Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2019 Jan 1.
Published in final edited form as: Antiviral Res. 2017 Nov 10;149:41–47. doi: 10.1016/j.antiviral.2017.11.008

Efficacy of Hepatitis B Virus Ribonuclease H Inhibitors, a New Class of Replication Antagonists, in FRG Human Liver Chimeric Mice

Kelly R Long 1,*, Elena Lomonosova 2,*, Qilan Li 2, Nathan L Ponzar 2, Juan A Villa 2, Erin Touchette 1, Stephen Rapp 1, R Matt Liley 1, Ryan P Murelli 3, Alexandre Grigoryan 3, R Mark Buller 2, Lisa Wilson 4, John Bial 4, John E Sagartz 1, John E Tavis 2,&
PMCID: PMC5743599  NIHMSID: NIHMS921605  PMID: 29129708

Abstract

Chronic hepatitis B virus infection cannot be cured by current therapies, so new treatments are urgently needed. We recently identified novel inhibitors of the hepatitis B virus ribonuclease H that suppress viral replication in cell culture. Here, we employed immunodeficient FRG KO mice whose livers had been engrafted with primary human hepatocytes to ask whether ribonuclease H inhibitors can suppress hepatitis B virus replication in vivo. Humanized FRG KO mice infected with hepatitis B virus were treated for two weeks with the ribonuclease H inhibitors #110, an α-hydroxytropolone, and #208, an N-hydroxypyridinedione. Hepatitis B virus viral titers and S and e antigen plasma levels were measured. Treatment with #110 and #208 caused significant reductions in plasma viremia without affecting hepatitis B virus S or e antigen levels, and viral titers rebounded following treatment cessation. This is the expected pattern for inhibitors of viral DNA synthesis. Compound #208 suppressed viral titers of both hepatitis B virus genotype A and C isolates. These data indicate that Hepatitis B virus replication can be suppressed during infection in an animal by inhibiting the viral ribonuclease H, validating the ribonuclease H as a novel target for antiviral drug development.

Keywords: antivirals, chimeric mice, RNaseH, HBV, FRG

1. Introduction

At least 240 million people are chronically infected with hepatitis B virus (HBV) (Ott et al., 2012), and about two billion people worldwide have been infected with the virus (Morikawa et al., 2016). Chronic HBV infection is a major cause of end-stage liver disease, including cirrhosis, liver failure and hepatocellular carcinoma (Chen and Yang, 2011; Fattovich et al., 2008; Yang et al., 2008). HBV is not directly cytopathic, and liver damage is mainly caused by immune-mediated necro-inflammation (Guidotti and Chisari, 2006; Protzer and Schaller, 2000). Recently, de novo HBV reactivation during chemotherapy and immunosuppressive therapy has emerged as a major concern (Voican et al., 2016).

HBV is an enveloped DNA virus with a partially double-stranded relaxed circular DNA genome of 3.2 kb that replicates by reverse transcription via an RNA intermediate. Viral replication is catalyzed by the DNA priming, DNA polymerase (reverse transcriptase) and ribonuclease H (RNaseH) activities of the multifunctional HBV polymerase protein.

The standard treatments for HBV employ (pegylated) interferon α and nucleos(t)ide analogs (NAs). However, these monotherapies very rarely eradicate the virus even though they greatly reduce HBV replication, hepatitis, and progression of fibrosis (Tong and Revill, 2016; Zeisel et al., 2015). Advantages of interferon α treatment include relatively frequent (~30%) seroconversion against the HBV e antigen (HBeAg) (Perrillo, 2009), limited treatment duration, negligible risk of development viral resistance, and slightly increased clearance of HBV with time (Gupta et al., 2014). However, side effects often limit its use. Five NAs are approved for treatment of chronic HBV infection in the USA: lamivudine, telbivudine, adefovir, entecavir, and tenofovir (Lok et al., 2016). The NAs inhibit DNA elongation by the HBV polymerase during reverse transcription. NA therapy has fewer side effects than interferon α, can lower viremia to undetectable levels (Jones and Hu, 2013), reduces short-term risk of HCC by several fold (Hosaka et al., 2013), and inhibits and sometimes reverses progression of fibrotic and cirrhotic liver injury (Marcellin et al., 2013; Tana and Hoofnagle, 2013). Unfortunately, long-term treatment with NAs is required because viral titers almost always rebound upon drug removal (Tong and Revill, 2016). In addition, HBV’s high mutation rate (Caligiuri et al., 2016; Tong and Revill, 2016) can readily lead to drug resistance against the older NAs such as lamivudine (Gupta et al., 2014). Therefore, more efficient therapies are urgently needed.

The currently available direct-acting anti-HBV drugs – the NAs – target the HBV DNA polymerase activity, whereas there are no drugs against the equally essential viral RNaseH activity. Therefore, the RNaseH is an attractive target for new drugs that might be used in combination with current treatments to increase effectiveness and reduce development of resistance to the older, cheaper NAs (Tavis et al., 2013b; Tavis and Lomonosova, 2015). Recently we identified HBV RNaseH inhibitors in three chemical families that block HBV replication in cell culture (Cai et al., 2014; Edwards et al., 2017; Lomonosova et al., 2017a; Lu et al., 2015; Tavis et al., 2013a; Tavis and Lomonosova, 2015). We found that these inhibitors are equally effective against RNaseH enzymes from multiple isolates of HBV genotypes B, C, and D, implying that HBV’s high genetic diversity is unlikely to be a barrier to drug development (Lu et al., 2016). We also found that combinations of two RNaseH inhibitors from different chemical classes (α-hydroxytropolones (αHTs) and N-hydroxyisoquinolinediones (HIDs)) with the NA lamivudine or with each other synergistically inhibited HBV replication in cell culture (Lomonosova et al., 2017b).

Chimeric mice with humanized livers can support HBV infection (Allweiss and Dandri, 2016) and are excellent preclinical in vivo models to evaluate drug candidates (Scheer and Wilson, 2016). Several mouse models with humanized liver have been developed (Bissig et al., 2010; Tsuge et al., 2005). FRG KO mice have mutations in the recombination activating gene (rag)2 and the gamma chain of the interleukin 2 receptor (il2rg) that render them immunodeficient. They also carry a functional knockout of the fumarylacetoacetate hydrolase (fah) gene (Azuma et al., 2007), which causes intracellular accumulation of the toxic tyrosine metabolite fumarylacetoacetate that induces hepatocellular necrosis. Unlike the uPA/SCID humanized chimeric liver model (Rhim et al., 1994), onset and severity of hepatocellular injury in FRG mice is controllable through administration and withdrawal of the protective drug 2-(2-nitro-4-trifluoromethylbenzoyl)-1,3-cyclohexanedione (NTBC) that prevents accumulation of fumarylacetoacetate and liver damage. Since FRG KO animals are maintained in a healthy state on NTBC prior to transplant of human hepatocytes, they breed normally as homozygous triple knockouts. FRG KO mice can also be engrafted with primary hepatocytes from any human donor.

Here, we assessed whether inhibition of the HBV RNaseH was a viable antiviral mechanism for the first time by testing whether RNaseH inhibitors could interfere with HBV replication in vivo. Two recently discovered HBV RNaseH inhibitors from different chemotypes, #110 (an αHT) and #208 (an N-hydroxypyridinedione, HPD) (Edwards et al., 2017; Lu et al., 2015) were used. Compound #110 is an αHT with a 50% effective concentration (EC50) against HBV replication in culture of 0.34 μM and a 50% cytotoxic concentration (CC50) of 32 μM, yielding a therapeutic index (TI) of 94 (Lu et al., 2015). Compound #208 (an HPD) has an EC50 of 0.69 μM and a CC50 of 15 μM for a TI of 22 in culture (Edwards et al., 2017). These compounds were administered to HBV-infected chimeric FRG KO mice with humanized livers and their ability to suppress HBV viremia and viral antigenemia was evaluated.

2. Materials and Methods

2.1. Compounds

Entecavir was purchased from Toronto Research Chemicals (Toronto, Canada) and was dissolved in sterile saline (0.9% NaCl). Compound #208 (SUN-B 8155) was purchased from Tocris/Fisher Scientific (Illkirch, France) and was dissolved in 10% ethanol / 90% phosphate-buffered saline (PBS). Compound #110 (CM1912-6e) (Lu et al., 2015) was synthesized in the Murelli lab and prepared as a suspension in 10% ethanol / 70% PEG400 / 20% PBS.

2.2. Ribonuclease H assays

Recombinant HBV RNaseH was purified as described (Villa et al., 2016). The molecular beacon assay was based on (Chen et al., 2008). The RNaseH was combined with compounds #110 or #208 plus 25 nM of the molecular beacon (5′ FAM-CCTAGCTCTAAATCACTATGGTCGCGCTAGG-BHQ 3′) annealed to a synthetic RNA (5′ rGrCrGrArCrCrArUrArGrUrGrArUrUrUrArGrA 3′), and incubated in 50 mM HEPES (pH 8.0), 100 mM NaCl, 2 mM TCEP, 0.05% Tween 20 with 20 U RNaseOut for 70 minutes with continuous fluorescence measurement.

2.3. Animal care

All mice were handled according to protocols approved by the St. Louis University Institutional Animal Care and Use Committee. Animals received humane care according to the criteria outlined in the “Guide for the Care and Use of Laboratory Animals.”

2.4. Humanized mouse model of chronic HBV viremia

Five- to six-month old male FRG KO huHep mice (Fah−/−/Rag2−/−/Il2rg−/− triple knock-out) repopulated with human hepatocytes from a single donor (>90% humanized) on C57BL/6 or NOD background strains were donated by Yecuris Corporation (Tualatin, OR). Human albumin ELISA kit with no cross-reactivity to mouse albumin (Bethyl Laboratories Inc., USA) was used to measure serum albumin (Foquet et al., 2017). The average pre-shipment level of albumin in all mice was 6212 ± 1852 μg/mL. The humanized chimeric mice were infected with HBV genotype A (2.9 × 107 genome equivalents (GE)/mouse) or genotype C (2.6 × 108 GE/mouse) using de-identified patient serum purchased from Bioreclamation IVT (Hicksvill, NY). Plasma HBV DNA titers were measured weekly by purifying virion-associated DNA using Qiagen QIAamp cador Pathogen Mini Kit (Qiagen) followed by TaqMan quantitative PCR (qPCR) (Cai et al., 2014). Primers and probes employed were 5′GGAGGCTGTAGGCATAAATTGG3′; 5′CATGTACAAGAGATGATTAGGCAGAG3′; 5′/56-FAM/CTGCGCACC/ZEN/AGCACCATGCA/3IABkFQ/3′ for genotype A, 5′GGAGGCTGTAGGCATAAATTGG3′; 5′ATGAACATGAGATGATTAGGCAGAGG3′; 5′/56-FAM/CTGTTCACC/ZEN/AGCACCATGCA/3IABkFQ/3′ for genotype C. DNA standards were quantified against purified HBV DNA sequences of the corresponding genotype. HBeAg levels were assessed weekly by enzyme immunoassay (Diasorin, Via Crescentino, Italy) and hepatitis B surface antigen (HBsAg) levels were assessed weekly by chemiluminescent microparticle immunoassay (CMIA; Abbott, Abbott Park, IL). The efficacy of compounds was evaluated at least eight weeks post-infection when a high-titer infection had been established.

2.5. Statistical Analysis

Statistical significance was determined using Student’s T Test or a one-way ANOVA with the Dunnet’s post-hoc test, with p ≤ 0.05 being considered significant.

3. Results

3.1. Biochemical and in vitro replication data for #110 and #208

The αHTs have been experimentally confirmed to inhibit HBV replication by targeting the RNaseH (Hu et al., 2013). The HPDs share a core pharmacophore with the HIDs, and the HIDs were recently demonstrated to inhibit HBV replication in cells by targeting the RNaseH (Edwards et al., 2017). To confirm that compounds #110 and 208 target the HBV RNaseH, we tested whether they could inhibit the HBV RNaseH using a molecular beacon RNaseH assay (Chen et al., 2008) with purified HBV genotype C RNaseH (Villa et al., 2016). #208 and #110 both suppressed HBV RNaseH activity in a dose-dependent manner (Fig. 1), although higher concentrations were required than are needed to suppress virus replication. This quantitative discord is presumably due to either a sub-optimal conformation adopted when the RNaseH domain is expressed as a recombinant protein in isolation from the remaining three domains of the HBV polymerase protein, or to altered binding characteristics of the substrate and/or inhibitor stemming from the absence of portions of the full enzyme. Unfortunately, all attempts to date to express larger forms of the polymerase that carry an active RNaseH domain have failed. Therefore, both compounds #110 and 208 inhibit the HBV RNaseH, but limitations to the current biochemical assay preclude quantitative evaluation of the inhibition.

Figure 1. Inhibition of HBV RNaseH activity by compounds #110 and 208.

Figure 1

Open in a new tab

RNaseH activity was measured using a molecular beacon assay. Inhibition is evident by the reduction in rate of signal decay.

3.2. Pharmacokinetic and maximum tolerated dose studies

Prior to evaluation of the RNaseH inhibitors #110 and #208 in HBV-infected humanized FRG KO chimeric mice (huFRG KO) mice, the compounds were evaluated in a single-dose pharmacokinetic (PK) study (#208 only) and single and repeat dose maximum tolerated dose (MTD) studies. Compound #110 could not be evaluated in PK studies due to inadequate ionization for liquid chromatography-mass spectrometry/mass spectrometry (LC-MS/MS) analyses. Twelve week old male C57Bl/6 mice were used the PK study for #208 to evaluate systemic exposure and bioavailability of compound #208. Mice received either 1 mg/kg by intravenous (IV) injection or 2 mg/kg by intraperitoneal (IP) injection or oral gavage (PO). Blood samples were collected from three mice/group at 5 (IV injection only), 15, and 30 min and 1, 2, 4, 8, and 24 h post-dose. Compound concentrations were determined using LC-MS/MS and PK analysis was conducted. Bioavailabilty for #208 was 37% by IP and 9% by oral administration. As exposure was greater with IP dosing for #208, IP dosing was used for both compounds in subsequent MTD and efficacy studies.

The maximum tolerated dose (MTD) was determined following single and repeat IP injections of compound #208 (100 or 200 mg/kg) or compound #110 (30, 50, or 100 mg/kg) for up to seven days in male C57Bl/6 mice or huFRG KO mice (>70% humanized), with three mice/group. In the repeat dose study in C57Bl/6 mice, an age-matched vehicle control group was included. Based on weight loss and adverse clinical signs of hypoactivity, feeling cool-to-touch, unkempt appearance, and distended abdomens, the MTD was determined to be 100 mg/kg for #208 and 50 mg/kg for #110. These MTDs were therefore used to evaluate antiviral efficacy in huFRG KO mice as outlined in Table 1.

Table 1.

Study design and dosage groupsa

Study HBV Genotype Mice Inoculated Treatment Phase Groups
Pilot A 12 (6 NOD, 6 C57Bl/6) Entecavir Vehicle Control: n=5 (2 NOD, 3 C57Bl/6)
1 mg/kg Entecavir: n=4 (1 NOD, 3 C57Bl/6)
#208 50 mg/kg #208: n=3 (1 NOD, 2 C57Bl/6)
100 mg/kg #208: n=3 (3 C57Bl/6)
Primary C 21 (C57Bl/6) — Vehicle Control: n=5
1 mg/kg Entecavir: n=5
100 mg/kg #208: n=5
50 mg/kg #110: n=6
Open in a new tab
a

–The number of mice at the beginning of the experiments is indicated

3.3. Pilot study to establish infection and treatment parameters

The FRG-KO mouse model is just beginning to be used for HBV studies. Although it was clear from other chimeric liver models that the animals would be infectable by HBV, there was only one published study using the FRG-KO animal for HBV infection when this project was initiated (Bissig et al., 2010), and it did not include treatment with an antiviral compound. Therefore, a pilot HBV infection study was conducted in FRG KO mice with humanized livers to establish the basic infection kinetics, compare the C57Bl/6 and NOD mouse strains, and establish the degree to which entecavir suppresses HBV viremia in huFRG KO mice. Six mice in each background were inoculated with 2.9 × 107 genome copies of HBV genotype A and plasma viremia was measured weekly by qPCR (Fig. 2A). Viral titers increased through Day 70 post-inoculation and a plateau was generally observed through Day 159 in untreated mice. Viremia patterns in the C57Bl/6 and NOD mice were the same, although three NOD mice were found dead between Days 30–42.

Figure 2. Pilot study treating HBV genotype A-infected huFRG KO mice with entecavir or compound #208.

Figure 2

Open in a new tab

A. Plasma viral titers in mice treated with vehicle or entecavir. Data are mean ± SD. The treatment window with antiviral agents (days 71 – 84) is indicated. B. Plasma viral titers in mice treated with compound #208. Data are mean ± SD. The treatment window (days 160 – 173) is indicated. NTBC treatments are indicated. GE, genome equivalents.

After stable high titer viremia was established (Day 71 post-infection), nine mice were available for the entecavir pilot study. Four of these mice were treated for two weeks with a high concentration entecavir (1.0 mg/kg PO in saline), with the remaining five animals receiving a saline vehicle control (Fig. 2A). Viral titers briefly declined by 0.3 log10 in the vehicle-treated animals, but the decline coincided with the animals being cycled onto NTBC to maintain their health. This transient reduction was subsequently confirmed to be due to NTBC treatment in an experiment conducted after the primary study described below (data not shown). HBV titers in the entecavir-treated animals dropped by 2.8 log more than the control animals (p = 0.01) between the last pre-treatment and the final on-treatment time points (Days 70 to 85). Viral titers rebounded to pretreatment levels by Day 159 following drug withdrawal.

While the pattern of viremia in NOD mice was similar to that in C57Bl/6 mice, five of six huFRG KO mice on the NOD background strain died by Day 118, compared to a single early death in mice on the C57Bl/6 background. In addition to the three NOD mice that were found dead between Days 30–42 during the infection development phase, a fourth NOD mouse in the saline control group was found dead during the treatment phase (Day 76). The fifth NOD mouse and a single C57Bl/6 mouse were found dead during the post-treatment phase (Days 118 and 121, respectively). Therefore, huFRG KO mice on the NOD strain were more fragile under the conditions of this study. Weight loss and clinical signs such as hunched posture, dehydration, and hypoactivity preceded these deaths in some cases.

3.4. Preliminary efficacy study with #208

Mice remaining after the pilot study with entecavir were then used in a small preliminary study to guide design of a study to evaluate efficacy of the RNaseH inhibitors in huFRG KO mice. After HBV titers returned to baseline, the six surviving infected mice were treated with 50 or 100 mg/kg/day compound #208 (IP) on Days 160–173. The two dosage groups were analyzed without concurrent controls due to the small number of remaining animals by comparing to pretreatment (Day 159 values) for each group. HBV titers declined in all treated animals, and compound #208 suppressed HBV viremia by an average of 1.1 log (50 and 100 mg/kg) after one week; this efficacy was sustained at week two in the surviving mice (Fig. 2B); statistical analysis could not be conducted due to the small group sizes.

Two mice were found dead on Day 168 after seven days of treatment with compound #208; one mouse given 50 mg/kg and one given 100 mg/kg. Both mice experienced weight loss and enlarged discolored livers. The cardiothoracic cavity of the mouse given 100 mg/kg #208 was fluid-filled. Another mouse given 50 mg/kg #208 was sacrificed moribund on Day 187 (about two weeks after treatment was discontinued) due to weight loss and unkempt appearance. Gross observations of enlarged, pale kidneys, and discolored livers were noted for this animal. A cause for the moribundity/mortality was not determined, but effects related to treatment with #208 and/or morbidity due to the age of these huFRG KO mice (>1 year) may both have contributed. The other three mice survived until the scheduled sacrifice on Day 187.

3.5. Primary efficacy study with compounds #110 and 208 in HBV-infected huFRG KO mice

We next used the experience gained with the FRG-KO model in the pilot and preliminary efficacy studies to test whether compounds #110 and 208 could inhibit HBV replication in vivo. Twenty-One C57Bl/6 huFRG KO mice were infected with human serum containing 2.6 × 108 genome copies of HBV genotype C and viral titers in plasma were measured weekly beginning 30 days post inoculation. There were no differences in pretreatment human albumin levels among the four groups by a one-way ANOVA with the Dunnets’ post-hoc test. Genotype C was employed in this study rather than genotype A which was used in the preliminary study because we had preliminary data indicating that RNaseH inhibitors from these chemical classes could inhibit HBV from multiple genotypes (Lu et al., 2016). Using genotype A in the preliminary experiment and genotype C in the primary efficacy study allowed us to directly test that hypothesis in vivo. Viremia increased from Day 30 through Day 58 and there were no early deaths (Fig. 3A). There was no further increase in plasma viral titers in animals in the saline-treated control group through Day 128 in the subsequent efficacy trial. Plasma HBsAg and HBeAg levels generally increased in parallel with HBV DNA copies (Fig. 3B and 3C). Therefore, stable viremia was achieved approximately eight weeks post-inoculation using an HBV genotype C isolate.

Figure 3. Primary efficacy study with anti-viral agents in HBV genotype C-infected huFRG KO mice.

Figure 3

Open in a new tab

A. Plasma viral titers in mice treated with entecavir, compounds #208 and #110, or vehicle. Data are mean ± SD, n = 5 for the vehicle, entecavir and #208 groups, n = 6 for #110 group. LLD line indicates lower limit of detection. B. Plasma HBsAg levels. C. Plasma HBeAg levels. D. Body weights. The treatment window with anti-viral agents (days 59 – 72) is indicated. NTBC treatments are indicated. GE, genome equivalents; *, p = 0.001; **, p < 0.0001.

The mice were randomized into four treatment groups (n=5 or 6 mice per group) after the Day 58 sample collection to evaluate efficacy of entecavir, compound #110, and compound #208 compared to vehicle-treated animals. Treatment with entecavir at 1 mg/kg/day PO on Days 59–72 post-infection caused a 2.6-log decrease in HBV titers after one week of treatment (p = 3.1 × 10−11) and a 3.2-log decrease after two weeks (p = 3.1 × 10−11) (Fig. 3A). HBV titers began rising 1–2 weeks after treatment ended, with most animals returning to pretreatment viral titers by Day 108.

Treatment with compound #208 at 100 mg/kg/day (IP) caused a 1.6-log decrease (p = 5.2 × 10−7) in HBV titers after one week compared to control mice, and this suppression was sustained after two weeks of dosing (1.4-log decrease; p = 3.1 × 10−5) (Fig. 3A). Viral titers returned to pretreatment levels by Day 87, approximately two weeks after treatment ended. Treatment of mice by IP injection with 50 mg/kg/day compound #110 also decreased HBV titers, but to a lesser extent of 0.4 log after both one (p = 0.02) and two (p = 0.001) weeks compared to control mice (Fig. 3A). Viral titers returned to pretreatment levels by Day 80, eight days post withdrawal of the compound. There was no impact of entecavir, compound #110, or compound #208 on plasma HBsAg or HBeAg levels (Fig. 3B and 3C).

While all mice survived the treatment phase (Days 59–72), weight loss was noted in all groups (Fig. 3D). Mice given vehicle (10% ethanol/70% PEG400/20% saline), compound #208, and compound #110, via once daily IP injections, lost 12–15% body weight at the end of the two-week dosing interval, while mice given entecavir lost 3%. While some weight gain occurred after the treatment phase with vehicle, entecavir, and compound #208 ended, mice given compound #110 generally did not recover weight. These data suggest that, in addition to a vehicle effect, there may also have been a test article-related effect on tolerability of #110 and #208, which was more evident with compound #110.

On Day 87 during the post-dosing phase, one animal that had been given compound #110 was sacrificed moribund due to severe weight loss, and necropsy revealed mottled discoloration of the liver and kidneys. On Day 88, also during the post-dosing phase, a single animal that had been given #208 was found dead. Minimal weight loss was noted for this animal and gross findings were only noted in the liver and included pale discoloration, hepatomegaly, and adhesions of liver lobes to the stomach, diaphragm, and other adjacent lobes. These deaths could not be considered with certainty to be test article-related due to their singular occurrence within affected groups, as well as the advancing age of the mice (~nine months), and because liver and kidney findings are not uncommon to FAH-deficient mice with impaired tyrosine metabolism possibly leading to accumulation of fumarylacetoacetate (Grompe et al., 1993).

Therefore, both RNaseH inhibitors significantly suppressed HBV titers in chimeric FRG KO mice without affecting antigenemia, and viral titers rebounded during the post-treatment period. This is the expected pattern for compounds that suppress viral genomic synthesis.

4. Discussion

This study was done to test for the first time whether inhibiting the viral RNaseH suppresses HBV viremia in an animal. We observed significant suppression of HBV plasma titers in huFRG KO mice infected with HBV with both RNaseH inhibitors, the HPD #208 and to a lesser degree the αHT #110. A decrease in plasma levels of HBsAg or HBeAg antigen was not evident during or after treatment (Fig. 3B and 3C). This was expected because entecavir and compounds #110 and 208 suppress HBV genomic replication and are not expected to affect levels of the nuclear cccDNA form of the viral genome that is the template for the HBV RNAs during this short treatment window, presumably due to a long half-life of the cccDNA and a relatively low turnover of infected cells in these animals with a stable HBV chronic infection.

HBV is genetically diverse, with at least 8 genotypes that differ from one another by ≥ 8% at the nucleotide level (Lu et al., 2016). This is easily high enough to impact efficacy of a drug among viral strains circulating in the population, similar to what was seen with the early protease inhibitors for HCV (Murphy et al., 2014). Therefore, we tested in vivo efficacy of #208 against an HBV genotype A isolate in the pilot experiment and a genotype C isolate in the primary study. The pilot experiment indicated a trend for an approximate 1 log decrease in HBV titers in the #208 treated animals (Fig. 2B), and the larger primary efficacy study revealed a 1.4 log (p = 3.1 × 10−5) drop in HBV titers mice treated with #208 (Fig. 3A). Therefore, compound #208 can inhibit HBV isolates from at least two genotypes in vivo. This is similar to our observation that the αHT compound #46 can inhibit both genotype A and D isolates in vitro (Hu et al., 2013) and that HBV RNaseH inhibition in biochemical assays is insensitive to genetic variation within genotypes B, C, and D (Lu et al., 2016).

Moderate toxicity based on weight loss was observed following dosing with both compounds #110 and #208. Dose-limiting toxicity following administration with compound #208 in non-infected mice included >10% weight loss, hypoactivity, unkempt appearance, feeling cool-to-touch, and distended abdomen. Dose-limiting toxicity following administration with compound #110 included the above symptoms plus lethargy, immobility, blood in the subcutaneous space/small intestines, and an early death. Although the weight loss observed for both #110 and 208 appeared to be partially caused by the vehicles employed, much of it appeared to be associated with the RNaseH inhibitors. This was not unexpected given that these compounds are first-in-class screening hits that that are not clinical candidates.

There were two primary limitations to this study. First, compounds #208 and #110 are tool compounds that have not been chemically optimized for efficacy or any pharmaceutical parameter. We were unable to determine a pharmacokinetic half-life for #110 because it does not ionize adequately for detection using mass spectrometry. Therefore, dosing was guided by MTD studies only. Differences in the pharmacological properties of the two compounds are the likely reason that #208 worked in mice better than #110 (1.4 vs. 0.4 log) despite #110 having a better EC50 in vitro (0.34 vs. 0.69 μM). The second major limitation was that the animals were not sacrificed at the end of the primary experiment so that these expensive mice could be reused in tests of NTBC dosing and other studies. This precluded evaluation of drug-related histopathology and assessment of how the inhibitors affected HBV intracellular replication intermediates.

Another widely used mouse model for HBV drug testing is transgenic mice in which constitutive replication of HBV in mouse hepatocytes is driven from an integrated HBV transgene (Allweiss and Dandri, 2016). These mice are viremic and immunotolerant to HBV. Therefore, we also evaluated efficacy in the transgenic mouse model through the NIAID Cooperative Antiviral Testing Group, with both #208 and #110 dosed at 100 mg/kg daily by IP injection. Although both compounds significantly suppressed HBV viremia in FRG KO chimeric mice, they failed to reduce either intrahepatic DNA accumulation or serum viremia in the transgenic mice, and substantial mortality was observed in both the vehicle-treated control groups and the animals treated with #110 and 208 (data not shown). The reasons for this discrepancy are not known, but it could be due to different stability and/or pharmacological suitability of #208 and #110 in murine compared to human hepatocytes. This study with transgenic animals emphasizes the early stage of drug development for the αHT and HPD compound classes. However, the inactivity of these compounds in the transgenic model does not detract from their clear efficacy in the humanized FRG KO mice because the huFRG KO mice experiments measured effects of the compounds in infected human hepatocytes and therefore more closely reflect a human infection.

This study demonstrates for the first time that HBV replication can be inhibited during infection in an animal model by targeting the viral RNaseH activity. The ability of compound #208 to inhibit both genotype A and C HBV isolates provides in vivo support for the in vitro and biochemical studies implying that RNaseH inhibitors are likely to be active against a wide range of viral strains and genotypes. As such, it validates the HBV RNaseH as a viable target for novel drugs to help control or cure hepatitis B.

Supplementary Material

supplement

Highlights.

  • Efficacy of RNaseH inhibitors against in HBV replication in infected animals was demonstrated for the first time

  • RNaseH inhibitors from two different chemical classes reduced viremia without affecting HBV S or e antigen levels

  • Compound #208 (an N-hydroxypyridinedione) suppressed viral titers of both HBV genotype A and C isolates

Acknowledgments

We thank John Morrey and Neil Motter for conducting the transgenic mouse inhibition study through NIAID task order HHSN27200017/A89. We thank Maura Dandri, Roger Melton, and Lander Foquet for helpful discussions and technical assistance. We thank Keith Jerome and the University of Washington Clinical Virology Laboratory for conducting the HBsAg and HBeAg assays.

JT and RM are inventors on patents covering use of #110 and 208 for HBV. KL, ET, SR, RML LW, JB and JS work for companies that sell the huFRG mice and/or HBV screening services.

This work was supported by donation of the chimeric mice from Yecuris Corporation, corporate funds from Seventh Wave Laboratories, Inc., NIH contract HHSN272201000039I to John Morrey, and NIH grants R01 AI122669 and R01 AI104494 to JET.

This manuscript is dedicated to the memory of Dr. R. Mark L. Buller.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Allweiss L, Dandri M. Experimental in vitro and in vivo models for the study of human hepatitis B virus infection. Journal of hepatology. 2016;64:S17–31. doi: 10.1016/j.jhep.2016.02.012. [DOI] [PubMed] [Google Scholar]
  2. Azuma H, Paulk N, Ranade A, Dorrell C, Al-Dhalimy M, Ellis E, Strom S, Kay MA, Finegold M, Grompe M. Robust expansion of human hepatocytes in Fah-/-/Rag2-/-/Il2rg-/- mice. Nature biotechnology. 2007;25:903–910. doi: 10.1038/nbt1326. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bissig KD, Wieland SF, Tran P, Isogawa M, Le TT, Chisari FV, Verma IM. Human liver chimeric mice provide a model for hepatitis B and C virus infection and treatment. The Journal of clinical investigation. 2010;120:924–930. doi: 10.1172/JCI40094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Cai CW, Lomonosova E, Moran EA, Cheng X, Patel KB, Bailly F, Cotelle P, Meyers MJ, Tavis JE. Hepatitis B virus replication is blocked by a 2-hydroxyisoquinoline-1,3(2H,4H)-dione (HID) inhibitor of the viral ribonuclease H activity. Antiviral research. 2014;108:48–55. doi: 10.1016/j.antiviral.2014.05.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Caligiuri P, Cerruti R, Icardi G, Bruzzone B. Overview of hepatitis B virus mutations and their implications in the management of infection. World journal of gastroenterology : WJG. 2016;22:145–154. doi: 10.3748/wjg.v22.i1.145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chen CJ, Yang HI. Natural history of chronic hepatitis B REVEALed. Journal of gastroenterology and hepatology. 2011;26:628–638. doi: 10.1111/j.1440-1746.2011.06695.x. [DOI] [PubMed] [Google Scholar]
  7. Chen Y, Yang CJ, Wu Y, Conlon P, Kim Y, Lin H, Tan W. Light-switching excimer beacon assays for ribonuclease H kinetic study. Chembiochem: a European journal of chemical biology. 2008;9:355–359. doi: 10.1002/cbic.200700542. [DOI] [PubMed] [Google Scholar]
  8. Edwards TC, Lomonosova E, Patel JA, Li Q, Villa JA, Gupta AK, Morrison LA, Bailly F, Cotelle P, Giannakopoulou E, Zoidis G, Tavis JE. Inhibition of hepatitis B virus replication by N-hydroxyisoquinolinediones and related polyoxygenated heterocycles. Antiviral research. 2017;143:205–217. doi: 10.1016/j.antiviral.2017.04.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Fattovich G, Olivari N, Pasino M, D’Onofrio M, Martone E, Donato F. Long-term outcome of chronic hepatitis B in Caucasian patients: mortality after 25 years. Gut. 2008;57:84–90. doi: 10.1136/gut.2007.128496. [DOI] [PubMed] [Google Scholar]
  10. Foquet L, Wilson EM, Verhoye L, Grompe M, Leroux-Roels G, Bial J, Meuleman P. Successful Engraftment of Human Hepatocytes in uPA-SCID and FRG(R) KO Mice. Methods Mol Biol. 2017;1506:117–130. doi: 10.1007/978-1-4939-6506-9_8. [DOI] [PubMed] [Google Scholar]
  11. Grompe M, al-Dhalimy M, Finegold M, Ou CN, Burlingame T, Kennaway NG, Soriano P. Loss of fumarylacetoacetate hydrolase is responsible for the neonatal hepatic dysfunction phenotype of lethal albino mice. Genes & development. 1993;7:2298–2307. doi: 10.1101/gad.7.12a.2298. [DOI] [PubMed] [Google Scholar]
  12. Guidotti LG, Chisari FV. Immunobiology and pathogenesis of viral hepatitis. Annual review of pathology. 2006;1:23–61. doi: 10.1146/annurev.pathol.1.110304.100230. [DOI] [PubMed] [Google Scholar]
  13. Gupta N, Goyal M, Wu CH, Wu GY. The Molecular and Structural Basis of HBV-resistance to Nucleos(t)ide Analogs. Journal of clinical and translational hepatology. 2014;2:202–211. doi: 10.14218/JCTH.2014.00021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hosaka T, Suzuki F, Kobayashi M, Seko Y, Kawamura Y, Sezaki H, Akuta N, Suzuki Y, Saitoh S, Arase Y, Ikeda K, Kumada H. Long-term entecavir treatment reduces hepatocellular carcinoma incidence in patients with hepatitis B virus infection. Hepatology. 2013;58:98–107. doi: 10.1002/hep.26180. [DOI] [PubMed] [Google Scholar]
  15. Hu Y, Cheng X, Cao F, Huang A, Tavis JE. beta-Thujaplicinol inhibits hepatitis B virus replication by blocking the viral ribonuclease H activity. Antiviral research. 2013;99:221–229. doi: 10.1016/j.antiviral.2013.06.007. [DOI] [PubMed] [Google Scholar]
  16. Jones SA, Hu J. Hepatitis B virus reverse transcriptase: diverse functions as classical and emerging targets for antiviral intervention. Emerging microbes & infections. 2013;2:e56. doi: 10.1038/emi.2013.56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Lok AS, McMahon BJ, Brown RS, Jr, Wong JB, Ahmed AT, Farah W, Almasri J, Alahdab F, Benkhadra K, Mouchli MA, Singh S, Mohamed EA, Abu Dabrh AM, Prokop LJ, Wang Z, Murad MH, Mohammed K. Antiviral therapy for chronic hepatitis B viral infection in adults: A systematic review and meta-analysis. Hepatology. 2016;63:284–306. doi: 10.1002/hep.28280. [DOI] [PubMed] [Google Scholar]
  18. Lomonosova E, Daw J, Garimallaprabhakaran AK, Agyemang NB, Ashani Y, Murelli RP, Tavis JE. Efficacy and cytotoxicity in cell culture of novel alpha-hydroxytropolone inhibitors of hepatitis B virus ribonuclease H. Antiviral research. 2017a;144:164–172. doi: 10.1016/j.antiviral.2017.06.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Lomonosova E, Zlotnick A, Tavis JE. Synergistic Interactions between Hepatitis B Virus RNase H Antagonists and Other Inhibitors. Antimicrobial agents and chemotherapy. 2017b:61. doi: 10.1128/AAC.02441-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Lu G, Lomonosova E, Cheng X, Moran EA, Meyers MJ, Le Grice SF, Thomas CJ, Jiang JK, Meck C, Hirsch DR, D’Erasmo MP, Suyabatmaz DM, Murelli RP, Tavis JE. Hydroxylated tropolones inhibit hepatitis B virus replication by blocking viral ribonuclease H activity. Antimicrobial agents and chemotherapy. 2015;59:1070–1079. doi: 10.1128/AAC.04617-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Lu G, Villa JA, Donlin MJ, Edwards TC, Cheng X, Heier RF, Meyers MJ, Tavis JE. Hepatitis B virus genetic diversity has minimal impact on sensitivity of the viral ribonuclease H to inhibitors. Antiviral research. 2016;135:24–30. doi: 10.1016/j.antiviral.2016.09.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Marcellin P, Gane E, Buti M, Afdhal N, Sievert W, Jacobson IM, Washington MK, Germanidis G, Flaherty JF, Aguilar Schall R, Bornstein JD, Kitrinos KM, Subramanian GM, McHutchison JG, Heathcote EJ. Regression of cirrhosis during treatment with tenofovir disoproxil fumarate for chronic hepatitis B: a 5-year open-label follow-up study. Lancet. 2013;381:468–475. doi: 10.1016/S0140-6736(12)61425-1. [DOI] [PubMed] [Google Scholar]
  23. Morikawa K, Shimazaki T, Takeda R, Izumi T, Umumura M, Sakamoto N. Hepatitis B: progress in understanding chronicity, the innate immune response, and cccDNA protection. Annals of translational medicine. 2016;4:337. doi: 10.21037/atm.2016.08.54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Murphy G, Farah B, Wong W, Krahn M, Wells G, Chen L, Kelly S, Kaunelis D, Blouin J, Lee K, Carrie A. Direct-Acting Antiviral Agents for Chronic Hepatitis C Genotype 1, Ottawa (ON) 2014 [PubMed] [Google Scholar]
  25. Ott JJ, Stevens GA, Groeger J, Wiersma ST. Global epidemiology of hepatitis B virus infection: new estimates of age-specific HBsAg seroprevalence and endemicity. Vaccine. 2012;30:2212–2219. doi: 10.1016/j.vaccine.2011.12.116. [DOI] [PubMed] [Google Scholar]
  26. Perrillo R. Benefits and risks of interferon therapy for hepatitis B. Hepatology. 2009;49:S103–111. doi: 10.1002/hep.22956. [DOI] [PubMed] [Google Scholar]
  27. Protzer U, Schaller H. Immune escape by hepatitis B viruses. Virus genes. 2000;21:27–37. [PubMed] [Google Scholar]
  28. Rhim JA, Sandgren EP, Degen JL, Palmiter RD, Brinster RL. Replacement of diseased mouse liver by hepatic cell transplantation. Science. 1994;263:1149–1152. doi: 10.1126/science.8108734. [DOI] [PubMed] [Google Scholar]
  29. Scheer N, Wilson ID. A comparison between genetically humanized and chimeric liver humanized mouse models for studies in drug metabolism and toxicity. Drug discovery today. 2016;21:250–263. doi: 10.1016/j.drudis.2015.09.002. [DOI] [PubMed] [Google Scholar]
  30. Tana MM, Hoofnagle JH. Scar undone: long-term therapy of hepatitis B. Lancet. 2013;381:433–434. doi: 10.1016/S0140-6736(12)61721-8. [DOI] [PubMed] [Google Scholar]
  31. Tavis JE, Cheng X, Hu Y, Totten M, Cao F, Michailidis E, Aurora R, Meyers MJ, Jacobsen EJ, Parniak MA, Sarafianos SG. The hepatitis B virus ribonuclease H is sensitive to inhibitors of the human immunodeficiency virus ribonuclease H and integrase enzymes. PLoS pathogens. 2013a;9:e1003125. doi: 10.1371/journal.ppat.1003125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Tavis JE, Gehring AJ, Hu Y. How further suppression of virus replication could improve current HBV treatment. Expert review of anti-infective therapy. 2013b;11:755–757. doi: 10.1586/14787210.2013.814846. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Tavis JE, Lomonosova E. The hepatitis B virus ribonuclease H as a drug target. Antiviral research. 2015 doi: 10.1016/j.antiviral.2015.04.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Tong S, Revill P. Overview of hepatitis B viral replication and genetic variability. Journal of hepatology. 2016;64:S4–S16. doi: 10.1016/j.jhep.2016.01.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Tsuge M, Hiraga N, Takaishi H, Noguchi C, Oga H, Imamura M, Takahashi S, Iwao E, Fujimoto Y, Ochi H, Chayama K, Tateno C, Yoshizato K. Infection of human hepatocyte chimeric mouse with genetically engineered hepatitis B virus. Hepatology. 2005;42:1046–1054. doi: 10.1002/hep.20892. [DOI] [PubMed] [Google Scholar]
  36. Villa JA, Pike DP, Patel KB, Lomonosova E, Lu G, Abdulqader R, Tavis JE. Purification and enzymatic characterization of the hepatitis B virus ribonuclease H, a new target for antiviral inhibitors. Antiviral research. 2016;132:186–195. doi: 10.1016/j.antiviral.2016.06.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Voican CS, Mir O, Loulergue P, Dhooge M, Brezault C, Dreanic J, Chaussade S, Pol S, Coriat R. Hepatitis B virus reactivation in patients with solid tumors receiving systemic anticancer treatment. Annals of oncology : official journal of the European Society for Medical Oncology. 2016;27:2172–2184. doi: 10.1093/annonc/mdw414. [DOI] [PubMed] [Google Scholar]
  38. Yang HI, Yeh SH, Chen PJ, Iloeje UH, Jen CL, Su J, Wang LY, Lu SN, You SL, Chen DS, Liaw YF, Chen CJ. Associations between hepatitis B virus genotype and mutants and the risk of hepatocellular carcinoma. Journal of the National Cancer Institute. 2008;100:1134–1143. doi: 10.1093/jnci/djn243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Zeisel MB, Lucifora J, Mason WS, Sureau C, Beck J, Levrero M, Kann M, Knolle PA, Benkirane M, Durantel D, Michel ML, Autran B, Cosset FL, Strick-Marchand H, Trepo C, Kao JH, Carrat F, Lacombe K, Schinazi RF, Barre-Sinoussi F, Delfraissy JF, Zoulim F. Towards an HBV cure: state-of-the-art and unresolved questions–report of the ANRS workshop on HBV cure. Gut. 2015;64:1314–1326. doi: 10.1136/gutjnl-2014-308943. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

supplement
NIHMS921605-supplement.pdf (62.6KB, pdf)

RESOURCES