately 300 ml of hemolymph was extracted from the posterior adductor muscle of the oysters using syringes, followed by centrifugation at 3000 rpm for 2 min. The collected hemocytes were washed with PBS three times and then resuspended in 50 ml complete DMEM (Dulbecco’s modified Eagle’s medium comprising 10% heat-inactivated fetal bovine serum [FBS] and supplemented with 0.4% NaCl, 100 units/ml penicillin, and 100 μg/ml streptomycin). The resulting hemocyte solution was plated on 24-well plates at a cell density of 1 × 105 cells/well, followed by incubation at 28 °C in a humidified incubator supplied with 5% CO2 for 24 h, so as to achieve 30–50% cell confluence. Subsequently, small interfering RNA (siRNA) and control RNA prepared by Sangon were individually transfected into the hemocytes using Lipofectamine™ 2000 (Invitrogen) according to the manufacturer’s instructions. The cells were allowed to recover at 28 °C for 24 h before collecting the first sample. The collected hemocytes were subsequently applied to RT-PCR analysis.

Dual-luciferase reporter assay

The ChPur-α coding sequence was amplified from the C. hongkongensis cDNA pool by PCR using the ChPur-α-F-KpnI and ChPur-α-R-XhoI primers (Table 1). The resulting PCR products were digested with the corresponding restriction enzymes and cloned into the pcDNA3.1 vector to yield pcDNA3.1-ChPur-α. The ChHsc70 promoter was amplified from C. hongkongensis genomic DNA using primers C70-F-KpnI and C70-R-XhoI (Table 1). The resulting PCR products were digested with Kpn I and Xho I restriction enzymes and cloned into the promoter probe vector pGL3-basic at the same sites to yield pGL3-ChHsc70p. HEK293T cells were cultivated according to the procedures described above for hemocyte cultivation. A 90–95% cell confluence was reached after plating onto 24-well plates. The dual-luciferase reporter assay was conducted as described previously (Miao et al. 2016). Briefly, the pGL3-ChHsc70 (200 ng/well), pRL-TK (20 ng/well, Promega), pcDNA3.1-ChPur-α (200 ng/well), or empty pcDNA3.1 (200 ng/well) plasmids were co-transfected into HEK293T cells using Lipofectamine™ 2000 (Invitrogen) in the DMEM medium lacking FBS and antibiotics in accordance with the manufacturer’s instructions. An incubation was maintained at 37 °C for 4.5 h, and the medium was changed back to complete DMEM, followed by an additional incubation for 24 h prior to the collection of the first sample. A Dual-Luciferase Reporter Assay System (Promega) was employed to determine the luciferase activities following the manufacturer’s instructions. Renilla luciferase activities were applied for correcting the transfection efficiency.

Quantitative real-time PCR

Total RNA was isolated from hemocytes transfected with either siRNA or control RNA as well as from gills of oysters that were either non-treated or treated by heat or CdCl2 at various time points using the TRIzol reagent (Cat. No. 15596-026; Invitrogen). First-strand cDNA was synthesized from 2 μg of total RNA of each sample using MLV Reverse Transcriptase (Promega) and oligo(dT) primer. Quantitative real-time PCR was performed as described previously (Zhang and Zhang 2012).

Statistical analysis

The data were processed by one-way ANOVA followed by the Tukey HSD test. Differences were considered as statistically significant at P < 0.05. IBM SPSS Statistics 19.0 was used for the statistical analysis.

Nucleotide sequence accession number

The ChPur-α cDNA sequence was deposited in the GenBank with accession number KY982276.

Results

Isolation and identification of proteins showing affinity to the ChHsc70 promoter in C. hongkongensis

The transcription factors that show affinity to the ChHsc70 promoter region were isolated by DNA affinity purification as described in the “Materials and Methods” section. The results are shown in Supplementary Fig. 1. A number of protein bands were visually detected under stressed or non-stressed conditions, while distinctive band patterns were shown. The band that is noticeably visible right below the 35 kDa marker was specifically appeared in the control and Cd-stressed lanes, but not in the heat-stressed lane. The nature of the band was subsequently revealed by mass spectrometry as Pur-α (Supplementary Fig. 2). The latter is a member of the Pur family of nucleic acid-binding proteins, which have been well known for the regulatory roles in a variety of DNA-dependent processes including transcription (Gallia et al. 2000). The stress-dependent affinity of Pur-α to the ChHsc70 promoter was of interest, and was therefore preferred for further study.

Fig. 2.

Fig. 2

Open in a new tab

Electrophoretic mobility shift assay of the ChHsc70 promoter with prokaryotically purified His6-ChPur-α. Fifty picomoles of FITC-labeled ChHsc70 promoter was added to all the lanes. The band positions of the shifted DNA-protein complexes and free DNA are designated by arrows

Characterization of the ChPur-α cDNA

The ChPur-α cDNA is 1503 bp in length, containing an open reading frame of 747 bp, as well as 87 and 669 bp of 5′ and 3′ untranslated regions, respectively (Fig. 1a). The peptide sequence consists of 248 amino acids, with a molecular weight of 28 kDa and an isoelectric point of 6.79. The three-dimensional structure was predicted by online SWISS-MODEL software (http://swissmodel.expasy.org/) using the ChPur-α amino acid sequence. The deduced protein model revealed the presence of three repeats of the Pur domains (Fig. 1a), which are dedicated to bind DNA, and the structure of the previous two Pur domains is shown in Fig. 1b.

Fig. 1.

Fig. 1

Open in a new tab

a The cDNA sequence and deduced amino acid sequence of ChPur-α in C. hongkongensis. The nucleotides and amino acids are numbered along both margins. Three repeats of Pur domains are marked by single lines, dashed lines, and double underlines, respectively. The putative DNA-binding sites are marked by triangles. The translation stop codon is indicated with an asterisk. b Three-dimensional structure of ChPur-α

ChPur-α directly interacts with the ChHsc70 promoter region in vitro

In order to test the ability of ChPur-α to directly interact with the ChHsc70 promoter region, electrophoretic mobility shift assay (EMSA) was performed using a FITC-labeled ChHsc70 promoter region and prokaryotically expressed/purified His6-ChPur-α. As shown in Fig. 2, the addition of ChPur-α clearly retarded the mobility of ChHsc70 promoter in a concentration-dependent manner (lanes 2 to 5). When excess amounts of unlabeled ChHsc70 promoter were introduced, the shifted band was eliminated (Fig. 2, lane 6), indicating a successful specific competition. However, the introduction of an irrelevant DNA fragment (+25 to +424 relative to the translational start on the ChPur-α coding sequence) led to largely compromised competition (Fig. 2, lane 7). These results indicated that ChPur-α interacts specifically with the ChHsc70 promoter in vitro.

ChPur-α knockdown led to enhanced ChHsc70 transcription in C. hongkongensis hemocytes

In order to discover the regulatory role of ChPur-α on ChHsc70 transcription, ChHsc70 mRNA expression was determined in both control- and siRNA-treated hemocytes of C. hongkongensis by RT-RCR. The results are shown in Fig. 3. Upon siRNA treatment, the mRNA expression of ChPur-α was depleted drastically at all tested time points, validating the effective gene knockdown of ChPur-α. In conditions of ChPur-α depletion, ChHsc70 transcription was apparently increased in all tested time points within 24 h. These results demonstrated that ChPur-α negatively regulated ChHsc70 mRNA expression in native C. hongkongensis host. Another noticeable point was the induced profile of the basal as well as the siRNA-treated ChHsc70 transcription until 12 h. While taking into account the in vitro cultivation of the oyster hemocytes, this induction might be very likely due to the experienced stress caused by the disturbed biological context.

Fig. 3.

Fig. 3

Open in a new tab

ChHsc70 and ChPur-α steady-state RNA levels by RT-PCR after the introduction of either control RNA (control) or siRNA (RNAi). All values are expressed as the means ± SD (n = 3). Asterisks above the bars indicate that values are significantly different from the individual controls (*P < 0.05 and **P < 0.01). Bars on the same group with different letters are statistically significant from one another

ChPur-α overexpression repressed ChHsc70 transcription in heterologous host HEK293T cells

The regulatory effects of overexpressed ChPur-α on ChHsc70 transcription were tested in HEK293 cells using luciferase reporter assay as described in the “Materials and methods” section. The results are shown in Fig. 4. The overexpressed ChPur-α clearly repressed the ChHsc70 mRNA expression particularly at 0, 6, 12, and 24 h. These results demonstrated that constitutively expressed ChPur-α played a negative regulatory role on the ChHsc70 transcription in the heterologous HEK293T host, which is consistent with that in the oyster native hemocytes. Noticeably, the ChHsc70 promoter activity in the control cells clearly decreased at 3 h. However, this repressed state was soon overturned since a clear increase in the ChHsc70 promoter expression was observed at 6 h. Interestingly, such oscillating expression manner (decrease followed by overturn) was presented again in the following time points. These results indicate that the mechanisms underlying the basal promoter expression are intrinsically complex in the heterologous HEK293 host.

Fig. 4.

Fig. 4

Open in a new tab

Luciferase activity driven by the ChHsc70 promoter in HEK293T cells upon the introduction of pcDNA3.1-ChPur-α and pcDNA3.1. All values are presented as the means ± SD (n = 3). Asterisks above the bars indicate that the values are significantly different from the individual controls (*P < 0.05 and **P < 0.01). Bars on the same group with different letters are statistically significant from one another

ChHsc70 and ChPur-α transcription profiles upon heat shock and CdCl2 stresses

In order to discover the relationship between ChHsc70 and ChPur-α in response to the external physical or chemical stress, the ChHsc70 and ChPur-α transcriptions were determined by RT-PCR in the gills of the oysters treated with heat or CdCl2 at 50 μg/l, the concentration of which has been previously demonstrated to be suitable for induction (data not shown). The results are shown in Fig. 5. The mRNA expression of ChHsc70 was clearly induced upon heat and Cd stresses, with the induced peaks at 6 h and 2 days, respectively. The ChPur-α transcription was also induced upon either of the two stresses. However, a different induction pattern was shown since the induction peaks were accumulated at 24 and 4 h, respectively, both of which were slightly delayed in comparison with that of the ChHsc70. These results demonstrated that the mRNA expressions of both ChHsc70 and ChPur-α were inducible by external stresses, indicating a correlated association between the two genes in the stress-induced regulatory pathway.

Fig. 5.

Fig. 5

Open in a new tab

ChHsc70 and ChPur-α expression levels by RT-PCR after a heat or b CdCl2 stress. All values are expressed as the means ± SD (n = 3). Asterisks above the bars indicate that the values are significantly different from the individual controls (*P < 0.05 and **P < 0.01). Bars on the same group with different letters are statistically significant from one another

Discussion

Pur-α is a highly conserved nucleic acid-binding protein that is ubiquitously expressed from bacteria through humans (Gallia et al. 2000). Human Pur-α was characterized to bind preferentially to a purine-rich single-strand element that is present upstream of the c-MYC gene (Bergemann and Johnson 1992; Bergemann et al. 1992). A consensus Pur-α binding sequence of GGNNGAGGGAGARRRR has been derived, and its presence was confirmed at origins of replication and in gene flanking regions in various eukaryotes (Bergemann and Johnson 1992). Pur-α is known with multiple cellular functions including the initiation of DNA replication and control of mRNA translation and transcription, and thus plays important roles in regulating cell cycle and proliferation (Gallia et al. 2000). Pur-α has been demonstrated to positively or negatively regulate the transcription of diverse target genes such as α-MHC (α-myosin heavy chain) (Gupta et al. 2003), PL (placental lactogen) (Limesand et al. 2004), AβPP (Darbinian et al. 2008), and BC1 RNA (Kobayashi et al. 2000). In this study, ChHsc70 was discovered as a novel target of ChPur-α, and the negative regulatory role of ChPur-α on ChHsc70 transcription was characterized in C. hongkongensis.

Analysis of the ChPur-α amino acid sequence showed the presence of three repeats of Pur domains, each of which contains an aromatic-basic section and a leucine-acidic section (Fig. 1). Such a unique and structurally conserved domain is known to be involved in DNA binding, especially to the single-stranded element with the sequence GGN (N is for any nucleotide) (Gallia et al. 2000). It has been previously demonstrated that Purα binds to a purine-rich negative regulatory (PNR) element in competition with an Ets-related protein to repress the transcription and translation of α-MHC gene (Gupta et al. 2003). When analyzing the ChHsc70 promoter, two sites that show 87.5% similarity (only one nucleotide difference) with the palindrome (TTCC...GGAA) in PNR were indeed discovered at the region between two HSEs (Supplementary Fig. 3), which were therefore deemed highly possible to be the target nucleotide sites of ChPur-α on the ChHsc70 promoter.

RNAi analysis clearly demonstrated a negative regulatory function of ChPur-α on ChHsc70 transcription in the oyster native host (Fig. 3). Considering together with the previous EMSA data (Fig. 2), these results suggest that ChPur-α negatively regulates the ChHsc70 mRNA expression through direct binding to its promoter region. Since ChPur-α depletion had a positive impact on ChHsc70 transcription, it was logical to suppose that conversely, ChPur-α overexpression should associate with a repressive phenotype. Indeed, in comparison with the control, the ChHsc70 mRNA expression was apparently decreased upon ChPur-α overexpression at most tested time points; however, such phenotype was not steadily shown since the repression was largely compromised at 3 and 18 h (Fig. 4). It has been previously noted that in addition to DNA and/or RNA binding, an important aspect of Pur-α function is to recruit and interact with cooperative transcription factors, affect their DNA-binding capabilities, and finally manipulate the transcription of target genes. For example, the association of Pur-α with E2F-1 showed to inhibit the DNA-binding capability of E2F-1 and resulted in a drastic decrease in the ability of E2F-1 in activating its target promoter DHFR (Darbinian et al. 1999). It is therefore reasonable to expect the emergence of any intrinsic repressors whose DNA-binding ability was intermittently disturbed by overexpressed ChPur-α, so as to lead an irregular repressive phenotype.

In spite of the constitutive nature of Hsc70, a lot of evidence has shown that the Hsc70 expression is inducible by heat shock and/or heavy metal stress in various hosts such as sea urchin and midge larvae (Bernabo et al. 2011; Lencioni et al. 2016; Yoshimi et al. 2009). In this study, the expression of ChHsc70 of C. hongkongensis was demonstrated to be significantly induced by both heat and Cd stresses by RT-PCR analysis, presenting the induction profiles of induction accumulation, peaking, decline, and recovery (Fig. 5). Such profiles resemble that of the stress-inducible ChHsp70 which was determined previously (Miao et al. 2016; Zhang and Zhang 2012) and likely reflect the transition of the physiological states of the oysters, which was driven by the demands of the molecular chaperones at different stages upon external stresses. ChPur-α transcription was also responsive to the two stresses, while the accumulated ChPur-α expression peak induced by either heat or Cd appeared at the point that was slightly delayed when compared with the corresponding ChHsc70 peak. Taking into account the previously discovered negative regulatory function, this tardy accumulated ChPur-α might be very likely to contribute to the recovery of the induced ChHsc70 expression back to its original level. Besides heat and heavy metal (Cd) stresses, a similar induction pattern was observed to both ChHsc70 and ChPur-α transcriptions when exposed to NP (nonylphenol) and TBT (tributyltin) (Supplementary Fig. 4), which are notorious endocrine-disrupting chemicals that are frequently found but not readily decomposable in aquatic environments (Lee et al. 2010; Soares et al. 2008). There results indicate that ChHsc70 and ChPur-α transcriptions might response universally to common aquatic pollutants.

In summary, we demonstrate a clear negative regulatory role of ChPur-α on ChHsc70 mRNA expression through direct protein-DNA interaction in C. hongkongensis. The unsteady ChPur-α regulatory effects on ChHsc70 transcription in a heterologous HEK293T host cells suggest a complex mechanism mediated by ChPur-α and likely involve the collaboration of other factors. This study discovered a novel regulatory target for Pur-α and presents the first evidence of a transcriptional factor in regulating the Hsc70 expression in Crassostrea.

Electronic supplementary material

ESM 1 (633KB, docx)

(DOCX 633 kb)

Acknowledgements

This work was supported by the National Natural Science Foundation of China (No. 41476100, 31170474) and the Key Natural Science Foundation of Guangdong Province (No. S2013020012720).

Author contributions

We would like to declare that the present work is a product of the intellectual environment of the entire team, and all members have contributed in various degrees to the analytical methods used, to the data collection/interpretation, to the research concept, to the experiment design, and to the drafting/critical revision of the article. The detailed roles or tasks of each author are listed:

1. Delin Xu

Constructed the idea and hypothesis for research, planned the methodology to reach the conclusions, logically interpreted the results, completed the literature review, constructed/drafted the entire manuscript, critically revised the article before submission, and approved the final version of the article to be submitted

2. Di Wang

Managed the experimental materials and reagents, executed the experiments, managed and reported the data, presented and interpreted the results, reviewed the article mainly for spelling and grammar before submission, and approved the final version of the article to be submitted

3. Miao Cui

Managed the experimental materials and reagents, executed the experiments, managed and interpreted the data, completed the literature review, organized the course of the project, reviewed the article for both grammar and intellectual content before submission, and approved the final version of the article to be submitted

4. Qizhong Zhang

Provided the personnel, environmental, and financial support and tools and instruments that are vital for the project; constructed the idea or hypothesis for the research and manuscript; supervised the course of the project and article; reviewed the article for both grammar and intellectual contents before submission; and approved the final version of the article to be submitted

Footnotes

Delin Xu and Di Wang contributed equally to this work.

Electronic supplementary material

The online version of this article (doi:10.1007/s12192-017-0826-5) contains supplementary material, which is available to authorized users.

References

  1. Bergemann AD, Johnson EM. The HeLa Pur factor binds single-stranded DNA at a specific element conserved in gene flanking regions and origins of DNA replication. Mol Cell Biol. 1992;12(3):1257–1265. doi: 10.1128/MCB.12.3.1257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bergemann AD, Ma ZW, Johnson EM. Sequence of cDNA comprising the human pur gene and sequence-specific single-stranded-DNA-binding properties of the encoded protein. Mol Cell Biol. 1992;12(12):5673–5682. doi: 10.1128/MCB.12.12.5673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bernabo P, Rebecchi L, Jousson O, Martinez-Guitarte JL, Lencioni V. Thermotolerance and hsp70 heat shock response in the cold-stenothermal chironomid Pseudodiamesa branickii (NE Italy) Cell Stress Chaperones. 2011;16(4):403–410. doi: 10.1007/s12192-010-0251-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chen MS, Featherstone T, Laszlo A. Amplification and altered expression of the hsc70/U14 snoRNA gene in a heat resistant Chinese hamster cell line. Cell Stress Chaperones. 1996;1(1):47–61. doi: 10.1379/1466-1268(1996)001<0047:AAAEOT>2.3.CO;2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Darbinian N, Cui J, Basile A, Del Valle L, Otte J, Miklossy J, Sawaya BE, Amini S, Khalili K, Gordon J. Negative regulation of AbetaPP gene expression by Pur-alpha. J Alzheimers Dis. 2008;15(1):71–82. doi: 10.3233/JAD-2008-15106. [DOI] [PubMed] [Google Scholar]
  6. Darbinian N, Gallia GL, Kundu M, Shcherbik N, Tretiakova A, Giordano A, Khalili K. Association of Pur alpha and E2F-1 suppresses transcriptional activity of E2F-1. Oncogene. 1999;18(46):6398–6402. doi: 10.1038/sj.onc.1203011. [DOI] [PubMed] [Google Scholar]
  7. Deshaies RJ, Koch BD, Werner-Washburne M, Craig EA, Schekman R. A subfamily of stress proteins facilitates translocation of secretory and mitochondrial precursor polypeptides. Nature. 1988;332(6167):800–805. doi: 10.1038/332800a0. [DOI] [PubMed] [Google Scholar]
  8. Gallia GL, Johnson EM, Khalili K. Puralpha: a multifunctional single-stranded DNA- and RNA-binding protein. Nucleic Acids Res. 2000;28(17):3197–3205. doi: 10.1093/nar/28.17.3197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Giebel LB, Dworniczak BP, Bautz EK. Developmental regulation of a constitutively expressed mouse mRNA encoding a 72-kDa heat shock-like protein. Dev Biol. 1988;125(1):200–207. doi: 10.1016/0012-1606(88)90073-5. [DOI] [PubMed] [Google Scholar]
  10. Gupta M, Sueblinvong V, Raman J, Jeevanandam V, Gupta MP. Single-stranded DNA-binding proteins PURalpha and PURbeta bind to a purine-rich negative regulatory element of the alpha-myosin heavy chain gene and control transcriptional and translational regulation of the gene expression. Implications in the repression of alpha-myosin heavy chain during heart failure. J Biol Chem. 2003;278(45):44935–44948. doi: 10.1074/jbc.M307696200. [DOI] [PubMed] [Google Scholar]
  11. Kobayashi S, Agui K, Kamo S, Li Y, Anzai K. Neural BC1 RNA associates with pur alpha, a single-stranded DNA and RNA binding protein, which is involved in the transcription of the BC1 RNA gene. Biochem Biophys Res Commun. 2000;277(2):341–347. doi: 10.1006/bbrc.2000.3683. [DOI] [PubMed] [Google Scholar]
  12. Lee J-H, Cho C, Kim H-Y, Cho H-S. Characteristics of bioconcentration and depuration of endocrine disruption chemicals in the flounder,Paralichthys olivaceus, under flow-through system. Toxicol Environ Heal Sci. 2010;2(4):221–230. doi: 10.1007/BF03217487. [DOI] [Google Scholar]
  13. Lencioni V, Grazioli V, Rossaro B, Bernabo P. Transcriptional profiling induced by pesticides employed in organic agriculture in a wild population of Chironomus riparius under laboratory conditions. Sci Total Environ. 2016;557-558:183–191. doi: 10.1016/j.scitotenv.2016.03.062. [DOI] [PubMed] [Google Scholar]
  14. Limesand SW, Jeckel KM, Anthony RV. Puralpha, a single-stranded deoxyribonucleic acid binding protein, augments placental lactogen gene transcription. Mol Endocrinol. 2004;18(2):447–457. doi: 10.1210/me.2003-0392. [DOI] [PubMed] [Google Scholar]
  15. Liu Y, Zhao J, Liu J, Zhang H, Liu M, Xiao X. Upregulation of the constitutively expressed HSC70 by KLF4. Cell Stress Chaperones. 2008;13(3):337–345. doi: 10.1007/s12192-008-0033-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Mason PB, Jr, Lis JT. Cooperative and competitive protein interactions at the hsp70 promoter. J Biol Chem. 1997;272(52):33227–33233. doi: 10.1074/jbc.272.52.33227. [DOI] [PubMed] [Google Scholar]
  17. Miao Z, Xu D, Cui M, Zhang Q. High mobility group protein DSP1 negatively regulates HSP70 transcription in Crassostrea hongkongensis. Biochem Biophys Res Commun. 2016;474(4):634–639. doi: 10.1016/j.bbrc.2016.03.163. [DOI] [PubMed] [Google Scholar]
  18. Pirkkala L, Nykanen P, Sistonen L. Roles of the heat shock transcription factors in regulation of the heat shock response and beyond. FASEB J Off Publ Fed Am Soc Exp Biol. 2001;15(7):1118–1131. doi: 10.1096/fj00-0294rev. [DOI] [PubMed] [Google Scholar]
  19. Saibil H. Chaperone machines for protein folding, unfolding and disaggregation. Nat Rev Mol Cell Biol. 2013;14(10):630–642. doi: 10.1038/nrm3658. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Soares A, Guieysse B, Jefferson B, Cartmell E, Lester JN. Nonylphenol in the environment: a critical review on occurrence, fate, toxicity and treatment in wastewaters. Environ Int. 2008;34(7):1033–1049. doi: 10.1016/j.envint.2008.01.004. [DOI] [PubMed] [Google Scholar]
  21. Stephanou A, Isenberg DA, Nakajima K, Latchman DS. Signal transducer and activator of transcription-1 and heat shock factor-1 interact and activate the transcription of the Hsp-70 and Hsp-90beta gene promoters. J Biol Chem. 1999;274(3):1723–1728. doi: 10.1074/jbc.274.3.1723. [DOI] [PubMed] [Google Scholar]
  22. Whitley D, Goldberg SP, Jordan WD. Heat shock proteins: a review of the molecular chaperones. J Vasc Surg. 1999;29(4):748–751. doi: 10.1016/S0741-5214(99)70329-0. [DOI] [PubMed] [Google Scholar]
  23. Wilke N, Sganga MW, Gayer GG, Hsieh KP, Miles MF. Characterization of promoter elements mediating ethanol regulation of hsc70 gene transcription. J Pharmacol Exp Ther. 2000;292(1):173–180. [PubMed] [Google Scholar]
  24. Xu D, Seghezzi N, Esnault C, Virolle MJ. Repression of antibiotic production and sporulation in Streptomyces coelicolor by overexpression of a TetR family transcriptional regulator. Appl Environ Microbiol. 2010;76(23):7741–7753. doi: 10.1128/AEM.00819-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Yoshimi T, Odagiri K, Hiroshige Y, Yokobori S, Takahashi Y, Sugaya Y, Miura T. Induction profile of HSP70-cognate genes by environmental pollutants in Chironomidae. Environ Toxicol Pharmacol. 2009;28(2):294–301. doi: 10.1016/j.etap.2009.05.008. [DOI] [PubMed] [Google Scholar]
  26. Zhang Z, Zhang Q. Molecular cloning, characterization and expression of heat shock protein 70 gene from the oyster Crassostrea hongkongensis responding to thermal stress and exposure of Cu(2+) and malachite green. Gene. 2012;497(2):172–180. doi: 10.1016/j.gene.2012.01.058. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

ESM 1 (633KB, docx)

(DOCX 633 kb)

Articles from Cell Stress & Chaperones are provided here courtesy of Elsevier

RESOURCES