Skip to main content
eLife logoLink to eLife
. 2017 Dec 12;6:e30463. doi: 10.7554/eLife.30463

Cell lineage and cell cycling analyses of the 4d micromere using live imaging in the marine annelid Platynereis dumerilii

B Duygu Özpolat 1,†,✉, Mette Handberg-Thorsager 2, Michel Vervoort 1, Guillaume Balavoine 1,✉
Editor: Lilianna Solnica-Krezel3
PMCID: PMC5764573  PMID: 29231816

Abstract

Cell lineage, cell cycle, and cell fate are tightly associated in developmental processes, but in vivo studies at single-cell resolution showing the intricacies of these associations are rare due to technical limitations. In this study on the marine annelid Platynereis dumerilii, we investigated the lineage of the 4d micromere, using high-resolution long-term live imaging complemented with a live-cell cycle reporter. 4d is the origin of mesodermal lineages and the germline in many spiralians. We traced lineages at single-cell resolution within 4d and demonstrate that embryonic segmental mesoderm forms via teloblastic divisions, as in clitellate annelids. We also identified the precise cellular origins of the larval mesodermal posterior growth zone. We found that differentially-fated progeny of 4d (germline, segmental mesoderm, growth zone) display significantly different cell cycling. This work has evolutionary implications, sets up the foundation for functional studies in annelid stem cells, and presents newly established techniques for live imaging marine embryos.

Research organism: P. dumerilii

Introduction

Development of a multicellular organism requires precise regulation of the cell cycle, which has crucial roles in cell lineage establishment, cell fate decisions, and maintenance of pluripotency. Many embryonic and post-embryonic developmental processes involve stem cells that repeatedly give rise to tissue founder cells while also self-renewing at each round of division. Cell cycle regulation defines the correct timing and pacing of divisions for generating the progenitor cells, as well as maintaining the potency of stem cells themselves (Ables and Drummond-Barbosa, 2013; Barker, 2014; Yasugi and Nishimura, 2016). Understanding the cell cycle characteristics of stem cells and the implications of cell cycle regulation requires a combined lineage tracing and live-cell cycle analysis approach at single-cell resolution. However, such high-resolution lineage tracing has been challenging in many traditional and emerging animal model systems, due to a wide range of practical limitations that spans from the inaccessibility of embryos or tissues of interest, to the unavailability of tools and techniques (reviewed in Kretzschmar and Watt, 2012). Therefore, in order to understand cycling behavior of stem cells and their progeny in vivo, studies are needed in organisms where continuous observations are feasible in intact individuals and tissues.

Spiralians are a group of Protostomes including segmented worms (Annelida), mollusks, ribbon worms, and flatworms, many of which undergo a stereotyped program of early cell divisions known as spiral cleavage (Conklin, 1897; Henry, 2014; Lyons et al., 2012; Seaver, 2014; Wilson, 1892). Blastomeres that arise from spiral cleavage show determinate cell fates and a strict correlation exists between cell division timing and cell fate determination. The 4d micromere (also called M for Mesoblast) is one of the micromeres created during the fourth spiral cleavage, and it is an evolutionarily conserved blastomere across Spiralia (Lambert, 2008). In most spiralians, 4d gives rise to mesoderm, endoderm, and primordial germ cells (PGCs) (Ackermann et al., 2005; Gline et al., 2011; Kang et al., 2002; Lyons et al., 2012; Meyer et al., 2010; Rebscher, 2014; Shimizu and Nakamoto, 2014; Swartz et al., 2008). Within a given species, 4d follows stereotypical division patterns. Differences across species in the 4d lineage division program have been proposed as a mechanism for obtaining the diverse body plans present across spiralians (Lyons et al., 2012). Yet, despite the immense diversity within spiralians, only a few studies have looked into the 4d lineage in detail, and some of these studies could not employ high-resolution lineage tracing due to techniques used (Fischer and Arendt, 2013; Gline et al., 2011; Gline et al., 2009; Goto et al., 1999b; Lyons et al., 2012). In addition, very limited data are available detailing the relationship between the 4d lineage cell cycle characteristics and the resulting differences in cell fates (Bissen, 1995; Bissen and Weisblat, 1989; Smith and Weisblat, 1994). Thus, the spiralian 4d lineage provides an exciting embryonic stem cell model system for linking cell fate potency, cell lineage, cell cycle, and morphogenetic processes.

Annelids (segmented worms) are a large but understudied group of spiralians containing many species with broadcast-spawning, giving large numbers of relatively small, yolk-poor and translucent embryos and larvae, which are amenable to functional developmental studies. Annelids are characterized by repeated (metameric) body parts called segments (Balavoine, 2014). In clitellate annelids, a taxon including the leeches and earth worms (Zrzavý et al., 2009), founder cells of segmental tissues are generated during embryonic development by stem cells called teloblasts (Anderson, 1973a; Devries, 1973, 1972; Goto et al., 1999b; Penners, 1924; Weisblat and Shankland, 1985; Zackson, 1982). Specific teloblasts make specific tissue types. The 4d micromere is the originator of the M teloblasts (mesoteloblasts) that make the trunk mesoderm: the first division of 4d generates two bilaterally symmetric stem cells named Mesoteloblast-Left (ML) and Mesoteloblast-Right (MR). ML and MR then make the left and right mesodermal bands, respectively, via a well-described division program (Weisblat and Shankland, 1985; Zackson, 1982): the teloblasts repeatedly divide asymmetrically to self-renew the ML/MR stem cells and to give rise to tissue precursor cells (primary blast cells) through iterated divisions. Each primary blast cell (much smaller in size compared to the teloblasts they have split from) follows a stereotyped program of cell divisions with fixed fate, generating clonal regions of tissues in adjoining segments. Micromere 4d and its daughters ML and MR are evolutionarily conserved embryonic stem cells across spiralians (Lambert, 2008; Lyons et al., 2012). Their teloblastic nature in non-clitellate annelids has been suggested before (Anderson, 1973b; Fischer and Arendt, 2013), but direct evidence for teloblasts outside of clitellate annelids is still missing.

Platynereis dumerilii is a marine annelid (Errantia, Nereididae) suitable to address the questions outlined above. As an Errant ‘Polychaete’, P. dumerilii is phylogenetically distant from clitellates (Struck et al., 2011; Weigert and Bleidorn, 2016) and presumably much closer in anatomy to the last common ancestor of annelids (Balavoine, 2014). Based on comparative genome analyses, P. dumerilii has also been suggested to belong to a slow-evolving lineage, thus potentially bearing genomic ancestral features of annelids (Raible et al., 2005; Raible and Arendt, 2004). In addition, P. dumerilii has externally fertilized, relatively fast-developing, transparent embryos which can be injected for lineage tracing and can be cultured at the lab for the full life cycle (Ackermann et al., 2005; Backfisch et al., 2014). Embryos develop into free-swimming planktonic larvae in about 24 hr-post-fertilization (hpf). By 48 hpf, segmental organization starts to become apparent, mostly evident by the repetition of paired bilateral bristle bundles (chaetae) on each segment (Fischer et al., 2010). At this stage, a mesodermal posterior growth zone (MPGZ) has formed anterior to the presumptive pygidium (the posterior-most non-segmental region), juxtaposed with the four putative PGCs (pPGCs). The MPGZ and pPGCs, as a cell cluster, sit at the converging point of the left and right mesodermal bands, and both express Vasa mRNA and protein (Rebscher et al., 2012, Rebscher et al., 2007). The first two divisions of ML and MR in P. dumerilii give rise to the pPGCs (Fischer and Arendt, 2013). However, how the MPGZ and pPGCs end up next to each other, and the exact embryonic origin of the MPGZ within the 4d lineage are not yet known. Previous studies show that the mesodermal bands, and eventually the segmental mesoderm also originate from the 4d micromere in P. dumerilii (Ackermann et al., 2005; Fischer and Arendt, 2013), but whether the segmental mesoderm forms via stereotyped teloblastic divisions of primary blast cells (à la clitellate) is also unknown.

Here, using high-resolution live imaging techniques complemented with a live-cell cycle reporter we developed, we report an extensive analysis for the 4d lineage at single-cell resolution, and an investigation of cell cycling patterns of several lineages that originate from the 4d micromere. We have developed imaging techniques for both embryos and larvae that are easy to implement and can be applied to other annelids and spiralians, as well as other metazoans with ciliated larvae. We show that a pair of mesoteloblasts (ML and MR), similar to what has been observed in clitellate annelids, are active during P. dumerilii embryogenesis and that they give rise to the mesodermal derivatives and pPGCs via asymmetric cell divisions. A series of four contiguous primary blast cells produced on each side of the larva proliferate to produce mesodermal blocks that each correspond to a distinct larval hemisegment. We show that M cells, after having produced the four larval segments, undergo an abrupt transition in their cycling behavior and start dividing much more slowly and symmetrically. These final divisions of the mesoteloblasts give rise to cells that form the MPGZ in the early larvae. The MPGZ cells remain in contact with the pPGCs, which are produced earlier and arrested in G0/G1. Differences we observed in cell cycling patterns in differentially-fated lineages that originate from a single cell (4d) provide foundational information to start delineating the relationship between cell cycle regulation, cell lineage, and generation of different cell fates.

Results

Establishment of a work flow for long time-lapse live imaging and cell lineage tracing in marine embryos and larvae

Live imaging at single-cell resolution over extended time periods, and analysis of these 4D image datasets for determining cell lineages require overcoming technical barriers. In this work, we used a standard scanning confocal microscope, which allowed us to trace cells in a specific body region of the embryo. To this end, we overcame a number of specific difficulties, piecing together a complete workflow that could be applied to other marine embryos and larvae. For the immobilization of embryos and larvae, we mounted samples in a thin layer of low-melting sea-water agarose using glass-bottom dishes. After injection and a careful selection of normal developing embryos at the time of mounting, we observed normal development of all embryos and larvae in agarose. For embedding swimming stages, we developed a new deciliation protocol, allowing for permanent immobilization, even after cilia regrew (see Materials and methods).

Intense exposure to laser lights in a scanning confocal microscope caused phototoxicity problems, resulting in embryonic deaths. To solve this problem, each image stack (at a resolution of 512 × 512 pixels) was acquired in roughly 2 min and was followed by a recovery time of at least 5 min. This time seemed to allow for the natural elimination of the toxic free radicals created by the laser light, before reaching deleterious concentrations for the cells. In these conditions, we observed development of the embryos and larvae that are morphologically indistinguishable from control animals.

This time resolution (about 7 min, or longer depending on the stack thickness imaged), which helped limiting exposure of samples to the laser light, in turn limited the possibility of using automated lineage tracing. In addition, for datasets that have low time- or image-resolution, or embryos which have significantly variable cell sizes and nuclei, segmentation and lineage-tracing algorithms available via different platforms are currently not able to carry out an automated lineage analysis with high accuracy (Ulman et al., 2017). Consequently, lineage tracing in such samples still largely rely on manual curation. For determining cell lineages at single-cell resolution in Platynereis dumerilii (P. dumerilii), we used a combination of labeling techniques. In addition to the conventional nuclear and membrane labeling, we also used a live-cell cycle reporter. This added the necessary information to trace lineages accurately, making it easier to predict when a cell will divide and follow daughter cells after a division, without the need to increase time resolution and thus light exposure.

Construction of a cell cycle reporter and analysis of its cycling patterns

In order to visualize cell cycle progression in live P. dumerilii embryos and larvae, we first constructed a fluorescent cell cycle reporter. Live-cell cycle reporters rely on fusion of a truncated cell cycle protein containing a degron motif (also called destruction box) to a fluorescent protein. As a result, the fluorescent protein becomes a visible reporter of the corresponding cell cycle phase, and gets degraded when the endogenous cell cycle protein normally gets degraded. These cell cycle reporters are also called FUCCI (fluorescent ubiquitination-based cell cycle indicator) (Sakaue-Sawano et al., 2008; Zielke and Edgar, 2015). For developing a live-cell cycle reporter in P. dumerilii, we first identified in the P. dumerilii genome and transcriptomes the cdt1 gene (Figure 1A), on which specific G1 phase reporters are based in human and zebrafish (Sakaue-Sawano et al., 2008; Sugiyama et al., 2009). Metazoan Cdt1 proteins contain a well-characterized degron motif called PIP box (Q-x-x-[I/L/M/V]-T-D-[F/Y]-[F/Y]-x-x-x-[R/K]) (Havens and Walter, 2009), which interacts with the ubiquitin ligase complex CRL4 pathway for degradation. The amino acid sequence of the degron in human Cdt1 (hCdt1) is QRRVTDFFARRR and it is at position aa3-14. We found a conserved degron QTSVTNFFASRK at the same location in P. dumerilii amino acid sequence (Figure 1—figure supplement 1). We also searched for a second degradation peptide, the Cy motif (aa68-70 in hCdt1), that interacts with SCF E3 ligase for degradation (Fujita, 2006; Nishitani et al., 2006). This second degron, however, cannot be identified unambiguously in metazoan proteins (including P. dumerilii) outside of mammals. Assuming that the PIP box is the most important for P. dumerilii Cdt1 degradation, we then proceeded by fusing a large truncated Pdu-Cdt1 sequence (aa1-147) containing the PIP box degron, but excluding the other functional interaction or DNA-binding domains, to different fluorescent proteins (mVenus, mCherry, mKO2, mAG) (Figure 1A). The fused constructs were then cloned into pCS2+ expression vector, transcribed in vitro, and injected as mRNA into embryos at one-cell stage (see Materials and methods for details). Among all constructs tested, only mVenus-Cdt1(aa1-147) showed fluorescence located to the nucleus and clear cycling without producing phenotypic effects (Figure 1B). The other constructs which had different fluorescent proteins but the same Cdt1 peptide did not produce any fluorescent signal (a problem also encountered by other researchers while establishing cell cycle reporters in other systems).

Figure 1. FUCCI cell cycle reporter for Platynereis dumerilii.

(A) P. dumerilii Cdt1 complete amino acid sequence above, showing the domains including PIP destruction box (N terminal). Below: a representation of the fused cell cycle construct containing mVenus fluorescent protein and a truncated part of Pdu-Cdt1. mVenus is a yellow fluorescent protein but is shown in green color for convenience throughout the manuscript. (B) Frames (every 4 min) from time-lapse (Figure 1—Video 1 and Figure 1—Video 2) showing division and cell cycling of an embryonic cell (labeled as ‘ab’) and its daughters (‘a’ and ‘b’). Fluorescent channels are shown separately for HistoneH2A-mCherry (red - nuclear) and mVenus-Cdt1(aa1-147) (green - cycling nuclear). The sister cells show significantly different cycling patterns, as indicated by bars marking the different cell cycle phases (M/G1/S/G2). (C) Example of an embryo which was injected with mRNA at two-cell stage, EdU-incubated for 3 min at 12hpf, and fixed immediately. The part below the dashed line is the injected side. All channels are merged. Red: Histone2A-mCherry; Green: mVenus-Cdt1(aa1-147); Magenta: EdU. (D–D’’’) Examples of cells that displayed different color combinations, and counts and percentages of cells based on data from six embryos (two independent experiments). (E) Cartoon summarizing the Pdu-FUCCI fluorescence patterns based on the time-lapse observations in B and EdU observations in D-D’’’.

Figure 1.

Figure 1—figure supplement 1. - Cdt1 amino acid alignments of destruction box sequences from different species.

Figure 1—figure supplement 1.

Cdt1 amino acid alignment showing the region containing the PIP BOX (degron motif). The conserved motif for this degron in the human sequence is Q-x-x-[I/L/M/V]-T-D-[F/Y]-[F/Y]-x-x-x-[R/K]. We found a highly conserved region in the P. dumerilii sequence (aa3-14) corresponding to the PIP degron. For the cell cycle construct, a truncated (aa1-147) piece of Pdu-cdt1 sequence containing the PIP Box was used.
Figure 1—figure supplement 2. Multiciliated cells that exit the cell cycle can be visualized using Pdu-FUCCI.

Figure 1—figure supplement 2.

(A) Cartoon of 48 hpf larva (ventral view), anterior up, slightly rotated up from the posterior end. (B–C’’) mVenus-Cdt1(aa1-147) (nuclear) and EGFP-caax (membrane) live-imaged together via single green channel. The orientation of sample in B is similar to cartoon in A. Strong mVenus signal persists in the nuclei of prototroch (arrowheads) (see Figure 1—Video 3 for earlier time points of the prototroch cells). (C) Ectoderm reconstruction of a larva injected with mVenus-cdt1(aa1-147), HistoneH2A-mCherry, and EGFP-caax mRNA (see Materials and methods and Figure 1—Video 4 for the ‘onionization’ process). The stage corresponds to late-trochophore stage. Paratroch cells show strong mVenus signal (arrowheads in C’ and C’’). (D) Cartoon of larva at 72 hpf, ventral view. Larvae were treated with EdU from 36 hpf until 72 hpf, and processed for immunohistochemistry (Acetylated-tubulin for cilia) and EdU reaction. Prototroch cells (E–E’’), and paratroch cells (F, G’) do not incorporate EdU after they are born confirming they have exited cell cycle and do not proceed to S phase. Stars indicate the troch cell nuclei.
Figure 1—video 1. Cell cycle reporter Pdu-FUCCI time-lapse in the early embryo (mCherry and mVenus).
Download video file (952.5KB, mp4)
DOI: 10.7554/eLife.30463.005
The video shows an embryo injected with Histone2A-mCherry and mVenus-cdt1(aa1-147) mRNAs at one cell stage, imaged every 4 min, starting around 6:30 hpf for about 2 hr. The cells marked by arrowheads in the video (ab, a, b) are shown in detail in Figure 1B. Red: mCherry, Green: mVenus
Figure 1—video 2. Cell cycle reporter Pdu-FUCCI time-lapse in the early embryo (mVenus).
Download video file (782.9KB, mp4)
DOI: 10.7554/eLife.30463.006
Same Figure 1—Video 1 is shown with mVenus (green) channel only.
Figure 1—video 3. Time-lapse of prototroch cells being born and exiting cell cycle.
Download video file (1.1MB, mp4)
DOI: 10.7554/eLife.30463.007
Embryo was injected with Pdu-FUCCI (Histone2A-mCherry and mVenus-cdt1(aa1-147) and EGFP-caax mRNA at one-cell stage, and imaged every 10 min for about 6 hr. mVenus and EGFP signals are imaged from a single channel.
Figure 1—Video 4. Explanation of the onionization process, and display of all the onion layers.
Download video file (3.1MB, mp4)
DOI: 10.7554/eLife.30463.008
Video is made from stack same as the sample shown in Figure 1—figure supplement 1C. Embryo was injected with Pdu-FUCCI and EGFP-caax mRNA at one-cell stage. 

To understand the temporal characteristics of cycling patterns of mVenus-Cdt1(aa1-147), we used live imaging and 5-ethynyl-2’-deoxyuridine (EdU) labeling assay. We first carried out a detailed time-point analysis for individual cells using live imaging. HistoneH2A-mCherry mRNA was co-injected with the mVenus-cdt1(aa1-147) mRNA for continuous nuclear labeling. The imaging was done in several embryos (n = 10, four replicates) but here we report results from a representative embryo (Figure 1—video 1 and Figure 1—video 2). We found that mVenus-Cdt1(aa1-147) in P. dumerilii was present during G1 phase, and was then degraded, probably during S phase. In contrast to the widely used hCdt1 reporter, which is specific to G1, the P. dumerilii Cdt1 reporter started accumulating again shortly before mitosis probably in late G2 (Figure 1B, see cell ‘ab’ and then cell ‘b’ before mitosis). Consequently, mVenus signal was also present during mitosis (can be seen in Figure 1—video 1, Figure 1—video 2). Fluorescence was suddenly dispersed in the cytoplasm when the nuclear envelope broke down during mitosis (because the truncated chimeric protein, unlike the native Cdt1, does not bind to chromatin), and then quickly concentrated in the daughter nuclei when nuclear envelope reformed at the end of telophase. We observed contrasting cycling patterns in sister cells. As an example, nucleus ‘a’ retained the mVenus signal for more than an hour (Figure 1B, upper row), while nucleus ‘b’ kept signal for only about 8 min (Figure 1B, lower row). The cell ‘b’ eventually divided (at 52 min) while cell ‘a’ was still in G1/S phase. Similar cycling patterns were observed for other cycling cells in several videos we have obtained, thus establishing mVenus-Cdt1(aa1-147) as an efficient cycling marker.

Next, in order to determine more precisely when mVenus-Cdt1(aa1-147) was degraded, we used S-phase-labeling with EdU. Cdt1 protein is part of the DNA-replication complex, normally present at the beginning of S phase, but targeted for degradation during S phase in order to prevent re-replication (Arias and Walter, 2006; Fujita, 2006; Liu et al., 2004). Thus, we tested whether mVenus-Cdt1(aa1-147) signal overlapped with the EdU signal. Embryos injected with mVenus-cdt1(aa1-147) and HistoneH2A-mCherry mRNAs were incubated until 12 hr-post-fertilization (hpf), then treated with a very short pulse of EdU (3 min) and immediately fixed after quick rinsing (as EdU detection cannot be carried out live, specimens needed to be fixed). The EdU treatment was long enough to mark the S phase but too short for most of the cells to progress much further in the cell cycle. As a result, the vast majority of EdU(+) cells were expected to be in S phase at the time of sample fixation. We analyzed cell nuclei from six embryos (from two independent experiments) treated this way (Figure 1C–D’’’). We observed that 15.6% (n = 51) of cells were positive for mVenus, mCherry and EdU, demonstrating that mVenus-Cdt1(aa1-147) was present during at least part of the S phase (Figure 1D). Only a few cells (2.1%, n = 7) were positive for mCherry and EdU, but not mVenus, suggesting that mVenus-Cdt1(aa1-147) was degraded at some point during the S phase (Figure 1D’). Taking into account that the vast majority but not all Edu(+) cells are also mVenus(+), this strongly suggests that mVenus-Cdt1(aa1-147) is degraded toward the end of the S phase and is no longer present as the cells enter the G2 phase. The majority of cells (75.3%, n = 247) were found to be positive for mVenus and mCherry, but lacked EdU signal (Figure 1D’’). These cells were either in G1 or late G2 phase. Finally, cells that were only mCherry(+) marking the early G2 phase made up a smaller percentage (7%, n = 23) of all cells analyzed (Figure 1D’’’). We further confirmed that the cell cycle reporter is working properly by analyzing the ciliated cells that are known to be terminally differentiated in the annelid swimming larvae. These cells exit the cell cycle, and thus are in G0, no longer degrading Cdt1. As expected, we observed that they accumulated mVenus-Cdt1(aa1-147), once they stopped cycling. The mVenus signal reached much higher levels than in any cycling cell and remained at high levels in these fully differentiated multiciliated cells (Figure 1—figure supplement 2, Figure 1—video 3 and Figure 1—video 4).

In P. dumerilii, mVenus-Cdt1(aa1-147) reporter is present during a larger portion of the cell cycle (Figure 1E). It is being degraded during the course of the S phase, similar to the vertebrate reporter, and it starts to accumulate again during the late G2 phase. This pattern reflects the behavior of endogenous Cdt1 degradation reported in other organisms: In human cells, Cdt1 starts getting degraded in the S phase, thus it is expected to be present at least partially during this phase (Shiomi et al., 2014). In embryonic stem cells, Cdt1 starts accumulating at the end of G2 phase, which is promoted by its interaction with Geminin (Ballabeni et al., 2004). Even though our mVenus-Cdt1(aa1-147) construct is not specific to the G1 phase, its cycling behavior is very pronounced as the protein is at barely detectable levels in late S and early G2 phases and therefore, together with HistoneH2A-mCherry, allows to follow cell cycle progression in living embryos. We call the two constructs (HistoneH2A-mCherry and mVenus-Cdt1(aa1-147)) together ‘Pdu-FUCCI’ in the rest of this manuscript. Next, we show our results of 4d micromere lineage analysis at single-cell resolution, via live imaging combining Pdu-FUCCI with membrane labeling. The layer of information into cell cycle progression provided by mVenus-Cdt1(aa1-147) was crucial in accurate manual curation of lineages in the experiments reported below. Because we could not increase the time resolution due to phototoxicity, cell cycle progression was used for predicting cell division, and differentiating the daughter cells from the surrounding cells.

Live imaging the cell cycling and migration behavior of putative primordial germ cells

In P. dumerilii, the mesodermal 4d micromere (also called ‘M’) gives rise to two symmetrically positioned sister cells ML (Mesoblast ‘Left’) and MR (Mesoblast ‘Right’) by symmetric cell division (Fischer and Arendt, 2013; Rebscher et al., 2012, Rebscher et al., 2007). The following two highly asymmetric divisions of ML and MR give rise to four small cells (1ml/r and 2ml/r), which have been suggested to form the germline (putative primordial germ cells, pPGCs). Thus, the pPGCs are the earliest lineage to segregate from 4d in P. dumerilii. pPGCs become mitotically quiescent right after birth. As a result, they can be labeled with a short pulse of EdU around their time of birth (between 3 and 8 hpf), and be detected even days after EdU incorporation as they retain undiluted EdU while the neighboring somatic cells have largely diluted EdU through multiple mitoses (Rebscher et al., 2012). We confirmed that when embryos were treated between 5 and 7 hpf or 6 and 8 hpf, and raised to 24 hpf or 48 hpf all four pPGCs were labeled with EdU under our culturing conditions (5–7 hpf treatment shown in Figure 2A for samples raised until and fixed at 24 hpf, in Figure 2B for samples raised until and fixed at 48 hpf; 6–8 hpf data not shown). When embryos were treated with EdU between 7 and 9 hpf, four out of six larvae had only two EdU-positive pPGCs at 72 hpf (data not shown), indicating that pPGCs stop incorporating EdU around this time frame. In addition, to test whether pPGCs synthesized DNA after they were born in the next 2 days of development, we carried out EdU incorporation assays after pPGCs were born, between 11 and 24 hpf (Figure 2C) and 24 and 48 hpf (Figure 2D). We did not detect any pPGCs positive for EdU in the larvae (n > 16) in either of these treatments, confirming DNA synthesis does not take place during this time frame in the pPGCs.

Figure 2. pPGCs do not incorporate EdU after they are born and retain mVenus-Cdt1(aa1-147) signal.

Figure 2.

pPGCs (arrowheads) incorporate and retain the EdU signal (red) when treated during the time they are born (5–7 hpf), and can be easily detected at 24 hpf (A) or 48 hpf (B) due to retention of EdU. However, they do not incorporate EdU, if treated after they are born (C and D). Live samples that were injected with Pdu-FUCCI (HistoneH2A-mCherry, mVenus-cdt1(aa1-147)) and EGFP-caax and imaged at 24 hpf (E) and 48 hpf (F) show that pPGCs have the nuclear mVenus signal (green), also suggesting that they have stopped cycling (see also Figure 3, Figure 3—figure supplement 1, and Figure 7B). Green bars in the timeline schemas show the time period in which pPGCs are born. Red arrows in A–D show the period of EdU treatment. At least n = 6 samples were imaged for each EdU assay, and a representative sample is shown.

We then analyzed the pPGCs for their cell cycle state using Pdu-FUCCI injection and live imaging. In this and following experiments, the injection cocktail included Pdu-FUCCI and an additional EGFP construct with a cell-membrane-localization signal (EGFP-caax) for visualization of individual cell shapes. First, we injected one-cell stage embryos with Pdu-FUCCI and EGFP-caax, and imaged the larvae live at 24 hpf and 48 hpf. We found that pPGCs were mVenus-Cdt1(aa1-147) positive at 24 hpf and 48 hpf, suggesting that they are arrested in G0/G1 (Figure 2E and F). Next, in samples injected with the same cocktail but only in the D quadrant at four-cell stage, we carried out high time-resolution (every 10 min) time-lapse imaging to determine if Pdu-FUCCI could allow tracking the pPGCs (Figure 3, Figure 3—figure supplement 1, Figure 3—video 1). We chose to inject the D quadrant only, as it eventually gives rise to the 4d lineage from which pPGCs originate. In addition, injecting only the D quadrant facilitated the observation of its descending lineages, because the rest of the embryo remained unlabeled. Starting from 8 hpf, injected embryos were imaged for about 12 hr, with 10 min intervals. Temperature conditions during live imaging were higher than 18°C (which is the usual culture temperature for P. dumerilii) (Fischer et al., 2010). Thus, development was accelerated during imaging allowing us to record a broader developmental period, while the sample had normal development (Figure 3—video 2). This imaging period corresponds to the stages from stereoblastula to mid-late trochophore (roughly 8 hpf to 38 hpf at 18˚C) (See Table 1 for time-points and corresponding stages at different temperatures). Using the high-resolution time-lapse video, we were able to track the pPGCs, and observed that mVenus signal persisted in pPGCs after they were born (Figure 3A–H, Figure 3—figure supplement 1 for close-ups). Thus, in addition to differentiated cells such as ciliated cells, Pdu-FUCCI is a useful tool to trace the cells that are undifferentiated but arrested in G0/G1, such as the pPGCs.

Figure 3. Time-lapse series of pPGC migration.

Embryo (Sample A) was injected with Pdu-FUCCI and EGFP-caax in the D quadrant and live-imaged with high time resolution (every 10 min). Time-lapse imaging started at 8 hpf and continued for 12 hr. Selected snapshots (elapsed time indicated on the lower-left corner) shown in the figure. (A–H) Z-projections from subsets of stacks showing the sample from a postero-lateral orientation, dorsal up, ventral down. pPGCs are indicated with arrowheads. (A’–H’) Same dataset analyzed in Imaris as Z-projection of full stacks, and rotated to a perfect posterior view in the software’s 3D viewer. All fluorescent signals are shown in grey color (set artificially in Imaris) and pPGCs (pink spots) were traced using the spots feature (Figure 3—video 3). (A’’–H’’) Lateral view of the same Imaris dataset, posterior to the right, dorsal up (Figure 3—video 4). Yellow arrow shows the approximate path of pPGCs as they migrate. Note that they travel on the surface (until E’’), then start assuming an internal position (indicated with the dashed yellow line) with the onset of epiboly. For the original video showing all time points and full-projection of stacks see Figure 3—video 1. For close-ups see Figure 3—figure supplement 1. (In the rest of the manuscript, this sample is analyzed for other developmental processes and is referred to as Sample A. Information from additional samples (Samples B and C) is provided in figure supplements.).

Figure 3.

Figure 3—figure supplement 1. Close-ups of time-lapse video of pPGCs.

Figure 3—figure supplement 1.

Close-ups of pPGCs for the frames from Figure 3—video 1 (Sample A) shown in Figure 3A–H are shown with merged fluorescent channels (A-H) and green fluorescent channel (A'-H') separately. Note that pPGCs (arrowheads) retain the nuclear mVenus signal throughout. Toward the end of the time-lapse, signal in pPGCs becomes weak and harder to see in these 3D-projections; however, measurements of nuclear signal show mVenus in pPGCs does not cycle (Figure 7B).
Figure 3—figure supplement 2. The first two divisions of ML and MR.

Figure 3—figure supplement 2.

Frames showing the first two divisions of ML and MR, from a different sample injected with Pdu-FUCCI and EGFP-caax. Imaging started at 7:20hpf, done every 6 min, allowing to observe the first two divisions. These divisions give rise to the four pPGCs (dashed circles). pPGCs have both HistoneH2A-mCherry (red) and mVenus-Cdt1(aa1-147) (green) right after cell divisions are completed, indicated by the orange-green nucleus color.
Figure 3—video 1. Original 3D-projected time-lapse dataset with annotations (for Sample A).
Download video file (2MB, mp4)
DOI: 10.7554/eLife.30463.013
Embryo was injected with Pdu-FUCCI and EGFP-caax mRNA into the D quadrant at four-cell stage, and imaged every 10 min. Note that uninjected side of the embryo appears dark. Also see Figure 5—video 1 and Figure 5—video 2 for additional samples imaged from a different batch of fertilization and injections.
Figure 3—video 2. Video of stack showing the same individual from Figure 3—video 1 imaged next day.
Download video file (5.7MB, mp4)
DOI: 10.7554/eLife.30463.014
The sample displays normal development after injection and imaging.
Figure 3—video 3. pPGC migration traced in Imaris, posterior view.
Download video file (2.3MB, mp4)
DOI: 10.7554/eLife.30463.015
Same confocal time-lapse dataset (Sample A) from Figure 3—video 1 was used for this analysis. Pink spots mark the pPGC nuclei.
Figure 3—video 4. pPGC migration traced in Imaris, lateral view.
Download video file (1.4MB, mp4)
DOI: 10.7554/eLife.30463.016
Same confocal time-lapse dataset (Sample A) from Figure 3—video 1 was used for this analysis. Pink spots mark the pPGC nuclei.

Table 1. Calculated developmental time and corresponding stage for each time point at imaging temperatures.

For the video (Sample A) from which we show most of the lineage tracing data in this manuscript, we calculated what each time point roughly corresponds to in the normal staging by Fischer et al., 2010. This calculation was done based on the starting stage, end stage, and how long this normally takes under 18˚C conditions. For example, Figure 3—video 1 (used in Figures 3, 4, 5 and 6) starts at eight hpf (stereoblastula stage), and in the final time point the sample appears towards the end of mid trochophore stage. Even though elapsed time is 12 hr of imaging (72 time points), under 18˚C incubation conditions, about 35–40 hr is required to reach this stage. Thus, we calculated each time point in the live-image dataset corresponding roughly to: T = 8 hr + (25mins x tp), where ‘tp’ is time point, and T is the calculated developmental time. According to this, the end calculated developmental time for Figure 3—video 1 is: T = 8 hr + (25 mins x 72)=37 hr 35 min.

Time point (tp) Elapsed imaging time (hr:min:s) Calculated developmental time (T) at 18˚C (hr:min:s) Corresponding developmental stage at 18˚C (Fischer et al., 2010)
1 0:00:00 8:00:00 Stereoblastula
3 0:20:00 8:50:00 Stereoblastula
5 0:40:00 9:40:00 Stereoblastula
7 1:00:00 10:30:00 Stereoblastula
9 1:20:00 11:20:00 Stereoblastula
11 1:40:00 12:10:00 Stereoblastula
13 2:00:00 13:00:00 Protrochophore
15 2:20:00 13:50:00 Protrochophore
17 2:40:00 14:40:00 Protrochophore
19 3:00:00 15:30:00 Protrochophore
21 3:20:00 16:20:00 Protrochophore
23 3:40:00 17:10:00 Protrochophore
25 4:00:00 18:00:00 Protrochophore
27 4:20:00 18:50:00 Protrochophore
29 4:40:00 19:40:00 Protrochophore
31 5:00:00 20:30:00 Protrochophore
33 5:20:00 21:20:00 Protrochophore
35 5:40:00 22:10:00 Protrochophore
37 6:00:00 23:00:00 Protrochophore
39 6:20:00 23:50:00 Protrochophore
41 6:40:00 24:40:00 Early trochophore
43 7:00:00 25:30:00 Early trochophore
45 7:20:00 26:20:00 Mid-trochophore
47 7:40:00 27:10:00 Mid-trochophore
49 8:00:00 28:00:00 Mid-trochophore
51 8:20:00 28:50:00 Mid-trochophore
53 8:40:00 29:40:00 Mid-trochophore
55 9:00:00 30:30:00 Mid-trochophore
57 9:20:00 31:20:00 Mid-trochophore
59 9:40:00 32:10:00 Mid-trochophore
61 10:00:00 33:00:00 Mid-trochophore
63 10:20:00 33:50:00 Mid-trochophore
65 10:40:00 34:40:00 Mid-trochophore
67 11:00:00 35:30:00 Mid-trochophore
69 11:20:00 36:20:00 Mid-trochophore
71 11:40:00 37:10:00 Mid-trochophore
72 11:50:00 37:35:00 Mid-trochophore

We then investigated the migration behavior of pPGCs in the same imaging dataset from the sample injected in the D quadrant with Pdu-FUCCI and EGFP-caax mix. When live imaging was started, 4d cell had already divided once giving rise to the left and right mesoblasts (ML and MR), and ML and MR had divided twice giving rise to two pPGCs each (Figure 3A–A’’, Figure 3—figure supplement 2 shows the first two divisions of ML and MR in another sample). pPGCs at this stage (stereoblastula) were located on the external surface of the embryo (Figure 3A’–A’’, Figure 3—video 3, Figure 3—video 4). However, soon after they were born pPGCs started moving toward each other, formed a cluster, and then moved toward the vegetal pole through epiboly (Figure 3B’–D’’). The movement of pPGCs continued on the surface until 20 hpf (or about 5 hr of imaging –Table 1) (Figure 3D’–D’’). Then they started to position internally (Figure 3E’–G’’), eventually assuming a postero-ventral position forming a bridge between the left and right mesodermal bands which converge at the ventral pole (Figure 3H–H’’, 2E and F). This analysis establishes a framework for locating pPGCs through these developmental stages and allow for tracking these cells in experimental manipulation conditions such as drug treatment or cell ablation in future studies.

Each mesodermal hemisegment is the progeny of individual blast cells produced in successive divisions

In addition to giving rise to pPGCs, 4d (M) blastomere is the origin of the trunk mesoderm in P. dumerilii (Ackermann et al., 2005). The trunk somatic mesoderm of P. dumerili larvae is organized in three largely similar segmental blocks (Brunet et al., 2015). Each mesodermal segment is composed of identical left and right halves called mesodermal hemisegments. In clitellate annelids, ML and MR divide asymmetrically giving rise to an anterior to posterior linear series of smaller segmental founder cells called ‘primary blast cells’ (PBCs). There are as many PBCs on each side as there are segments. Each PBC generates a metamerically iterated clonal mesodermal domain distributed over three consecutive hemisegments. However, each PBC makes ‘one hemisegment-worth’ of mesoderm (Gline et al., 2011; Weisblat and Kuo, 2014). This stereotypic, anterior to posterior-oriented, asymmetric division process is termed teloblastic growth. In P. dumerilii, to determine whether the 4d lineage (after the divisions that generate pPGCs) makes the mesodermal hemisegments in the larva via the teloblastic process as in the clitellates, we followed divisions of this lineage and analyzed the origin of mesodermal cell clusters (4d lineage is summarized in Figure 4A). If mesoderm formation in P. dumerilii follows a teloblastic process, a key expectation is the presence of clonally homogeneous mesodermal regions, each originating from one specific primary blast cell as in the clitellate annelids. To do this, we manually traced cell lineages originating from 4d blastomere in live imaging datasets using Imaris software (for details, see Materials and methods). Here we only report data for the left mesoblast (ML) (Sample A), but confirmed in other samples (Samples B and C) that MR behaves like ML (Figure 5—figure supplement 1, Figure 5—video 1, Figure 5—video 2).

Figure 4. Primary blast cells give rise to clonal bocks of mesoderm.

The same sample as shown in Figure 3 (Sample A) was analyzed for mesodermal lineages in Bitplane Imaris. 4-cell stage embryo injected with Pdu-FUCCI (HistoneH2A-mCherry, mVenus-cdt1(aa1-147)) and EGFP-caax into D quadrant was live-imaged starting at 8 hpf every 10 min for 12 hr, from a posterior-lateral angle which enabled the tracing and visualization of the left mesoblast (ML = 4d1) lineage. Schema in A shows 4d lineage: ML (blue), MR (orange), pPGCs (pink), and highlighted subsets (yellow) are all color-coded (summarized in C) throughout this and following figures. Note that only a limited number of cells were traced for MR. Panel B (zoomed-in from B’) shows the starting frame of the time-lapse, and the position of ML and MR, with all three fluorescent constructs (see Figure 3—video 1 for the original time-lapse with annotations, and Figure 4—video 1 with spots for lineage tracing of ML). In the panels (D’- G’’), the last time point from this time-lapse (Sample A) is shown with EGFP-caax and mVenus-Cdt1(aa1-147) only (both in green), but HistoneH2A-mCherry (red) was removed for easier observation of the colored spots. 5ml lineage makes the mesoderm of the anterior-most left cryptic hemisegment (D–D’’’), 6ml makes the 1st larval left hemisegment (E–E’’’), 7ml the 2nd larval left hemisegment (F–F’’’), and 8ml the 3rd larval left hemisegment (G–G’’’). Panels D-G are the same orientation as D’-G’ but only showing the spots. D’–G’ show posterior orientation, and D’’-G’’ show lateral orientation. The lineages highlighted in yellow in D–G’’ are also shown in yellow in the lineage trees (D’’’–G’’’). See Figure 4—video 16 for an animated version of these lineages highlighted. Figure 4—video 2–13 show the full time-lapse of each lineage from posterior and lateral orientations, as well as 360-degree rotation.

Figure 4.

Figure 4—figure supplement 1. Progeny of each blast cell at an intermediate time point.

Figure 4—figure supplement 1.

For a comparison to the final time point (12 hr 00 min) shown in Figure 4. Clonal domains (in yellow) of cells each primary blast cell gives rise to are already obvious at time point 8 hr 10 min. Blue: ML lineage, Yellow: subset highlighted within ML lineage, Pink: pPGCs, Orange: subset of MR lineage for reference.
Figure 4—figure supplement 2. Mesodermal clonal clusters align with chaetal sacs specific to each hemisegment.

Figure 4—figure supplement 2.

Chaetal sacs (ectodermal) are evident by the final time point (t = 72, or 12 hr 0 min) of the time-lapse (A–A’), which corresponds to about 37:35 hpf developmental time (Table 1). The chaetal sacs are often used as anatomical landmarks for determining larval segments, as there are two sacs per hemisegment (A’). The clonal mesodermal clusters (Imaris spots) align with the chaetal sacs of the relevant segment, an example for the second segment is shown in (B, B’), highlighted with yellow spot color. The spots are not ectodermal and do not overlap with the chaetal sacs, but instead lie beneath them at this stage (C–D’’). For obtaining cross sections in C’-D’’, the Imaris 3D stack with lineage spots at t = 72 was exported, and resliced in FIJI for visualizing cross-sections. Orange lines in C and D indicate the section planes shown in C’,C’’ and D’,D’’. Red dashed line marks the approximate border between the ectoderm (the chaetal sacs) and the mesoderm. Note that the spots marking the mesoderm are positioned mostly below the chaetal sacs (C’’,D’’), and those spots that overlap in these projections are located in-between the sacs.
Figure 4—figure supplement 3. Live-imaging of the formation of mesodermal segmental blocks and the corresponding chaetal sacs.

Figure 4—figure supplement 3.

Development of the right mesodermal band tissues, between the early trochophore and the late trochophore stages (from 26 hpf to 54 hpf) was time-lapse imaged (Figure 4—video 17). The embryo was injected in the D quadrant with HistoneH2A-mCherry (red) and EGFP-caax (green) mRNA, and was raised until swimming larva stage and imaged at a time resolution of every 67 min (18°C equivalent). Two visualizations of the same time point are shown in each panel: (i) an onion layer projection deep enough to exclude all surface ectoderm (A–D), and (ii) a curved section along the Z axis that follows the formation of the ventral row of chaetal sacs (A’–D’). An interpretation of the morphogenetic events is given with color code for each type of tissue. The position of section curves is indicated by white dashed lines (D, D’). At 28 hpf (A, A’), the mesodermal band is still a bean-shaped, rapidly proliferating block of tissue. At 31 hpf (B, B’), while the mesodermal band spreads dorso-ventrally, chaetal sacs start to form as pockets of ectodermal tissue above the mesodermal band. At 36 hpf (C, C’), the mesodermal band shows transient but very clear intersegmental constrictions possibly corresponding to segmental anlage. Note that this is about the same developmental point as shown in the last time point of the lineage-tracing dataset (Sample A) in the previous figures. Each segmental mesodermal block corresponds to one of the clonal blocks identified in the lineage tracing. Chaetal sacs elongate and each mesodermal block starts to surround a pair of chaetal sacs (C’). At 51 hpf (D, D’), the chaetal sacs are fully elongated and the mesoderm surrounds each one of them like a sheath. Note that approximate 18°C equivalents of developmental time in hours-post-fertilization (hpf) are shown in the panels.
Figure 4—video 1. Time-lapse of the ML lineage, and 360 rotation of the last time point.
Download video file (2.2MB, mp4)
DOI: 10.7554/eLife.30463.022
Video shows spots from Imaris lineage tracing for extensively-traced ML lineage (blue), some tracing for MR lineage (orange), and pPGCs from both MR and ML (pink). Data set is the same as shown in Figure 3—video 1 (Sample A).
Figure 4—video 2. 3ml, posterior view.
Download video file (950.8KB, mp4)
DOI: 10.7554/eLife.30463.023
3ml sub-lineage is highlighted (yellow) within the ML lineage (blue) time-lapse video.
Figure 4—video 3. 3ml, lateral view.
Download video file (650.1KB, mp4)
DOI: 10.7554/eLife.30463.024
Figure 4—video 4. 4ml, posterior view.
Download video file (997.6KB, mp4)
DOI: 10.7554/eLife.30463.025
4ml sub-lineage is highlighted (yellow) within the ML lineage (blue) time-lapse video.
Figure 4—video 5. 4ml, lateral view.
Download video file (720.2KB, mp4)
DOI: 10.7554/eLife.30463.026
Figure 4—video 6. 5ml, posterior view.
Download video file (2.2MB, mp4)
DOI: 10.7554/eLife.30463.027
5ml sub-lineage is highlighted (yellow) within the ML lineage (blue) time-lapse video.
Figure 4—video 7. 5ml, lateral view.
Download video file (882.3KB, mp4)
DOI: 10.7554/eLife.30463.028
Figure 4—video 8. 6ml, posterior view.
Download video file (2.4MB, mp4)
DOI: 10.7554/eLife.30463.029
6ml sub-lineage is highlighted (yellow) within the ML lineage (blue) time-lapse video.
Figure 4—video 9. 6ml, lateral view.
Download video file (882.4KB, mp4)
DOI: 10.7554/eLife.30463.030
Figure 4—video 10. 7ml, posterior view.
Download video file (2.2MB, mp4)
DOI: 10.7554/eLife.30463.031
7ml sub-lineage is highlighted (yellow) within the ML lineage (blue) time-lapse video.
Figure 4—video 11. 7ml, lateral view.
Download video file (880.2KB, mp4)
DOI: 10.7554/eLife.30463.032
Figure 4—video 12. 8ml, posterior view.
Download video file (2.2MB, mp4)
DOI: 10.7554/eLife.30463.033
8ml sub-lineage is highlighted (yellow) within the ML lineage (blue) time-lapse video.
Figure 4—video 13. 8ml, lateral view.
Download video file (877.8KB, mp4)
DOI: 10.7554/eLife.30463.034
Figure 4—video 14. 8ML, posterior view.
Download video file (2.2MB, mp4)
DOI: 10.7554/eLife.30463.035
8ML sub-lineage is highlighted (yellow) within the ML lineage (blue) time-lapse video.
Figure 4—video 15. 8ML, lateral view.
Download video file (873KB, mp4)
DOI: 10.7554/eLife.30463.036
Figure 4—video 16. Animation of the segmental mesoderm clonal regions.
Download video file (334.7KB, mp4)
DOI: 10.7554/eLife.30463.037
Posterior and lateral views together.
Figure 4—video 17. Segment formation in the P. dumerilii larva.
Download video file (1.4MB, mp4)
DOI: 10.7554/eLife.30463.038
Embryo was injected with HistoneH2A-mCherry and EGFP-caax mRNA, raised until 24 hpf swimming larval stage, immobilized with DMSO treatment and mounted in low-melting agarose for time-lapse live-imaging. The resulting 4D dataset was modified in FIJI with the Onionizer (see Materials and methods) to reveal the curved ectodermal and mesodermal larval segments forming. Upper row is the lateral view, middle row is the cross-section, and lower row is the label key with corresponding colors. The timer shows the calculated developmental time. See Figure 4—figure supplement 3 for details.

Imaris creates a temporal series of fully re-orientable 3D reconstructions of the embryo, allowing the manual tracking of cell divisions. Spots corresponding to the nucleus of each cell are generated and cell lineages can be connected via these spots across time (Figure 4—video 1). In addition to nuclear divisions, the cell cycle reporter helped us predict when cell division was approaching, and the cell membrane rounding (visualized via the EGFP-caax construct) helped us detect without ambiguity each mitosis and the resulting daughter cells. Once a cell lineage tree is available, subsets of lineages can be highlighted to visualize where the progeny is located in the 3D reconstruction. Using this feature, we highlighted the progeny of each blast cell that splits from ML (Figure 4). We looked at the origin and clonality of cells that formed each segmental mesoderm. Here, we adopt a similar three-character nomenclature (rank, fate, and side) (Fischer and Arendt, 2013; Lyons et al., 2012). For example, 5ml is the small daughter, of the fifth asymmetric division of the left M teloblast, whereas its sister cell, 5ML is the self-renewed M teloblast.

P. dumerilii has three true larval segments with bundles of chaetae on each side and one cryptic anterior segment (also called ‘segment 0’ [Saudemont et al., 2008], or ‘segment I’ [Steinmetz et al., 2011]). The cryptic segment does not bear chaetae and is incorporated into the head of the larva (Brunet et al., 2015; Fischer et al., 2010; Steinmetz et al., 2011). We adopt the following order from anterior to posterior progression: cryptic segment, segments 1, 2, and 3. The numbered segments are already clearly identifiable in the final stacks of our videos corresponding to mid-trochophore stage, because two ectodermal pockets corresponding to chaetal sacs are starting to form in each hemisegment, and mesodermal tissues that will make the segmental musculature are starting to surround them (Figure 3—video 1, last frame). We identified four clear mesodermal sub-lineages that make distinct clonal domains of segmental mesodermal precursor cells arranged in bilateral anterior to posterior series (Figure 4D–G, Figure 4—figure supplement 1). We found that, progeny of each ‘m’ blast cell from 6ml to 8ml contributes mostly to a specific larval segment: 6ml contributes to the left larval hemisegment 1 (Figure 4E–E’’’’, Figure 4—video 8, Figure 4—video 9); 7ml to the left larval hemisegment 2 (Figure 4F–F’’’’, Figure 4—video 10, Figure 4—video 11); and 8ml to the left larval hemisegment 3 (Figure 4G–G’’’’, Figure 4—video 12, Figure 4—video 13). These clonal blocks were easily discernible at earlier stages of development as well (Figure 4—figure supplement 1). In addition, 5ml proliferates to give a mesodermal block located just anterior to the three true segmental blocks originating from 6ml-8ml and will possibly give rise to the mesoderm of the left cryptic larval hemisegment (Figure 4D–D’’’’, Figure 4—video 6, Figure 4—video 7). These lineages are summarized in Figure 4—video 16.

To confirm that the clonal blocks of cells generated by each blast cell corresponded to segmental anlagen, we bring forward additional observations. First, we further analyzed the dorso-ventral position of the clonal mesodermal clusters at the final time point (t = 72, or about 37.5 hpf of development (Table 1) of the time lapse dataset. At this time point, chaetal sacs (ectodermal structures used as anatomical markers of larval segment formation) had already started forming with a few elongating bristles evident, and each clonal mesoderm cluster from a single PBC overlapped with a pair of chaetal sacs present in each hemisegment (Figure 4—figure supplement 2A–B’,). Then we analyzed the cross-sections of the 3D stacks with the Imaris lineage spots. We found that spots marking the mesodermal lineage lie just beneath each pair of chaetal sacs within a larval hemisegment (Figure 4—figure supplement 2C–D’’), confirming that these were mesodermal cells forming the layer beneath the elongating chaetal sacs at this stage. Second, we analyzed another time-lapse movie showing the development of the trochophore larva up to a stage where segmentation becomes thoroughly apparent (26–54 hpf) (Figure 4—figure supplement 3, Figure 4—video 17). Mesodermal blocks were initially beneath the elongating and deepening chaetal sacs (Figure 4—figure supplement 3A–B, Figure 4—video 17), but they eventually formed mesodermal pockets surrounding the chaetal sacs like sheaths (Figure 4—figure supplement 3C–D, Figure 4—video 17). Interestingly, before the chaetal sacs started to elongate and sink into the mesodermal layer, clear mesodermal segment boundaries were briefly visible, in the form of dorso-ventrally stretched cells (Figure 4—figure supplement 3C, arrows). In other models, these boundaries have been shown to correspond to acto-myosin cables that act as active compartmental limits preventing cell mixing (Monier et al., 2011). Furthermore, in P. dumerilii, previous works have shown that segmental anlagen become distinguishable at the transcriptional level already by 34 hpf, evident by the striped pattern of gene expression in the pre-segmental mesoderm and ectoderm (Saudemont et al., 2008; Steinmetz et al., 2011). Thus, even though segments are not anatomically distinct yet, at the molecular level mesodermal clusters start to show evidence of segmentation. Together, these observations support early determination of segmental anlage and suggest that there is minimal (if any) mixing of mesodermal cells across segments at the stages we carried out the mesodermal cell lineage analysis and after.

We also looked into the fate of blast cells segregated prior to these segmental lineages. 1ml and 2ml (1mr and 2mr for the right side) corresponded to the bilateral pairs of pPGCs as described above (Figure 4A–B). These cells did not divide further and stayed in the immediate vicinity of the M teloblastic cells near the vegetal pole of the embryo. 3ml and 4ml blast cells, unlike 5ml to 8ml, underwent a limited number of symmetric mitoses. These small 3ml and 4ml lineages drifted toward the animal pole. Due to the orientation of the sample during imaging, it was not possible to trace the lineages 3ml and 4ml confidently after a certain time point. Our confocal stacks cover only about 60 µm thickness (the embryos are 160 µm) from the posterior end, and the progeny of 3ml and 4ml move out of the imaged area. However, the limited information we obtained suggests they may be giving rise to anterior-most non-segmental mesodermal tissues (Figure 4—videos 2–5). Overall, the data support that ML shows teloblastic behavior and the progeny of mesodermal primary blast cells contribute to distinct larval segments similar to what is observed in clitellate annelids.

Mesodermal posterior growth zone originates from 8ML and 8MR

At the eighth division of ML and MR, cells 8ML/R and 8ml/r are generated. As described above, 8ml/r are the founder cells of the third segmental mesoderm (Figure 4G, Figure 4—figure supplement 1, Figure 4—video 16). We next investigated the progeny of 8ML/MR (Figure 5). We compared three separate individuals (Samples A, B, C) for the 8ML and 8MR divisions and found them to be similar in all samples (Figure 5—figure supplement 1, Figure 5—video 1, Figure 5—video 2). At the time they were born, 8ML/MR were positioned immediately next to the pPGCs (Figure 6U–U’; Figure 4—figure supplement 1; Figure 4—video 14, Figure 4—video 15). By mid-trochophore stage (around time points 55–60), all individuals had three cells on the left and right sides near pPGCs (Figure 5—figure supplement 1A–C’). Two of these cells divided eventually (around the same time in the left and right sides, but not perfectly simultaneously) (Figure 5A’–A’’’; Figure 5—figure supplement 1A’’-C’’) expanding the progeny of 8ML and 8MR to 5 cells on each side (10 total). Thus, by the last time point of our datasets (corresponding to the end of mid-trochophore stage), 8ML and 8MR had given rise to five cells each that were surrounding the four pPGCs and formed a posterior ‘bridge’ between the right and left mesodermal bands. They were positioned slightly posterior to the pPGC cluster (Figure 5B–B’’), in the region which has been previously described as the mesodermal posterior growth zone (Rebscher et al., 2007). We thus suggest that these cells represent the founding lineage ring of mesodermal stem cells that will be active later in juvenile development in the segment addition zone (Gazave et al., 2013).

Figure 5. 8ML/R give rise to the mesodermal posterior growth zone.

Continuation of lineage analysis (in Figure 4) of Sample A shows that (A) the 8ML cell created during the 8th division gives rise to a few cells near the pPGCs (A’–A’’), where the mesodermal posterior growth zone is located. The 8ML lineage is highlighted in the tree (A’’’). Another sample (Sample B) with different orientation is shown in B-B’’. A subset of 3D-projected focal planes show how the 8ML/8MR lineages are located immediately posterior to the pPGCs (B’, B’’). The same color coding as in Figure 4 is used: Blue is ML lineage, orange is MR, pink is pPGCs, and yellow 8ML. For a comparison of three different samples with 8ML/MR lineages traced see Figure 5—figure supplement 1. See Figure 4—video 14 and Figure 4—video 15 for full time-lapse with spots showing lineages, from posterior and lateral orientations, as well as 360˚ rotation (Figure 4—video 14). All signals from fluorescent constructs is shown in green (EGFP-caax and mVenus-Cdt1(aa1-147), in A’-A’’’) or in grayscale (Histone2A-mCherry, EGFP-caax, and mVenus-Cdt1(aa1-147)) to highlight general morphology.

Figure 5.

Figure 5—figure supplement 1. Cell lineages from additional samples compared with the sample shown in the main text.

Figure 5—figure supplement 1.

For easier comparison, only some cell lineages in ML and MR are highlighted in each sample. Sample A is the one shown in the main text (A). Samples B and C were partially traced for confirming lineages (B, C). In all three samples, 7ml gives rise to mesodermal cells located on the left side of the 2nd larval segment (A’, B’, C’). 7mr was observed to make a symmetric region to 7ml on the right (only analyzed in the third sample (C, C’). Similarly, 8ML and 8MR gave rise to lineages located near pPGCs (in pink), and lineage trees of all three samples for these cells look very similar. Black lines in (A’’, B’’, C’’) indicate the time point shown in snapshots in (A, B, C). These time points were chosen for comparison of each sample at an equivalent time point where both 8ML and 8MR has given rise to 3 cells each, and some of these cells are about to divide. B’ shows nuclei position by spots while B’’ shows cell delineations indicating direct contact between pPGCs and MPGZ cells. All fluorescence signals from Pdu-FUCCI (HistoneH2A-mCherry, mVenus-Cdt1(aa1-147)) and EGFP-caax are shown in grayscale.
Figure 5—video 1. Time-lapse of Sample B.
Download video file (4.7MB, mp4)
DOI: 10.7554/eLife.30463.041
Video shows time-lapse 3D projections of Sample B, imaged every 12 mins for 13 hr. Embryo was injected with Pdu-FUCCI and EGFP-caax mRNA into the D quadrant at four-cell stage.
Figure 5—video 2. Time-lapse of Sample C.
Download video file (4.7MB, mp4)
DOI: 10.7554/eLife.30463.042
Video shows time-lapse 3D projections of Sample C, imaged every 12 mins for 13 hr. Embryo was injected with Pdu-FUCCI and EGFP-caax mRNA into the D quadrant at four-cell stage.

Figure 6. Cell divisions of 4d lineage giving rise to the mesodermal primary blast cells.

Figure 6.

Same dataset shown in Figures 4 and 5 (Sample A) was analyzed for cell division size asymmetry and orientation. In (A), schema shows the 4d lineage divisions, ML in blue. The spot diagrams next to the images show the division by which each primary blast cell is created. The direction of division shown in spot diagrams represents the actual division axis. (B) is a zoomed-in panel from (B’) showing the mesoblasts after two rounds of division (2ML = 4d111, and 2MR = 4d211). The orientation of imaging is depicted in (B’). In (C), fluorescence key shows the color and location of each construct. Throughout D-U (merged channels) and D'-U' (green channel only) snapshots of ML’s divisions from the live imaging dataset are shown, outlined with dashed lines. Note that the initial divisions are highly asymmetric in size (E, G, J, L, S) while the division that creates 7ml and 7ML appears symmetric (O). In V, the division axes for all primary blast cells are shown together. See Figure 3—video 1 for the time-lapse dataset, the snapshots are derived from (Sample A). Arrowheads in (U, U’): pPGCs. Time is shown as elapsed imaging time (Table 1).

Both the asymmetry and orientation of embryonic mesoteloblast divisions gradually change

We analyzed the 4d lineage divisions at single-cell resolution for size asymmetry. The division asymmetry (based on cell size) for 4d’s two daughter cells ML and MR has been previously described using bright-field microscopy only until the seventh division (7ML/R and 7ml/r) conclusively (Fischer and Arendt, 2013), and the divisions after this were not possible to observe due to the limitations of this imaging technique. We took advantage of high-resolution confocal imaging with injection of the fluorescent markers Pdu-FUCCI (nuclear) and EGFP-caax (cell membrane, making the cell size very easy to observe). Here, we show the imaging dataset of an embryo (Sample A, same dataset as reported above) injected into its D quadrant and live-imaged from 8 hpf until larval stages when segmental mesoderm morphology started becoming obvious (Table 1, Figure 3—video 1). In the confocal stacks, we were able to investigate division of 4d lineage further than previously reported, and we analyzed the size asymmetry as well as cell division angle for this lineage.

The first division of 4d is equal, creating two sister mesoblast cells positioned bilaterally symmetrically (ML and MR) (Figure 6A–B, Figure 3—figure supplement 2). However, most of the rest of the divisions were unequal, as expected of teloblasts. The first two divisions of ML and MR, are the most unequal. They gave rise to large daughter cells (1ML, 1MR, 2ML, 2MR) and very small ones (1ml, 1mr, 2ml, 2mr). 1ml/r and 2ml/r are the pPGCs as explained above (Figure 4A–C; Figure 3—figure supplement 2). For the next rounds of divisions, we report the data for ML in detail, but we confirmed MR behaves similarly in two more samples investigated (Figure 5—figure supplement 1, Figure 5—video 1, Figure 5—video 2). After the initial divisions that gave rise to the pPGCs, the mesoblast (now named 2ML) continued to divide, budding off small cells: division of 2ML, 3ML, 4ML, 5ML were all unequal (Figure 6E, G, J and L, respectively). However, the size difference between the two daughter cells progressively decreased. This seemed to be due to the fact that 3ml and 4ml were small precursors compared to the later segmental precursors, 5ml, 6ml (compare Figure 6E and G with 6J and L) but also due to the gradual decrease in size of the remaining M teloblast. Following this tendency, division of 6ML into 7ML and 7ml was roughly equal in size (Figure 6O). We observed that 7ML then divided unequally again, giving rise to 8ML and 8ml (Figure 6S). But, surprisingly this time, the size difference was inverted: 8ml, precursor of the mesoderm of the third segment was the large cell and 8ML, the remaining teloblast cell, was now very small. The further divisions of this remaining teloblast 8ML are essentially equal and give a cluster of quite small cells. Thus, we confirm that 4d lineage shows asymmetric divisions similar to clitellate mesoteloblasts. However, unlike in the leech, in P. dumerilii the mesodermal teloblasts decreased in size very rapidly through this eight-division sequence, and we observed a reversed asymmetry at the end of the sequence. The mesodermal teloblastic lineage (derived from 8ML/MR) that will presumably produce the segments of the juvenile thus starts from a cluster of very small cells.

As observed in previous work (Fischer and Arendt, 2013), the orientation of divisions also sequentially shifted in a clock-wise fashion for the left mesoteloblast divisions (Figure 6E, G, J, L, O and S, summarized in Figure 6V), when looking from the posterior pole. Consequently, whereas the first series of precursors (pPGCs, 3ml, 4ml) were budded off roughly in the direction of the future blastopore, the later segmental precursors (5ml to 8ml) were budded off progressively more towards the anterior of the embryo, also reflecting the gradual change of size of the teloblast cell and its shifting position toward the vegetal pole.

Divisions generating segmental mesoderm precursors happen in quick succession, then cell cycling slows down significantly

We assessed whether the divisions giving rise to segmental precursors follow some kind of ‘segmentation clock’, comparable to the way somites are produced at a regular time interval in vertebrates (Cooke and Zeeman, 1976). This is not the case in P. dumerilii as the time interval increases gradually between divisions. Precisely, at the experimental temperatures 4ML, 5ML, 6ML, 7ML divisions happened in 30, 30, 40, and 50 mins after the preceding division, respectively. Thus, there is no ‘segmentation clock’ but a ‘segmentation oscillator’ of decreasing frequency in the embryo.

We next used the live cell cycle reporter Pdu-FUCCI to compare the cell cycling patterns of some of the different lineages that arise from the 4d micromere. To do this, mean fluorescence intensity information was extracted for each spot from the cell lineage datasets using statistics module in Imaris and these were plotted as graphs (Figure 7A, Figure 7—source data 1). Each spot was manually placed inside each nucleus (Figure 7A’), and mean fluorescence intensity of pixels within each spot was calculated for subsets of lineages (see Materials and methods for details). The measurement reflects the abundance of mVenus-Cdt1(aa1-147) protein, providing quantitation of the cycling of the construct. pPGCs stopped cycling after they were born (Figures 2 and 3; Figure 3—figure supplement 1) and as expected, a roughly linear plot, without significant valleys and peaks was obtained for these cells (Figure 7B). The mesoblast ML, in contrast, had clear cycling with prominent valleys and peaks (Figure 7B, Figure 7—figure supplement 1A). Next, we selected a sub-lineage within primary blast lineages 7ml, and 8ml, as well as a sub-lineage within 8ML for analyzing cell cycling patterns. In segmental mesoderm lineages within 7ml and 8ml, we selected ‘equivalent’ sub-lineages based on the location of daughter cells as the primary blast cell divided (see Materials and methods for details of the lineage selection criteria). The comparison of 7ml sub-lineage to 8ml sub-lineage revealed that initially these two are out of phase (valleys and peaks do not overlap) even though cycling periodicity is similar. However, by time point 46 they become synchronized as shown by the overlapping graphs (Figure 7C). On the other hand, 8ml and 8ML sub-lineages differ from each other drastically: 8ML has much fewer valleys and peaks (Figure 7D, Figure 7—figure supplement 2A–E, Figure 7—figure supplement 1C), indicating slower cell cycling compared to 8ml (Figure 7D, Figure 7—figure supplement 2F–J, Figure 7—figure supplement 1B). We have also confirmed that the cycling patterns are similar in different samples and in the right mesoblast (Figure 7—figure supplement 2). Overall, these data show that live cell cycle reporter Pdu-FUCCI is a useful tool for revealing changing cycling signatures within lineages and across lineages. This tool can be used for similar purposes in other developmental processes and stages.

Figure 7. Comparison of mVenus-Cdt1(aa1-147) intensity across different cell lineages.

(A) The lineages selected for cell cycle signature analysis are indicated in color (matching the colors used in the subsequent graphs). (A’) Example of a spot placed in the middle of the nuclear signal (only one focal plane from the stack shown here), and used for obtaining ‘mVenus fluorescence intensity mean’ measurements for each nucleus per time point in Imaris. (B) Comparison of mVenus intensity across 3 cell lineages. 8ml (light blue) is plotted as a continuation of the mesoblast ML (dark blue). Star indicates the time point 7ML divides into 8ml and 8ML in the lineage tree (A) and the cell cycle graph (B). (C) Two lineages from 7ml and 8ml show similar cycling patterns. Despite being slightly out of phase at the beginning, they become synchronized around time point 46. (D) Same 8ml lineage is compared this time with a lineage from 8ML, which is the lineage that gives rise to the mesodermal posterior growth zone cells, and is much slower in its cycling. In B and D, the dashed boxes show the excerpts from the graphs analyzed in Figure 7—figure supplement 1. Time axis shows time points (Table 1). Fluorescence measurement is in arbitrary units (Figure 7—source data 1).

Figure 7—source data 1.
DOI: 10.7554/eLife.30463.047

Figure 7.

Figure 7—figure supplement 1. Details from the cell cycle graphs.

Figure 7—figure supplement 1.

Excerpts from the cell cycle graphs presented in Figure 7 are shown here with snapshots of the cell nuclei corresponding to the time points on the graphs (indicated as matching numbers on the graphs and above the images). The cartoons above cell snapshots show simplified versions of those cells, with nuclei color matching the fluorescent signal. Red: mCherry only; Yellow: mCherry + mVenus; Orange: mCherry + lower mVenus. Dots in C indicate time points not shown here. M: Mitosis, G1: Gap phase 1, S: Synthesis, G2: Gap phase 2. Fluorescent protein colors are indicated in the ‘Fluorescence Key’ box.
Figure 7—figure supplement 2. Cell cycle graphs compared across different live-imaged samples.

Figure 7—figure supplement 2.

Sample A is the sample shown in the main figures in the manuscript. Cell cycle graphs obtained from the same cell lineages from two additional time-lapse samples (Samples B and C) are compared with Sample A. The volume of mRNA injected in each sample slightly differs leading to differences in the measured intensity of fluorescence. For easier comparison, data were normalized by finding the maximum for each series, dividing all time points by the maximum, and multiplying by 100. The same letter codes are used for the samples as in Figure 5—figure supplement 1. Cell lineages show very similar cycling patterns in all samples (A-E show 8ML and 8MR from different samples; (F–J) show ML +8ml from different samples) (Figure 7—source data 1).

Discussion

Here we report techniques for long-term live imaging of P. dumerilii embryos and larvae, and demonstrate the feasibility of a FUCCI live-cell cycle reporter in this species. Using these techniques and tools, we reveal previously unknown characteristics of the development of this marine annelid, in particular the fact that the daughters of the blastomere 4d (ML and MR) produce the trunk mesoderm by teloblastic divisions, as in clitellate annelids. Starting with the fifth division, each division of this pair of cells gives rise to the mesoderm of one segment. ML and MR also give rise, by their two first divisions, to the putative Primordial Germ Cells (pPGCs), and starting with the eighth round of division, to the mesodermal posterior growth zone (MPGZ), which is part of the segment addition zone (SAZ). Interestingly, the different cell types that originate from 4d (segmental mesoderm cells, posterior growth zone cells, and germ cells) show distinct cell cycle characteristics.

Live imaging the 4d (M) lineage in P. dumerilii with a live-cell cycle reporter

Long-term imaging at single-cell resolution for lineage analyses has been technically challenging in most spiralians including annelids. The micromere lineages (such as 4d) are small and very difficult to label individually in non-clitellate annelids (i.e. non-clitellate Sedentaria, Errantia, and basal annelids) (Irvine and Seaver, 2006), as opposed to the leech and the sludge worm Tubifex (both clitellates), which have larger and accessible embryos that enable injecting single blastomeres to follow specific lineages (Gline et al., 2011, Gline et al., 2009; Goto et al., 1999a, 1999b; Storey, 1989; Weisblat and Shankland, 1985). Despite the difficulty of injections, cell lineage analyses have been carried out nevertheless. Some of the studies used DiI injections for labeling specific blastomeres and analyzing the domains they gave rise to in fixed samples, in which case there is no continuous observation by time-lapse imaging, thus no resolution at individual cell-level (Ackermann et al., 2005; Irvine and Seaver, 2006). Other studies used bright-field microscopy for live observations, but only earlier stages of development could be analyzed as cell sizes become too small at later stages to confidently follow without any labeling, and/or the larvae start moving due to ciliary band formation (Fischer and Arendt, 2013; Wilson, 1892 in two other nereidids, Nereis limbata and Platynereis megalops). As a result, behavior of specific lineages with detailed cell cycling characteristics at single-cell resolution could not be observed, and whether the lineages showed teloblastic activity in non-clitellate annelids could not be directly observed. Taking advantage of injecting mRNAs coding for fluorescently labeled proteins, confocal imaging, and specimen immobilization, we were able to live-image the 4d lineage until late trochophore stages (summarized in Figure 8) and analyzed its cell cycling patterns. Overcoming the long-standing challenge of immobilization of the trochophore larvae was particularly significant, because the larvae start spinning from 15 hpf and later actively swim via several ciliary bands. Thus, live imaging for extended time periods to follow cell lineages has not been possible. Our DMSO treatment method (Materials and methods) for cilia elimination can be potentially applied to other marine ciliated larvae as well as freshwater ciliates (Balavoine, Özpolat, Duharcourt, unpublished results).

Figure 8. ML lineage tree indicating known and novel sub-lineages in P. dumerilii, and comparison of P. dumerilii with the leech.

Figure 8.

Lineage tree of cells that arise from the left mesoblast (ML) traced in Imaris is plotted in A. Colors show the extent of lineage analyses accomplished in earlier studies. The same lineage tree is shown in A’ with color-coded sub-lineages for each primary blast cell, pPGCs, and 8ML. The same color codes are used in the Platynereis larva cartoon in B. On the left in B, 4d lineage diagram is shown with primary blast cells labeled with the mesodermal region they contribute to. Note how the cells from the first two divisions of ML (pPGCs) end up next to the cells in the mesodermal posterior growth zone (MPGZ), which are born much later. For comparison, 4d (DM’’) lineage diagram and primary blast cell lineages (again color-coded) are shown in C for the leech (a clitellate annelid) (Cho et al., 2014; Gline et al., 2011; Rebscher, 2014). The first six divisions of ML make cells that contribute to non-segmental mesoderm in anterior regions and the gut (both in dark gray). The following divisions make segmental primary blast cells, each or which contributes to the mesoderm of two consecutive hemisegments (for example, sm1 contributes to part of first segment and part of second segment mesoderm, in total making one segment-worth of mesoderm). Note that in the leech, PGCs (pink) arise in later cell divisions, as a subset within the segmental mesoderm population that originate from a primary blast cell (sm10, and sm12 through 22).

We generated a live-cell cycle reporter in P. dumerilii, using the gene Pdu-cdt1 (Figure 1). Cdt1 cell cycle component in mammal and zebrafish FUCCI (fluorescent ubiquitination-based cell cycle indicator) is restricted to the G1 phase (Sakaue-Sawano et al., 2008; Sugiyama et al., 2009). Our reporter mVenus-Cdt1(aa1-147) is not specific to G1, but it was sufficient to observe cell cycling patterns, therefore is a useful tool to study cell lineages and cell cycle dynamics during development of P. dumerilii. To our knowledge, this is the first live-cell cycle reporter available in a spiralian model system. Studies are in progress to develop reporters for other phases of cell cycle in P. dumerilii, as well as transgenic lines containing one or more of the live cell cycle constructs.

Cell cycle patterns of the 4d lineage

4d is a conserved blastomere across many spiralian organisms with diverse body plans (Lambert, 2008; Lyons et al., 2012). However, only limited data are available on detailed 4d lineage/fate maps, cell cycle characteristics, and how cell cycle regulation is related to different cell types ‘4d program’ generates (Bissen, 1997, 1995; Bissen and Weisblat, 1989; Chen and Bissen, 1997). In P. dumerilii, 4d generates differentially fated cell populations, which then display different cycling characteristics. pPGCs (the first lineages to segregate from 4d) are mitotically quiescent and presumably do not divide until later in development. However, lineages that arise right after pPGCs, the precursors of mesoderm, show diverse cell cycling patterns (Figure 7). For example, we found early cycles of ML/R to be very short in P. dumerilii (Figure 7—figure supplement 1A). Then cell cycle becomes slightly longer within mesodermal lineages with relatively extended G2 phase. These findings in P. dumerilii are reminiscent of the leech, in which, early ML/R divisions have short cell cycle durations due to absence of G1 and a very short G2 phase. Later cycles in the leech teloblasts become longer due to an increase in the G2 phase length, and appearance of G1 phase (Bissen and Weisblat, 1989).

In stark contrast to the fast cycling lineages of the trunk mesoderm (3ml/r-8ml/r), precursors of the MPGZ (8ML/R) are a slow cycling lineage which has relatively short G1 and long G2 phases (Figure 7—figure supplement 1C). These cells resemble stem cells in other organisms (such as hydra, mammals, Drosophila, and C. elegans) because of their slow cycling as well as having short G1 and longer G2 phase (Ables and Drummond-Barbosa, 2013; Buzgariu et al., 2014; Hsu et al., 2008; Roccio et al., 2013; Seidel and Kimble, 2015). How will the cycling characteristics of the growth zone cells change with slow or fast growth (for example, based on nutrient availability), or in response to injury (for example, during segment addition in the regenerated tail, which grows faster) remains to be determined.

The first lineage segregated from 4d: putative primordial germ cells

In organisms where germline specification takes place early during development, the PGCs are segregated before gastrulation (Extavour and Akam, 2003). This also appears to be the case in P. dumerilii. We confirmed the earlier observations (Fischer and Arendt, 2013; Rebscher et al., 2012, Rebscher et al., 2007) that suggested that four putative PGCs (pPGCs; 1ml/r and 2ml/r cells) arise from the first two divisions of 4d’s daughters, ML/R. Our and previous observations suggest these cells make only pPGCs (Ackermann et al., 2005; Rebscher et al., 2012; Rebscher et al., 2007), thus pPGCs are made separately from the segmental mesoderm lineages which arise during the subsequent divisions. Here, we refer to these cells as ‘putative’ PGCs because a continuous lineage tracing (or genetic lineage tracing) by following these progenitors into adulthood when they would form the gametes has not been carried out. However, these cells fit the PGC criteria used in other model systems: they express germline/multipotency program (GMP) genes (Juliano et al., 2010) and Vasa protein, at day 4 of development they migrate anteriorly (Rebscher et al., 2012; Rebscher et al., 2007), they are mitotically quiescent (Figures 2 and 3) but after migration they start proliferating to make future gametes (Rebscher, 2014). However, considering that some annelids can regenerate their germline (Herlant-Meewis, 1946; Özpolat et al., 2016; Özpolat et al., 2016; Stéphan-Dubois, 1964), these PGCs set aside early in development in P. dumerilii may not be the only source of the germ cells in this species. In particular, the ectodermal and mesodermal cells that constitute the SAZ of the juvenile worm persistently express the GMP genes such as vasa, piwi or nanos (Gazave et al., 2013; Rebscher et al., 2007). It is currently not known whether the GMP is shared between these apparently different sets of cells because the program is crucial for multipotency, or whether the GMP expression in SAZ, and growth zone cells in general, reflects a persistent ability of these cells to produce germline cells. A similar situation has been described in planarians, where both the neoblast cells (the planarian stem cells) and the germ cells express piwi (Handberg-Thorsager, 2008; Nakagawa et al., 2012). In planarians, the neoblasts give rise to the germ cells (Morgan, 1901; Newmark et al., 2008; Solana, 2013). Only further investigation involving genetic cell tracing or cell ablation will establish whether P. dumerilii can produce (or regenerate) germline cells independently of the pPGCs discussed in this work.

4d lineage gives rise to the PGCs in other annelid species as well (Rebscher, 2014), but with some differences: in contrast to P. dumerilii, which segregates its pPGCs during the first two divisions of 4d (Figure 8B), PGCs arise much later from within the segmental mesoderm lineage in clitellates studied so far, as opposed to being set aside during the earlier divisions of ML/R. For example, in the leech, blast cells 16ml/r and 18 to 23ml/r (or sm10 and sm12-22 in the leech nomenclature) give rise to both segmental mesoderm and the PGCs within the associated segments (Cho et al., 2014; Kang et al., 2002) (Figure 8C). Cells produced by the first six divisions of 4d’s daughters contribute mostly to gut endoderm, to head and pharynx musculature, but not to the germline. Likewise, in Tubifex, PGCs originate from within the progeny of 10ml/r and 11ml/r (Kitamura and Shimizu, 2000; Niwa et al., 2013; Oyama and Shimizu, 2007). In other spiralians such as mollusks, pPGCs are segregated from the 4d lineage during relatively early divisions (Rebscher, 2014), for example 2ml/r in the slipper snail (Lyons et al., 2012). However, the lineage that generates the pPGCs in the slipper snail also gives rise to mesodermal cell types. At the metazoan-wide level, it has been suggested that late epigenetic specification inside trunk mesoderm is the ancestral process and that early specification, often linked to the existence of a ‘germ plasm’, has evolved independently multiple times in metazoans (Extavour and Akam, 2003). What role these different segregation and specification patterns play, and whether they have implications in the ability to regenerate germ cells at later stages of development and in adulthood in a given species need to be further investigated.

Formation of segmental and growth zone mesoderm in P. dumerilii

We have established, for the first time, the early pattern of segmental mesoderm formation in P. dumerilii (Figure 4, and Figure 8 for summary). We found that during embryogenesis, segmental precursor cell segregation is similar to that in the leech or other clitellate embryogeneses. One important difference is that, only four segments (one anterior ‘cryptic’ segment and three bristle-bearing larval trunk segments) are formed during P. dumerilii embryonic/larval development. This is in sharp contrast to the 32 segments formed during leech embryogenesis and to the numerous segments formed in the other non-leech clitellates (Anderson, 1973a; Balavoine, 2014; Goto et al., 1999b; Weisblat and Shankland, 1985; Zackson, 1982). Nevertheless, as in clitellates, pairs of mesodermal precursors (called primary blast cells (PBCs)) are sequentially produced in an anterior to posterior progression, and correspond to a mesodermal segment of the larva. The segregation of the series of segmental PBCs in P. dumerilii (from 5ml/r to 8ml/r) is preceded by two pairs of precursors (3ml/r and 4ml/r) that divided only a few times during our analysis and probably contribute to the head mesoderm. These two pairs of anterior head mesoderm precursors may be related to the six pairs of em precursors known in the leech that contribute to endoderm and pharynx musculature (Figure 8C) (Gline et al., 2011).

We were not able to determine the precise tissue-type contribution of each mesodermal PBC because our lineage analysis ends at the beginning of late trochophore stage, before cell differentiation takes place. Additional imaging that extends further in development suggests that segmental blocks of mesodermal cells contributed mostly to a single hemisegment (Figure 4—figure supplement 3, Figure 4—video 17). However, we cannot exclude the possibility that each clonal block will eventually contribute complementary sets of different tissue types to two or more contiguous segments in the juveniles, as they do in the leech. Future studies will also determine whether these precursors give rise to a few neuronal cells (as in the clitellates), as well as other tissues such as the gut endoderm, and possibly pygidium (the non-segmental posterior end) as it has been previously suggested (Starunov et al., 2015).

Another important difference between P. dumerilii and clitellate annelids resides in the size of the mesodermal teloblasts and their evolution through embryogenesis. In the leech and other clitellates, M teloblasts are huge cells that undergo a long series of very asymmetric divisions, budding off a series of much smaller mesodermal PBCs, before they become ‘exhausted’ in terms of cytoplasmic volume after they produce the most posterior segments (Shimizu, 1982; Weisblat and Kuo, 2014). In P. dumerilii, correlating with the small number of segments produced during embryogenesis, M teloblasts are born with a medium size and appear to get quickly ‘exhausted’ through a short series of asymmetric divisions (Figure 6). It will be interesting to find out in the future, whether such M teloblasts exists in non-clitellate annelids that form more segments during the embryonic/larval stage, such as Capitella which forms 13 larval segments (Balavoine, 2014; Seaver, 2016), and whether teloblast size evolved in proportion to the number of larval segments (Figure 9, also see discussion below).

Figure 9. Phylogenetic distribution of embryonic and post-embryonic teloblasts in some annelids, and the relation to the number of segments made.

Figure 9.

A simplified annelid phylogeny (Weigert and Bleidorn, 2016) summarizes the main annelid species investigated for segment formation and teloblasts. The number of segments appearing during the pelagic larval phase (but patterned during embryogenesis) and the number of segments added posteriorly after the start of benthic life can vary considerably (Balavoine, 2014). In leeches, a fixed number of segments is made during direct embryonic development and none added after hatching. In non-leech clitellates (such as Tubifex), the embryos make a few tens of segments during embryogenesis and add many more after hatching. In non-clitellate annelids (Errantia, Sedentaria, and early branching), the number of larval segments is variable, and many more are added in post-larval development: In Nereidids (Errantia) such as Platynereis, only three larval segments develop, while in Capitella (Sedentaria), 13 larval segments (Thamm and Seaver, 2008) and in Chaetopterus (an early-branching annelid) 15 larval segments develop (Seaver et al., 2001). Embryonic and post-embryonic teloblasts differ in the way they have been evidenced. Embryonic teloblasts in the Clitellates (Weisblat and Kuo, 2014; Goto et al., 1999a; Nakamoto et al., 2011) and in Platynereis (this work) have been directly observed in live specimens. By contrast, post-embryonic teloblasts are inconspicuous cells that are identified only so far by their molecular stem cell signature (Gazave et al., 2013; Dill and Seaver, 2008; Özpolat et al., 2016). No direct observation of post-embryonic teloblast patterns of division is available so far. No direct evidence for embryonic teloblasts giving birth to post-embryonic teloblasts exists in any species so far to our knowledge. The ancestor of annelids presumably had both larval and post-larval segments, and thus it raises the question of the presence of both embryonic and post-embryonic teloblasts in this ancestral annelid, and even more broadly in other spiralians such as chitons (a type of segmented mollusk). Structures shown in the figure are color coded and explained in the ‘symbol key’.

We also found that after the progenitors of the four mesodermal segments have been produced, the remaining M teloblast cells in P. dumerilii gave rise to the precursors of mesodermal posterior growth zone (MPGZ), which is the likely source of the mesodermal component of the Segment Addition Zone (SAZ). Most annelids (but not leeches) continue growing from their posterior end by adding new segments throughout their lives (Özpolat et al., 2016) (Figure 9). The new tissues that form new segments originate from the SAZ which is a specific ring of small cells (presumably teloblast-like) within the posterior growth zone, and has mesodermal and ectodermal components (Balavoine, 2014). The SAZ expresses many Germline/Multipotency markers (Gazave et al., 2013; Juliano et al., 2010; Özpolat et al., 2016, Özpolat et al., 2015). Much is still unknown about the exact embryonic origins of the SAZ in annelids. Studies using bright-field microscopy, and DiI injections suggested that the mesodermal SAZ originates from the 4d blastomeres (Ackermann et al., 2005; Anderson, 1973b; Rebscher et al., 2007), but which cells within the 4d lineage make up the growth zone has not been identified to date. Our work successfully identifies 8ML/MR as the origin of the mesodermal SAZ in the larva. A slowly cycling small cluster of cells are made by 8ML/MR, located immediately anterior to the pPGCs, consistent with the previous studies that described this region as the Vasa(+) ‘mesodermal posterior growth zone’ (MPGZ) (Rebscher et al., 2012, Rebscher et al., 2007). Our imaging dataset is only until mid-/late-trochophore stage, thus we do not know whether all or a subset of these cells will produce the mesodermal SAZ in the later larval stages and juveniles. Thus, how these precursors go onto form the ring-like mesodermal SAZ and how they contribute to new tissues in juvenile worms remain to be determined.

This study in P. dumerilii helps putting different types of development in the annelids into a phylogenetic perspective (Figure 9). In the leeches, the totality of a species-specific number of segments are made during embryogenesis through the activity of large embryonic teloblasts. In contrast, in most marine annelids, the majority of segments are made during post-embryonic juvenile development, through the activity of inconspicuous posterior stem cells whose characteristics are still largely unknown. Earlier works in P. dumerilii (de Rosa et al., 2005; Gazave et al., 2013) have suggested that posterior stem cells in the juvenile may have a teloblast-like activity. We establish in this article that the mesodermal teloblasts which are very similar to the leech are indeed at play in the P. dumerilii embryo, contributing to the formation of the three larval segments. We also show that these embryonic teloblasts are most likely at the origin of the teloblast-like posterior stem cells of the juvenile (post-embryonic teloblasts), thus possibly establishing a cellular continuity in segment formation in P. dumerilii. In addition, it will be useful to determine if embryonic ectodermal teloblasts exist in P. dumerilii and whether they are at the origin of the ectodermal posterior stem cells as well. It is very likely that the ancestral life cycle in annelids involved these two phases of segment formation (embryonic/larval and post-embryonic) (Figure 9). The large teloblasts of Clitellate embryos would have evolved in the context of an acceleration of development, most or all segment formation happening in the embryonic stage (Balavoine, 2014). Meanwhile, parallels among all spiralians remain to be determined. It is legitimate to wonder whether embryonic teloblasts are present in mollusks having a form of mesodermal segmentation such as chitons or aplacophorans (Scherholz et al., 2015), or whether post-embryonic teloblasts are present in other posteriorly growing phyla, such as nemerteans. Future studies using high-resolution live imaging and genetic lineage-tracing methods on these exciting but understudied spiralian groups, as well as additional studies in the annelids will help answer the open questions surrounding teloblasts and their involvement in the evolution of different body plans.

Materials and methods

Key resources table.

Reagent type (species)
or resource
Designation Source or reference Identifiers Additional information
Gene (Platynereis dumerilii) Pdu-cdt1 NA GenBank No: MF614951 From the full 2337 bp coding sequence, a 1946 bp part including the start site, and ending before the stop codon was amplified
Strain, strain background (P. dumerilii) Wild Type Institut Jacques Monod cultures
Recombinant DNA reagent pCS2+ mVenus-cdt1(aa1-147) this paper GenBank No: MF614950
Recombinant DNA reagent pEXPTol2-H2A-mCherry Other Plasmid was not specifically produced for this paper, and has been published before. The source plasmids used for the constructions of this plasmid was provided by Caren Norden Lab (MPI-CBG, Dresden, Germany).
Recombinant DNA reagent pEXPTol2-EGFP-CAAX Other Plasmid was not specifically produced for this paper, and has been published before. The source plasmids used for the constructions of this plasmid was provided by Caren Norden Lab (MPI-CBG, Dresden, Germany).
Antibody Acetylated-tubulin Sigma-Aldrich T7451, RRID:AB_609894 (1:500)
Sequence-based reagent Pdu-cdt1- Forward Primer this paper TTGTTTTCTTGTTGAGGTGGGATG
Sequence-based reagent Pdu-cdt1- Reverse Primer this paper GGAGATGACGAGACAGGCAG
Sequence-based reagent pCS2+ vector backbone – Forward Primer this paper CTAGAACTATAGTGTGTTGTATTACGT
Sequence-based reagent pCS2+ vector backbone – Reverse Primer this paper AGAGGCCTTGAATTCGAATCG
Commercial assay or kit Gibson assembly master mix NEB France E2611S
Commercial assay or kit Click-iT EdU Alexa Fluor 647 Imaging Kit Life Technologies C10340
Commercial assay or kit SP6 mMessage kit Ambion, ThermoFisher AM1340
Commercial assay or kit MEGAclear kit Ambion, ThermoFisher AM1908 RNA elution option two with the modifications - see Materials and methods for details
Commercial assay or kit Proteinase K Ambion, ThermoFisher AM2548 20 µg/µl final concentration
Software, algorithm Bitplane Imaris (Version 8.2)
Software, algorithm Onionizer https://figshare.com/s/1c0dcd120d13deb888ba

Animal cultures and staging

Platynereis dumerilii embryos were obtained from lab cultures at the Institut Jacques Monod. Cultures are reared based on previous protocols (Dorresteijn et al., 1993) (available in English by Fischer and Dorresteijn on www.platynereis.de). Embryos and larvae are staged after Fischer et al., 2010. All staging is made at 18°C unless otherwise stated. For live time-lapse imaging, the imaging temperatures were typically higher (estimated 26–28°C). We provide a table with calculated developmental times and stages corresponding to each time point (Table 1).

Gene cloning

Pdu-cdt1 coding sequence was obtained from transcriptome databases by the Jékely and Arendt Labs (jekely-lab.tuebingen.mpg.de/blast; 4dx.embl.de/platy). An amino acid alignment against several species was carried out to confirm the sequence (MUSCLE alignment in GENEIOUS 6.1.8). From the full 2337 bp coding sequence, a 1946 bp part including the start site, and ending before the stop codon was amplified (Pdu-cdt1- Forward Primer: TTGTTTTCTTGTTGAGGTGGGATG; Reverse Primer: GGAGATGACGAGACAGGCAG). The PCR fragment was gel purified, cloned into TOPO-TA pCRII plasmid, and sequenced (GenBank No: MF614951).

Construction of nuclear, membrane, and cell cycle constructs

Nuclear and membrane constructs

We created the expression constructs pEXPTol2-EGFP-CAAX and pEXPTol2-H2A-mCherry by LR Recombination Reaction according to the manufacturer’s instructions (Gateway Technology, Invitrogen,Carlsbad, CA). The individual plasmids used were the entry plasmids pENTR- p5E-CMV-SP6, pENTR-pME- EGFP-CAAX and pENTR-p3E-polyA or pENTR- p5E-CMV-SP6, pENTR-pME-H2A-mCherry, and pENTR-p3E-polyA and the destination plasmid pDestTol2pA2 (Kwan et al., 2007).

Cell cycle construct

Using an alignment of P. dumerilii Cdt1 (Pdu-cdt1) with vertebrate Cdt1 amino acid sequences, we sub-cloned a C-terminal truncation of Cdt1 that is comparable to FUCCI constructs made by others previously (Sakaue-Sawano et al., 2008; Sugiyama et al., 2009), including the PIP degron, excluding Cdt1-Geminin interaction site and Cdt1-MCM2-7-binding site (Figure 1A). The truncated Pdu-cdt1 sequence was placed at the 3’ end of mVenus fluorescent protein. To ensure the stability of expressed or injected mRNA for the fused mVenus-cdt1(aa1-147) construct, we added a KOZAK sequence immediately upstream to the start codon of mVenus. The conserved ‘CACC’ KOZAK sequence from H. sapiens was used, because we could not determine a consensus sequence for P. dumerilii. Finally, several STOP codon sequences were added to the 3’ end of the construct. This KOZAK-mVenus-cdt1(aa1-147) sequence was synthetized by a provider (IDTDNA gBlocks, Belgium). The synthetized fragment (200 ng) was resuspended in 20 µl nuclease-free water to a final concentration of 10 ng/µl, and it was cloned using Gibson reaction into pCS2+ expression vector which was amplified via PCR (pCS2+ vector backbone – Forward Primer: CTAGAACTATAGTGTGTTGTATTACGT; Reverse Primer: AGAGGCCTTGAATTCGAATCG) (GenBank No: MF614950). For the Gibson reaction, Gibson assembly master mix (NEB, France, E2611S) and NEB 5-alpha Competent E. coli (NEB C2987H) were used, following the manufacturer’s protocol.

In vitro transcription of mRNA for microinjections

To express constructs in P. dumerilii embryos, we injected in vitro-transcribed mRNA into fertilized oocytes. To prepare the mRNA, each vector was linearized, gel-purified, and used for the in vitro transcription reaction (HistoneH2A-mCherry: BglII/SP6; EGFP-caax: ClaI/SP6; mVenus-cdt1(aa1-147): Not-I/SP6). For in vitro transcription, SP6 mMessage kit from Ambion (AM1340) was used, and the manufacturer’s protocol was followed until the end of DNase step (1 µl DNase 15 mins at 37˚C). For purification of mRNA, MEGAclear kit from Ambion (AM1908) was used, following RNA elution option two with the following modifications: elution buffer was heated to 72˚C, this warmed elution buffer was applied to filter cartridge containing mRNA, the tubes were kept at 72˚C heated plate for 5 min before centrifuging for elution.

Embryo preparation and microinjections

For preparing the embryos for microinjections, fertilized embryos were dejellied and their cuticle was softened via enzymatic degradation. To do this, fertilized embryos were transferred to a nylon 80 µm-mesh at about 1 hr-post-fertilization (hpf), washed 10 times using filtered natural sea water to remove the jelly secretion, treated with 20 µg/µl Proteinase K (Ambion, AM2548) in 30 mL seawater for 1 min, then washed again 10 times, and transferred to a six-well plate.

For microinjections, an agarose injection platform (made of 1.5% agarose in filtered natural sea water) was prepared (Lauri et al., 2014) (Figure 10A–A’’’). Injection solutions were prepared using the following final concentrations: mVenus-cdt1(aa1-147) – 25 ng/µl, HistoneH2A-mCherry – 75 ng/µl, EGFP-caax – 75 ng/µl, 0.07% phenol red (Sigma-Aldrich, St. Louis, MO, P0290, 0.5% stock). Microinjections were carried out using an inverted Zeiss Axiovert 135 scope, Eppendorf Femtojet 4i, and Eppendorf Transferman Micromanipulator (Figure 10A). Micro injection needle (Sterile Eppendorf Femtotips II (930000043) was angled at about 15–20 degrees (Figure 10A’), and was connected to an Eppendorf universal capillary holder (920-00-739-2) with adapter (no: 5) for Femtotips. Femtojet pressure settings varied depending on the needle opening size, approximately in the following ranges: pi[hPa]=200–300 psi; pc[hPa]=30–300 psi; ti = 1–4 s (pi: injection pressure, pc: back pressure, ti: injection time). Embryos were injected at one-cell stage, two-cell stage (into CD half), and four-cell stage (into D quadrant). Injected embryos were transferred back to the six-well plate and were kept at 18˚C incubator until mounting.

Figure 10. Injection setup and general experimental outline for imaging samples.

(A) A Zeiss inverted scope with a gliding stage, coupled with the Eppendorf Femtojet microinjector and Eppendorf Transferman micromanipulation system were used for injections. Femtotip ready-to-use injection needles were back-filled with injection solution (A’). An agarose platform (A’’) with a groove large enough to contain embryos was prepared using a plastic custom-made mold. Under a dissecting scope, small incisions were made to the right side of the groove (A’’’), and these incisions were used to remove embryos from the needle by sliding the needle through them. The agarose platform was placed into a small petri dish lid and covered with filtered sea water before the embryos were transferred into the dish. In B and C, the steps of general experimental outline for live imaging samples at different stages are listed.

Figure 10.

Figure 10—figure supplement 1. Heating plate setup for mounting samples in glass-bottom dishes.

Figure 10—figure supplement 1.

A) One of the heating blocks was turned upside down to use its flat surface, and was painted with black marker to provide contrasting background for mounting samples. The heating plate was placed under a stereoscope. Temperature was set to 37˚C. B) Glass-bottom dishes were pre-warmed on this surface. One injected sample was placed on the dish with as little sea water as possible. Next, a drop of 100 µl of 1% low-melting agarose was added on, and before the agarose started solidifying, the sample was rotated to the desired position with the help of an eyelash tool. If needed, more agarose was slowly added with the help of a micropipette to cover the glass surface completely. Then the plate was transferred on a colder surface to let agarose solidify. Once agarose solidified (in about 3–5 min), filtered natural sea water was added on top to cover the agarose, and the dishes were covered with the lid and kept at 18˚C incubator, in a wet chamber, until imaging.

Mounting samples for imaging

For all mounts, we used glass-bottom dishes (MatTek Corporation 35 mm dish, P35G-0–10 C), as this method enabled keeping embryos and larvae in sea water which could be easily renewed if desired. As a result, samples were healthy after mounting during extended periods of imaging, and even after imaging they continued to grow in the agarose. Mounting was carried out on a warm plate to keep low-melting agarose from solidifying while allowing enough time for rotating the samples to the desired position using an eyelash tool (Figure 10—figure supplement 1). Low melting agarose (Invitrogen, France, 16520050) was prepared as 1% solution in filtered natural sea water by microwaving, and 500 µl aliquots were kept in −20˚C until use. These tubes were thawed in a water bath at 65˚C right before mounting, and kept in dry heating block at 37˚C once thawed.

Injected embryos and larvae can be checked for normal development based on a number of criteria observed at different stages of development. For injected embryos to be imaged early (around 7–8 hpf at 18°C developmental time), we identified those injected samples without any visible deformations, clear animal-vegetal polarization, and four oil droplets with typical appearance at this stage (Fischer et al., 2010). For samples to be imaged after ciliary band development (15 hpf or later, at 18°C developmental time), we looked for normal ciliary bands, normal swimming behavior, chaetal sacs with developing bristles, and larval eyes. We picked healthy samples based on these criteria, as well as the samples with optimal fluorescence signal strength (which varies based on the amount of mRNA injected), and appropriate angle for mesoderm imaging after mounting.

Depending on the developmental stage to be imaged, samples had to be mounted before or after the ciliary band formation and the start of swimming movements. Mounting embryos or larvae with functional cilia will result in the specimens rotating in their agarose spherical lodge. For stages after the cilia form, immobilization requires deciliation at the time of mounting. We thus carried out imaging for both pre-hatching (embryonic and pre-larval) and post-hatching (larval) stages using two different techniques:

Mounting technique 1 - Mounting before ciliary band formation (Figure 10B)

Cilia do not appear before 15 hpf (18°C). We observed that specimens mounted in low-melting agarose before 15 hpf (usually around 5–6 hpf) usually will not move even after the ciliary bands develop, because the growing cilia are impaired by the agarose covering. These specimens were simply placed onto the glass coverslip, excess sea water was removed, and low-melting agarose was added to cover the sample.

Mounting technique 2 – Mounting after ciliary bands are formed (Figure 10C)

If specimens are to be imaged after the ciliary band formation, we found that incubating the larvae for 10 min in a small volume of 10% DMSO/90% seawater, followed by sudden flushing with fresh seawater caused clumping and breakage of the cilia, thus immobilizing the specimens temporarily. Embryos and larvae can then be mounted in low-melting agarose in the next ten minutes before the cilia start to grow back. These DMSO-treated larvae recover completely and grow without abnormalities. Mounting injected samples during larval stages may be desirable when a specific and precise orientation of the sample is required starting at a specific stage.

EdU cell proliferation analysis and immunohistochemistry

EdU assay on injected samples

Embryos were injected at one-, two-, or four-cell stage with HistoneH2A-mCherry and mVenus-cdt1(aa1-147) solution mix, and were raised until 12 hpf. At 12 hpf, they were treated with 5 µM EdU in natural sea water for 3 min, rinsed quickly and fixed in 4% PFA for 1 hr. After fixation, they were washed in 1X PBS a few times and were processed for the EdU reaction next day, using the Click-iT EdU Alexa Fluor 647 Imaging Kit (Life Technologies, C10340) kit following the manufacturer’s protocol, except EdU reaction was carried out for 45 min.

EdU assay and Immunohistochemistry

These experiments were done according to previously-published protocols (Asadulina et al., 2012; Gazave et al., 2013). For EdU assays, embryos or larvae were incubated in EdU (incubation conditions same as above) for the desired time period. Then EdU solution was washed by transferring the samples several times through sea water. The samples were incubated to grow until the desired stage and fixed in 4% PFA for 2 hr. The fixed samples were either processed just for EdU reaction, or additional immunohistochemistry was carried out (primary antibody: Acetylated-tubulin (1:500) (Sigma-Aldrich, T7451), secondary antibody: anti-mouse Alexa Fluor 488 (Molecular Probes, Life Technologies, Eugene, OR, 44408S), and DAPI (1:1000 from stock concentration of 1 mg/ml, overnight). EdU reaction was developed on the final day of immunohistochemistry protocol.

Imaging

Immunohistochemistry and EdU reaction samples were mounted in 33% TDE (Asadulina et al., 2012) using standard slides and coverslips, and were imaged using a Zeiss LSM710 confocal scope. For the injected samples treated with EdU, endogenous mCherry and mVenus signals (expressed from the injected mRNA) are detectable in ‘quick-fixed’ specimens (see above), thus precluding the need for antibody detection.

For live imaging, a Zeiss LSM780 confocal scope was used. In the samples coinjected with both nuclear and membrane constructs, we took advantage of mVenus (YFP) being nuclear and EGFP being strictly localized to the cell membrane, and imaged the two fluorophores together, using single laser (514) for excitation. This allowed quick simultaneous acquisition of all three fluorophores decreasing phototoxicity due to laser exposure. Fluorescent protein production from the injected mRNA started becoming detectable around 5–6 hr after injections, thus imaging could not be carried out earlier. For the samples imaged for cell lineage analysis (Samples A, B, C in Figure 5—figure supplement 1), 1.13 µm step size and 60–70 µm total stack thickness was used, representing the proximal embryonic hemisphere roughly. The 4D Z-stack for Sample A has been uploaded online as a dataset and can be accessed at https://doi.org/10.5281/zenodo.1063531.

Image analysis and processing

EdU assays, and immunostaining stacks were analyzed and exported using Fiji release of ImageJ (Schindelin et al., 2012). Nuclear signal counts were done manually in Fiji for Edu assays on injected samples. For live imaging datasets, 3D-projected stacks were exported as videos also using Fiji, except cell lineage tracking (see below). Time frame, and frequency of imaging is indicated for each video specifically. Annotated videos were edited using Adobe Premiere Pro CC 2017, and video encoding was adjusted to web-viewing using Hanbrake.

To better represent graphically an embryo that is spherical in shape, or parts of the embryo that are laid out in a curved manner, we wrote a Fiji script called ‘Onionizer’. (The onionized images appear in Figure 1—figure supplement 2C, and Figure 4—figure supplement 3.) This is essentially a tool that allows in silico flattening of the embryo at various tissue depths. Concretely, the script extracts the intersection of the 3D stacks and a series of near spherical surfaces located at increasing depth from the tissue surface. The intersections are then 2D projected as if successive ‘onion layers’ of the sample were flattened. The stack (x; y; z) is replaced by a (x; y; ol) stack where ‘ol’ represent onion layers of increasing depth. This allows flattening of ectodermal tissues for low ‘ol’ values and mesodermal for higher ‘ol’ values. The FIJI script is available on FigShare.com (https://figshare.com/s/1c0dcd120d13deb888ba).

All the cell lineage and cell cycle analyses were done using Bitplane Imaris (Version 8.2). Three different samples from two independent injection batches were used for lineage analysis, and these are letter coded throughout the manuscript: Sample A, Sample B, and Sample C. In the Figures 3–7, data from Sample A is shown (except in Figure 5B–B’’ Sample B is shown), and data from Samples B and C are presented in the figure supplements.

Imaris – cell lineage

Zeiss confocal stacks were uploaded to Imaris, and cell lineage tracing was done manually using spots feature, volume and slice views in Imaris (as opposed to automated tracing, which does not work well when cell and nuclei sizes change drastically, as is the case in P. dumerilii embryos). Based on the manual curation and connection of spots across time frames, a cell lineage tree is automatically created by Imaris. Different color codes were assigned to different lineages (such as blue, orange, and pink). Descendants of particular blastomeres were selected using a different spot color (yellow) for highlighting the clonal regions, and time-lapse videos including these highlighted spots were exported using Imaris.

Imaris – cell cycle

Spots (each sphere marking a cell in Imaris dataset) can be used for measuring fluorescence intensity for the pixels that fall into that spot’s volume. We used this feature for obtaining a quantitation of the cell cycle construct. To do this, spot size and position were manually adjusted so that each spot was slightly smaller than the nucleus signal, and was positioned to be completely inside the nucleus. Fluorescence intensity mean calculation for the mVenus channel was extracted for different cell lineages. During mitosis (when cell nucleus disappeared) the spot was positioned roughly to contain chromosomes. Criteria for choosing lineages to compare was as follows: we picked always the larger of the two sister cells after a division, and if the division was equal, we picked the one more posterior/closer to the Mesoblast. Cell cycle graphs were drawn in Excel and were modified in Adobe Illustrator CC 2017.

Acknowledgements

We thank the Balavoine Lab Members, Vervoort Lab Members, and Ryan Null for helpful discussions and feedback on the manuscript. We thank Solène Song for help with the ‘onionization’ code. We acknowledge the Company of Biologists for the travel award to BDO, which enabled a trip to Florian Raible’s laboratory (MFPL, Vienna, Austria) for learning injections. We thank Karim Vadiwala (Raible Lab) for his assistance during this training period. We acknowledge the ImagoSeine facility (member of the France BioImaging infrastructure supported by the French National Research Agency, ANR-10-INSB-04, ‘Investments of the future’) and its experienced staff for their assistance in imaging and image analysis. We also thank Caren Norden Lab (MPI-CBG, Dresden, Germany) for providing the plasmids for the construction of EGFP-caax and HistoneH2A-mCherry vectors. Finally, we thank the editors and reviewers for their comments that helped improve this manuscript.

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

B Duygu Özpolat, Email: dozpolat@gmail.com.

Guillaume Balavoine, Email: guillaume.balavoine@ijm.fr.

Lilianna Solnica-Krezel, Washington University School of Medicine, United States.

Funding Information

This paper was supported by the following grants:

  • Labex No.ANR-11-LABX-0071 to Michel Vervoort, Guillaume Balavoine.

  • Agence Nationale de la Recherche METAMERE no. ANR-12-BSV2-0021 to Michel Vervoort, Guillaume Balavoine.

  • Agence Nationale de la Recherche TELOBLAST no. ANR-16-CE91-0007 to B Duygu Özpolat, Michel Vervoort, Guillaume Balavoine.

Additional information

Competing interests

No competing interests declared.

Author contributions

Conceptualization, Resources, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing—original draft, Project administration, Writing—review and editing.

Resources, Methodology, Writing—review and editing.

Conceptualization, Supervision, Funding acquisition, Methodology, Writing—review and editing.

Conceptualization, Data curation, Software, Supervision, Funding acquisition, Validation, Methodology, Project administration, Writing—review and editing.

Additional files

Transparent reporting form
DOI: 10.7554/eLife.30463.052

Major datasets

The following dataset was generated:

Ozpolat BD, author; Handberg-Thorsager M, author; Vervoort M, author; Balavoine G, author. Sample A - Z-stacks. 2017 https://doi.org/10.5281/zenodo.1063531 Available at Zenodo under a Creative Commons Attribution-Non Commercial-No Derivatives license.

References

  1. Ables ET, Drummond-Barbosa D. Cyclin E controls Drosophila female germline stem cell maintenance independently of its role in proliferation by modulating responsiveness to niche signals. Development. 2013;140:530–540. doi: 10.1242/dev.088583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ackermann C, Dorresteijn A, Fischer A. Clonal domains in postlarval Platynereis dumerilii (Annelida: Polychaeta) Journal of Morphology. 2005;266:258–280. doi: 10.1002/jmor.10375. [DOI] [PubMed] [Google Scholar]
  3. Anderson DT. Chapter 3: Oligochaetes and Leeches. In: Kerkut G. A, editor. Embryology and Phylogeny in Annelids and Arthropods. New York: Pergamon Press; 1973a. pp. 51–92. [DOI] [Google Scholar]
  4. Anderson DT. Chapter2: Polychaetes. In: Kerkut G. A, editor. Embryology and Phylogeny in Annelids and Arthropods.  New York: Pergamon Press; 1973b. pp. 7–50. [DOI] [Google Scholar]
  5. Arias EE, Walter JC. PCNA functions as a molecular platform to trigger Cdt1 destruction and prevent re-replication. Nature Cell Biology. 2006;8:84–90. doi: 10.1038/ncb1346. [DOI] [PubMed] [Google Scholar]
  6. Asadulina A, Panzera A, Verasztó C, Liebig C, Jékely G. Whole-body gene expression pattern registration in Platynereis larvae. EvoDevo. 2012;3:27. doi: 10.1186/2041-9139-3-27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Backfisch B, Kozin VV, Kirchmaier S, Tessmar-Raible K, Raible F. Tools for gene-regulatory analyses in the marine annelid Platynereis dumerilii. PLoS One. 2014;9:e93076. doi: 10.1371/journal.pone.0093076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Balavoine G. Segment formation in Annelids: patterns, processes and evolution. The International Journal of Developmental Biology. 2014;58:469–483. doi: 10.1387/ijdb.140148gb. [DOI] [PubMed] [Google Scholar]
  9. Ballabeni A, Melixetian M, Zamponi R, Masiero L, Marinoni F, Helin K. Human geminin promotes pre-RC formation and DNA replication by stabilizing CDT1 in mitosis. The EMBO Journal. 2004;23:3122–3132. doi: 10.1038/sj.emboj.7600314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Barker N. Adult intestinal stem cells: critical drivers of epithelial homeostasis and regeneration. Nature Reviews Molecular Cell Biology. 2014;15:19–33. doi: 10.1038/nrm3721. [DOI] [PubMed] [Google Scholar]
  11. Bissen ST, Weisblat DA. The durations and compositions of cell cycles in embryos of the leech, Helobdella triserialis. Development. 1989;106:105–118. doi: 10.1242/dev.106.1.105. [DOI] [PubMed] [Google Scholar]
  12. Bissen ST. Expression of the cell cycle control gene, cdc25, is constitutive in the segmental founder cells but is cell-cycle-regulated in the micromeres of leech embryos. Development. 1995;121:3035–3043. doi: 10.1242/dev.121.9.3035. [DOI] [PubMed] [Google Scholar]
  13. Bissen ST. Developmental control of cell division in leech embryos. BioEssays. 1997;19:201–207. doi: 10.1002/bies.950190305. [DOI] [PubMed] [Google Scholar]
  14. Brunet T, Lauri A, Arendt D. Did the notochord evolve from an ancient axial muscle? The axochord hypothesis. BioEssays. 2015;37:836–850. doi: 10.1002/bies.201500027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Buzgariu W, Crescenzi M, Galliot B. Robust G2 pausing of adult stem cells in Hydra. Differentiation. 2014;87:83–99. doi: 10.1016/j.diff.2014.03.001. [DOI] [PubMed] [Google Scholar]
  16. Chen Y, Bissen ST. Regulation of cyclin A mRNA in leech embryonic stem cells. Development Genes and Evolution. 1997;206:407–415. doi: 10.1007/s004270050070. [DOI] [PubMed] [Google Scholar]
  17. Cho SJ, Vallès Y, Weisblat DA. Differential expression of conserved germ line markers and delayed segregation of male and female primordial germ cells in a hermaphrodite, the leech helobdella. Molecular Biology and Evolution. 2014;31:341–354. doi: 10.1093/molbev/mst201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Conklin EG. The embryology of crepidula. A contribution to the cell lineage and early development of some marine gasteropods. Journal of Morphology. 1897;13:1–226. doi: 10.1002/jmor.1050130102. [DOI] [Google Scholar]
  19. Cooke J, Zeeman EC. A clock and wavefront model for control of the number of repeated structures during animal morphogenesis. Journal of Theoretical Biology. 1976;58:455–476. doi: 10.1016/S0022-5193(76)80131-2. [DOI] [PubMed] [Google Scholar]
  20. de Rosa R, Prud'homme B, Balavoine G. Caudal and even-skipped in the annelid Platynereis dumerilii and the ancestry of posterior growth. Development. 2005;7:574–587. doi: 10.1111/j.1525-142X.2005.05061.x. [DOI] [PubMed] [Google Scholar]
  21. Devries J. Etude Descriptive Et Experimentale Du Developpement Embryonaire Chez Le Lombricien Eisenia Foetida. Universite de Bordeaux I; 1972. [Google Scholar]
  22. Devries J. La formation et la destinee des feuillets embryonnaires chez le lombricien Eisenia foetida. Arch. Anat. Microsc. 1973;62:15–38. [PubMed] [Google Scholar]
  23. Dill KK, Seaver EC. Vasa and nanos are coexpressed in somatic and germ line tissue from early embryonic cleavage stages through adulthood in the polychaete Capitella sp. I. Development Genes and Evolution. 2008;218:453–463. doi: 10.1007/s00427-008-0236-x. [DOI] [PubMed] [Google Scholar]
  24. Dorresteijn AWC, O'Grady B, Fischer A, Porchet-Henneré E, Boilly-Marer Y. Molecular specification of cell lines in the embryo of Platynereis (Annelida) Roux's Archives of Developmental Biology. 1993;202:260–269. doi: 10.1007/BF00363215. [DOI] [PubMed] [Google Scholar]
  25. Extavour CG, Akam M. Mechanisms of germ cell specification across the metazoans: epigenesis and preformation. Development. 2003;130:5869–5884. doi: 10.1242/dev.00804. [DOI] [PubMed] [Google Scholar]
  26. Fischer AH, Arendt D. Mesoteloblast-like mesodermal stem cells in the polychaete annelid Platynereis dumerilii (Nereididae) Journal of Experimental Zoology Part B: Molecular and Developmental Evolution. 2013;320:94–104. doi: 10.1002/jez.b.22486. [DOI] [PubMed] [Google Scholar]
  27. Fischer AH, Henrich T, Arendt D. The normal development of Platynereis dumerilii (Nereididae, Annelida) Frontiers in Zoology. 2010;7:31. doi: 10.1186/1742-9994-7-31. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Fujita M. Cdt1 revisited: complex and tight regulation during the cell cycle and consequences of deregulation in mammalian cells. Cell Division. 2006;1:22. doi: 10.1186/1747-1028-1-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Gazave E, Béhague J, Laplane L, Guillou A, Préau L, Demilly A, Balavoine G, Vervoort M. Posterior elongation in the annelid Platynereis dumerilii involves stem cells molecularly related to primordial germ cells. Developmental Biology. 2013;382:246–267. doi: 10.1016/j.ydbio.2013.07.013. [DOI] [PubMed] [Google Scholar]
  30. Gline SE, Kuo DH, Stolfi A, Weisblat DA. High resolution cell lineage tracing reveals developmental variability in leech. Developmental Dynamics. 2009;238:3139–3151. doi: 10.1002/dvdy.22158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Gline SE, Nakamoto A, Cho SJ, Chi C, Weisblat DA. Lineage analysis of micromere 4d, a super-phylotypic cell for Lophotrochozoa, in the leech Helobdella and the sludgeworm Tubifex. Developmental Biology. 2011;353:120–133. doi: 10.1016/j.ydbio.2011.01.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Goto A, Kitamura K, Arai A, Shimizu T. Cell fate analysis of teloblasts in the Tubifex embryo by intracellular injection of HRP. Development, Growth and Differentiation. 1999a;41:703–713. doi: 10.1046/j.1440-169x.1999.00469.x. [DOI] [PubMed] [Google Scholar]
  33. Goto A, Kitamura K, Shimizu T. Cell lineage analysis of pattern formation in the Tubifex embryo. I. Segmentation in the mesoderm. The International Journal of Developmental Biology. 1999b;43:317–327. [PubMed] [Google Scholar]
  34. Handberg-Thorsager M. PhD Thesis: Neoblast and Germ Cell Dynamics in the Planarian Schmidtea Mediterranea: The Role of the Nanos and Piwi Gene Families. Universitat de Barcelona; 2008. [Google Scholar]
  35. Havens CG, Walter JC. Docking of a specialized PIP Box onto chromatin-bound PCNA creates a degron for the ubiquitin ligase CRL4Cdt2. Molecular Cell. 2009;35:93–104. doi: 10.1016/j.molcel.2009.05.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Henry JQ. Spiralian model systems. The International Journal of Developmental Biology. 2014;58:389–401. doi: 10.1387/ijdb.140127jh. [DOI] [PubMed] [Google Scholar]
  37. Herlant-Meewis H. Contribution à l’etude de la régénération chez les oligochètes - reconstitution du germen chez lumbricillus lineatus (Enchytraeides) (deuxième partie) Arch. Biol. Paris. 1946;57:197–306. [Google Scholar]
  38. Hsu HJ, LaFever L, Drummond-Barbosa D. Diet controls normal and tumorous germline stem cells via insulin-dependent and -independent mechanisms in Drosophila. Developmental Biology. 2008;313:700–712. doi: 10.1016/j.ydbio.2007.11.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Irvine SQ, Seaver EC. Early annelid development, a molecular perspective. In: Rouse G. W, Pleijel F, editors. Reproductive Biology and Phylogeny of Annelida. Enfield: Science Publishers; 2006. pp. 93–140. [Google Scholar]
  40. Juliano CE, Swartz SZ, Wessel GM. A conserved germline multipotency program. Development. 2010;137:4113–4126. doi: 10.1242/dev.047969. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Kang D, Pilon M, Weisblat DA. Maternal and zygotic expression of a nanos-class gene in the leech Helobdella robusta: primordial germ cells arise from segmental mesoderm. Developmental Biology. 2002;245:28–41. doi: 10.1006/dbio.2002.0615. [DOI] [PubMed] [Google Scholar]
  42. Kitamura K, Shimizu T. Analyses of segment-specific expression of alkaline phosphatase activity in the mesoderm of the oligochaete annelid Tubifex: implications for specification of segmental identity. Developmental Biology. 2000;219:214–223. doi: 10.1006/dbio.1999.9602. [DOI] [PubMed] [Google Scholar]
  43. Kretzschmar K, Watt FM. Lineage tracing. Cell. 2012;148:33–45. doi: 10.1016/j.cell.2012.01.002. [DOI] [PubMed] [Google Scholar]
  44. Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant JM, Yost HJ, Kanki JP, Chien CB. The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs. Developmental Dynamics. 2007;236:3088–3099. doi: 10.1002/dvdy.21343. [DOI] [PubMed] [Google Scholar]
  45. Lambert JD. Mesoderm in spiralians: the organizer and the 4d cell. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution. 2008;310:15–23. doi: 10.1002/jez.b.21176. [DOI] [PubMed] [Google Scholar]
  46. Lauri A, Brunet T, Handberg-Thorsager M, Fischer AH, Simakov O, Steinmetz PR, Tomer R, Keller PJ, Arendt D. Development of the annelid axochord: insights into notochord evolution. Science. 2014;345:1365–1368. doi: 10.1126/science.1253396. [DOI] [PubMed] [Google Scholar]
  47. Liu E, Li X, Yan F, Zhao Q, Wu X. Cyclin-dependent kinases phosphorylate human Cdt1 and induce its degradation. Journal of Biological Chemistry. 2004;279:17283–17288. doi: 10.1074/jbc.C300549200. [DOI] [PubMed] [Google Scholar]
  48. Lyons DC, Perry KJ, Lesoway MP, Henry JQ. Cleavage pattern and fate map of the mesentoblast, 4d, in the gastropod Crepidula: a hallmark of spiralian development. EvoDevo. 2012;3:21. doi: 10.1186/2041-9139-3-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Meyer NP, Boyle MJ, Martindale MQ, Seaver EC. A comprehensive fate map by intracellular injection of identified blastomeres in the marine polychaete Capitella teleta. EvoDevo. 2010;1:8. doi: 10.1186/2041-9139-1-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Monier B, Pélissier-Monier A, Sanson B. Establishment and maintenance of compartmental boundaries: role of contractile actomyosin barriers. Cellular and Molecular Life Sciences. 2011;68:1897–1910. doi: 10.1007/s00018-011-0668-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Morgan TH. Growth and regeneration in Planaria lugubris. Archiv Für Entwickelungsmechanik Der Organismen. 1901;13:179–212. doi: 10.1007/BF02161982. [DOI] [Google Scholar]
  52. Nakagawa H, Ishizu H, Hasegawa R, Kobayashi K, Matsumoto M. Drpiwi-1 is essential for germline cell formation during sexualization of the planarian Dugesia ryukyuensis. Developmental Biology. 2012;361:167–176. doi: 10.1016/j.ydbio.2011.10.014. [DOI] [PubMed] [Google Scholar]
  53. Nakamoto A, Nagy LM, Shimizu T. Secondary embryonic axis formation by transplantation of D quadrant micromeres in an oligochaete annelid. Development. 2011;138:283–290. doi: 10.1242/dev.055384. [DOI] [PubMed] [Google Scholar]
  54. Newmark PA, Wang Y, Chong T. Germ cell specification and regeneration in planarians. Cold Spring Harbor Symposia on Quantitative Biology. 2008;73:573–581. doi: 10.1101/sqb.2008.73.022. [DOI] [PubMed] [Google Scholar]
  55. Nishitani H, Sugimoto N, Roukos V, Nakanishi Y, Saijo M, Obuse C, Tsurimoto T, Nakayama KI, Nakayama K, Fujita M, Lygerou Z, Nishimoto T. Two E3 ubiquitin ligases, SCF-Skp2 and DDB1-Cul4, target human Cdt1 for proteolysis. The EMBO journal. 2006;25:1126–1136. doi: 10.1038/sj.emboj.7601002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Niwa N, Akimoto-Kato A, Sakuma M, Kuraku S, Hayashi S. Homeogenetic inductive mechanism of segmentation in polychaete tail regeneration. Developmental Biology. 2013;381:460–470. doi: 10.1016/j.ydbio.2013.04.010. [DOI] [PubMed] [Google Scholar]
  57. Oyama A, Shimizu T. Transient occurrence of vasa-expressing cells in nongenital segments during embryonic development in the oligochaete annelid Tubifex tubifex. Development Genes and Evolution. 2007;217:675–690. doi: 10.1007/s00427-007-0180-1. [DOI] [PubMed] [Google Scholar]
  58. Özpolat BD, Bely AE. Gonad establishment during asexual reproduction in the annelid Pristina leidyi. Developmental Biology. 2015;405:123–136. doi: 10.1016/j.ydbio.2015.06.001. [DOI] [PubMed] [Google Scholar]
  59. Özpolat BD, Bely AE. Developmental and molecular biology of annelid regeneration: a comparative review of recent studies. Current Opinion in Genetics & Development. 2016;40:144–153. doi: 10.1016/j.gde.2016.07.010. [DOI] [PubMed] [Google Scholar]
  60. Özpolat BD, Sloane ES, Zattara EE, Bely AE. Plasticity and regeneration of gonads in the annelid Pristina leidyi. EvoDevo. 2016;7:22. doi: 10.1186/s13227-016-0059-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Penners A. Die entwicklung des keimstreifs und die organbildung bei tubifex rivulorum lam. Zool. Jb. Abt. Anat. Ontog. 1924:251–308. [Google Scholar]
  62. Raible F, Arendt D. Metazoan evolution: some animals are more equal than others. Current Biology. 2004;14:R106–R108. doi: 10.1016/j.cub.2004.01.015. [DOI] [PubMed] [Google Scholar]
  63. Raible F, Tessmar-Raible K, Osoegawa K, Wincker P, Jubin C, Balavoine G, Ferrier D, Benes V, de Jong P, Weissenbach J, Bork P, Arendt D. Vertebrate-type intron-rich genes in the marine annelid Platynereis dumerilii. Science. 2005;310:1325–1326. doi: 10.1126/science.1119089. [DOI] [PubMed] [Google Scholar]
  64. Rebscher N, Lidke AK, Ackermann CF. Hidden in the crowd: primordial germ cells and somatic stem cells in the mesodermal posterior growth zone of the polychaete Platynereis dumerillii are two distinct cell populations. EvoDevo. 2012;3:9. doi: 10.1186/2041-9139-3-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Rebscher N, Zelada-González F, Banisch TU, Raible F, Arendt D. Vasa unveils a common origin of germ cells and of somatic stem cells from the posterior growth zone in the polychaete Platynereis dumerilii. Developmental Biology. 2007;306:599–611. doi: 10.1016/j.ydbio.2007.03.521. [DOI] [PubMed] [Google Scholar]
  66. Rebscher N. Establishing the germline in spiralian embyos. The international journal of Developmental Biology. 2014;58:403–411. doi: 10.1387/ijdb.140125nr. [DOI] [PubMed] [Google Scholar]
  67. Roccio M, Schmitter D, Knobloch M, Okawa Y, Sage D, Lutolf MP. Predicting stem cell fate changes by differential cell cycle progression patterns. Development. 2013;140:459–470. doi: 10.1242/dev.086215. [DOI] [PubMed] [Google Scholar]
  68. Sakaue-Sawano A, Kurokawa H, Morimura T, Hanyu A, Hama H, Osawa H, Kashiwagi S, Fukami K, Miyata T, Miyoshi H, Imamura T, Ogawa M, Masai H, Miyawaki A. Visualizing spatiotemporal dynamics of multicellular cell-cycle progression. Cell. 2008;132:487–498. doi: 10.1016/j.cell.2007.12.033. [DOI] [PubMed] [Google Scholar]
  69. Saudemont A, Dray N, Hudry B, Le Gouar M, Vervoort M, Balavoine G. Complementary striped expression patterns of NK homeobox genes during segment formation in the annelid Platynereis. Developmental Biology. 2008;317:430–443. doi: 10.1016/j.ydbio.2008.02.013. [DOI] [PubMed] [Google Scholar]
  70. Scherholz M, Redl E, Wollesen T, Todt C, Wanninger A. From complex to simple: myogenesis in an aplacophoran mollusk reveals key traits in aculiferan evolution. BMC Evolutionary Biology. 2015;15:201. doi: 10.1186/s12862-015-0467-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, Tinevez JY, White DJ, Hartenstein V, Eliceiri K, Tomancak P, Cardona A. Fiji: an open-source platform for biological-image analysis. Nature Methods. 2012;9:676–682. doi: 10.1038/nmeth.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Seaver EC, Paulson DA, Irvine SQ, Martindale MQ. The spatial and temporal expression of Ch-en, the engrailed gene in the polychaete Chaetopterus, does not support a role in body axis segmentation. Developmental Biology. 2001;236:195–209. doi: 10.1006/dbio.2001.0309. [DOI] [PubMed] [Google Scholar]
  73. Seaver EC. Variation in spiralian development: insights from polychaetes. The International Journal of Developmental Biology. 2014;58:457–467. doi: 10.1387/ijdb.140154es. [DOI] [PubMed] [Google Scholar]
  74. Seaver EC. Annelid models I: Capitella teleta. Current Opinion in Genetics & Development. 2016;39:35–41. doi: 10.1016/j.gde.2016.05.025. [DOI] [PubMed] [Google Scholar]
  75. Seidel HS, Kimble J. Cell-cycle quiescence maintains Caenorhabditis elegans germline stem cells independent of GLP-1/Notch. eLife. 2015;4:e10832. doi: 10.7554/eLife.10832. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Shimizu T, Nakamoto A. Developmental significance of D quadrant micromeres 2d and 4d in the oligochaete annelid Tubifex tubifex. The International Journal of Developmental Biology. 2014;58:445–456. doi: 10.1387/ijdb.140102ts. [DOI] [PubMed] [Google Scholar]
  77. Shimizu T. Development in the freshwater oligochaeteTubifex. In: Harrison F. W, Cowden R. R, editors. Developmental Biology of Freshwater Invertebrates. New York: Alan R. Liss; 1982. pp. 286–316. [Google Scholar]
  78. Shiomi Y, Suenaga N, Tanaka M, Hayashi A, Nishitani H. Imaging analysis of cell cycle-dependent degradation of Cdt1 in mammalian cells. Methods in Molecular Biology. 2014;1170:357–365. doi: 10.1007/978-1-4939-0888-2_18. [DOI] [PubMed] [Google Scholar]
  79. Smith CM, Weisblat DA. Micromere fate maps in leech embryos: lineage-specific differences in rates of cell proliferation. Development. 1994;120:3427–3438. doi: 10.1242/dev.120.12.3427. [DOI] [PubMed] [Google Scholar]
  80. Solana J. Closing the circle of germline and stem cells: the primordial stem cell hypothesis. EvoDevo. 2013;4:2. doi: 10.1186/2041-9139-4-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  81. Starunov VV, Dray N, Belikova EV, Kerner P, Vervoort M, Balavoine G. A metameric origin for the annelid pygidium? BMC Evolutionary Biology. 2015;15:25. doi: 10.1186/s12862-015-0299-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  82. Steinmetz PR, Kostyuchenko RP, Fischer A, Arendt D. The segmental pattern of otx, gbx, and Hox genes in the annelid Platynereis dumerilii. Evolution & Development. 2011;13:72–79. doi: 10.1111/j.1525-142X.2010.00457.x. [DOI] [PubMed] [Google Scholar]
  83. Stéphan-Dubois F. La Lingnée germinale des Turbellariés et des Annélides dans l’évolution normale et la régéneration. In: Wolff, E, editor. L’Origine De La Lingée Germinale Chez Les Vertébrés Et Chez Quelques Groups d’Invertébrés. Paris: Hermann; 1964. pp. 115–136. [Google Scholar]
  84. Storey K. The effects of ectoteloblast ablation in the earthworm. Development. 1989;107:533–545. [Google Scholar]
  85. Struck TH, Paul C, Hill N, Hartmann S, Hösel C, Kube M, Lieb B, Meyer A, Tiedemann R, Purschke G, Bleidorn C. Phylogenomic analyses unravel annelid evolution. Nature. 2011;471:95–98. doi: 10.1038/nature09864. [DOI] [PubMed] [Google Scholar]
  86. Sugiyama M, Sakaue-Sawano A, Iimura T, Fukami K, Kitaguchi T, Kawakami K, Okamoto H, Higashijima S, Miyawaki A. Illuminating cell-cycle progression in the developing zebrafish embryo. PNAS. 2009;106:20812–20817. doi: 10.1073/pnas.0906464106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  87. Swartz SZ, Chan XY, Lambert JD. Localization of Vasa mRNA during early cleavage of the snail Ilyanassa. Development Genes and Evolution. 2008;218:107–113. doi: 10.1007/s00427-008-0203-6. [DOI] [PubMed] [Google Scholar]
  88. Thamm K, Seaver EC. Notch signaling during larval and juvenile development in the polychaete annelid Capitella sp. I. Developmental Biology. 2008;320:304–318. doi: 10.1016/j.ydbio.2008.04.015. [DOI] [PubMed] [Google Scholar]
  89. Ulman V, Maška M, Magnusson KEG, Ronneberger O, Haubold C, Harder N, Matula P, Matula P, Svoboda D, Radojevic M, Smal I, Rohr K, Jaldén J, Blau HM, Dzyubachyk O, Lelieveldt B, Xiao P, Li Y, Cho SY, Dufour AC, Olivo-Marin JC, Reyes-Aldasoro CC, Solis-Lemus JA, Bensch R, Brox T, Stegmaier J, Mikut R, Wolf S, Hamprecht FA, Esteves T, Quelhas P, Demirel Ö, Malmström L, Jug F, Tomancak P, Meijering E, Muñoz-Barrutia A, Kozubek M, Ortiz-de-Solorzano C. An objective comparison of cell-tracking algorithms. Nature Methods. 2017;14:1141–1152. doi: 10.1038/nmeth.4473. [DOI] [PMC free article] [PubMed] [Google Scholar]
  90. Weigert A, Bleidorn C. Current status of annelid phylogeny. Organisms Diversity & Evolution. 2016;16:345–362. doi: 10.1007/s13127-016-0265-7. [DOI] [Google Scholar]
  91. Weisblat DA, Kuo DH. Developmental biology of the leech Helobdella. The International Journal of Developmental Biology. 2014;58:429–443. doi: 10.1387/ijdb.140132dw. [DOI] [PMC free article] [PubMed] [Google Scholar]
  92. Weisblat DA, Shankland M. Cell lineage and segmentation in the leech. Philosophical Transactions of the Royal Society B: Biological Sciences. 1985;312:39–56. doi: 10.1098/rstb.1985.0176. [DOI] [PubMed] [Google Scholar]
  93. Wilson EB. The cell-lineage of Nereis. A contribution to the cytogeny of the annelid body. Journal of Morphology. 1892;6:361–480. doi: 10.1002/jmor.1050060301. [DOI] [Google Scholar]
  94. Yasugi T, Nishimura T. Temporal regulation of the generation of neuronal diversity in Drosophila. Development, Growth & Differentiation. 2016;58:73–87. doi: 10.1111/dgd.12245. [DOI] [PubMed] [Google Scholar]
  95. Zackson SL. Cell clones and segmentation in leech development. Cell. 1982;31:761–770. doi: 10.1016/0092-8674(82)90330-0. [DOI] [PubMed] [Google Scholar]
  96. Zielke N, Edgar BA. FUCCI sensors: powerful new tools for analysis of cell proliferation. Wiley Interdisciplinary Reviews: Developmental Biology. 2015;4:469–487. doi: 10.1002/wdev.189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  97. Zrzavý J, Ríha P, Piálek L, Janouskovec J. Phylogeny of Annelida (Lophotrochozoa): total-evidence analysis of morphology and six genes. BMC Evolutionary Biology. 2009;9:189. doi: 10.1186/1471-2148-9-189. [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision letter

Editor: Lilianna Solnica-Krezel1

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

Thank you for submitting your article "Cell lineage and cell cycling analysis of the 4d lineage using live imaging in the marine annelid Platynereis dumerilii" for consideration by eLife. Your article has been favorably evaluated by K VijayRaghavan (Senior Editor) and three reviewers, one of whom is a member of our Board of Reviewing Editors. The reviewers have opted to remain anonymous.

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

Summary:

Ozpolat and colleagues report their elegant in vivo time-lapse imaging of early embryogenesis of the marine annelid Platynereis dumerilli, for which they generated a FUCCI cell cycle reporter based on P. dumerilli cdt1 gene and optimized methods for long-term microscopy for this species. The experimental focus is on the 4d lineage, which was previously shown to give rise to mesodermal segments and primordial germ cells but the underlying cellular mechanisms were unknown. Leveraging these technological advances to extend imaging and 4d lineage tracing the authors demonstrate early segregation of PGCs in that linage, following by their clustering and cell cycle quiescence. Moreover, the traced cells divide to form several segment rudiments, not as many as in leeches but using a similar teloblast asymmetric division mechanism. This is a novel observation, along with the extension of the lineage analysis by up to 8 cell generations. In addition, the authors report identification of the embryonic origins of mesodermal posterior growth zone and report different cell cycling properties for differentially-fated progenies. The importance of this work lies in that provides high resolution in vivo analyses of early development that extend earlier studies. The methods will be valuable for future studies of this and other marine species. Moreover, this work reveals a lineage separation that is similar to the well-studied teloblasts, like leaches. This is, evolutionarily, a surprising result, since it was thought that leeches were highly derived. Conversely, this work implies that leeches simply took a common feature of segmentation that is found throughout the phylum and amplified it.

Essential revisions:

1) The time interval in time-lapse analyses of several minutes is relatively long questioning the lineage relationships established by Imaris. Therefore, a manual validation of critical lineages to corroborate automatic analysis is essential.

2) Pdu FUCCI system to be better characterized, and its utility for this study better justified. Why Pdu FUCCI system is also labelling G2? Currently, it is not clear whether it provides additional information over the live imaging and tracing.

3) The paper needs to be presented better in terms of figure numbering, labeling and how figures are incorporated in the logical flow of the manuscript. Moreover, whereas the lineage tracing is the most important aspect of this work it is presented as an add on. Finally, the authors appropriately acknowledge that even their extended lineage tracing does not allow them to trace the lineages until the morphologic segments are apparent. It would be important to more clearly present the argument that the linear arrangements of specific sub-lineages represent segmental anlagen.

4) Videos 4.1 and 4.2 could not be converted. Videos 5.3 and 5.4 are missing.

[Editors' note: further revisions were requested prior to acceptance, as described below.]

Thank you for resubmitting your work entitled "Cell lineage and cell cycling analysis of the 4d micromere using live imaging in the marine annelid Platynereis dumerilii" for further consideration at eLife. Your revised article has been favorably evaluated by K VijayRaghavan (Senior Editor) and a Reviewing Editor.

The manuscript has been improved and in principle will be suitable for publication. However, there are some remaining issues that need to be addressed before acceptance, as outlined below:

The authors state that they have added to the figures labels explaining what fluorescent probes/proteins are shown in the images. Yet, it is not clear what we are looking at on Figure 3—figure supplement 2?

Same for Figure 4. The color key if the same should be also provided on the pages with figures supplemental to Figure 4.

Introduction, fourth paragraph: "PGCs" abbreviation should be explained.

Subsection “Establishment of a work flow for long time-lapse live imaging and cell lineage tracing in marine embryos and larvae”, second paragraph: "…each image stack acquisition (…) was acquired" revise "each image stack was acquired".

Subsection “Live imaging the 4d (M) lineage in P. dumerilii with a live-cell cycle reporter”: the sentence "As a result, behavior of specific lineages with detailed cell cycling characteristics at single-cell resolution was not possible," should be revised "behavior.…could not be discerned/observed” etc.

eLife. 2017 Dec 12;6:e30463. doi: 10.7554/eLife.30463.057

Author response


Essential revisions:

1) The time interval in time-lapse analyses of several minutes is relatively long questioning the lineage relationships established by Imaris. Therefore, a manual validation of critical lineages to corroborate automatic analysis is essential.

All of the lineage relationships reported in this manuscript were curated manually and not via automatic algorithms in Imaris. This was already stated in Materials and methods but we added in several places in the text that the lineages were curated manually (subsection “Each mesodermal hemisegment is the progeny of individual blast cells produced in successive divisions”, first two paragraphs, subsection “Divisions generating segmental mesoderm precursors happen in quick succession, then cell cycling slows down significantly”, last paragraph).

2) Pdu FUCCI system to be better characterized, and its utility for this study better justified. Why Pdu FUCCI system is also labelling G2?

This was initially explained in the Discussion, but in order to make it more accessible early on in the manuscript, we have moved the information to Results and emphasized it in the last paragraph of the subsection “In P. dumerilii, mVenus-Cdt1(aa1-147) reporter”. In brief, the current cycling pattern obtained actually matches the endogenous patterns reported in other organisms, thus it is not surprising that the late G2 phase is labeled. In addition, for the purposes of the work in this manuscript, the cycling pattern observed was sufficiently useful. However, we are currently working on developing additional live-cell cycle reporters that will more precisely match different phases of the cell cycle. While we believe this ongoing work is out of the scope of this manuscript, it is worth noting that as a part of these efforts we have tested several different constructs obtained from the authors of the original FUCCI systems based on zebrafish and human sequences (Sakaue-Sawano et al., 2008) and did not observe fluorescence.

Currently, it is not clear whether it provides additional information over the live imaging and tracing.

Pdu-FUCCI was indeed crucial for cell lineage analysis carried out in this manuscript, as it provided additional resolution into cell cycle, making it feasible to trace lineages manually under the time and image resolution constraints we had. To clarify this, we added a section at the beginning of Results.

To our knowledge, with current algorithms available via different cell lineage-tracing platforms (such as Imaris, or the Fiji plugin Mamut), it is not possible to carry out an automated lineage analysis for embryos like P. dumerilii’s which have significantly variable cell sizes and nuclei. Most tracing algorithms rely on more or less uniform nuclei size for confidently tracking them from a time point to the next, such as it has been done in the early C. elegans and Drosophila embryos (Tomer et al., 2012; Wu et al., 2011). Consequently, lineage tracing cell in embryos such as P. dumerilii’s still rely on manual curation, especially at stages of development we have attempted in this work. During this manual curation of lineages, the researcher has to mark the nuclei one by one, from one frame to the next. We have optimized the imaging conditions for healthy-developing embryos, and in doing so, we had to give up better time- and image- resolution (therefore decreasing the time embryos were exposed to laser light for imaging). As a result, each frame had to be carefully examined to make sure to pick the right nuclei as the daughters of a dividing cell. The cell cycle reporter was critical at this stage, as it enabled observation of a particular cell’s progression in cell cycle, therefore making it easier to differentiate it from the surrounding cells, and predict if it is likely to divide. For example, if a nucleus being traced was red (meaning it is in early G2 phase) and it became orange/yellow (the brief period in late G2 when cells upregulate the cell cycle construct right before division), it was possible to predict the cell will divide soon (possibly in the next frame). This layer of extra information was crucial in accurate manual curation of lineages, especially as the cells progressively became smaller, division after division.

Of note, for this study, we did not have access to SPIM (i.e. light sheet microscopy), which would have allowed higher time resolution without deleterious effects. We used the cell cycle reporter to complement live imaging conditions with the technology available to us. We believe that our work may encourage others who have access to only confocal imaging. As data processing, visualization, and analysis remain a challenge in light sheet (Girstmair et al., 2016; Shah et al., 2017) scanning confocal imaging continues to be useful for live-imaging and lineage-tracing at single cell level, with the right combination of techniques.

3) The paper needs to be presented better in terms of figure numbering, labeling and how figures are incorporated in the logical flow of the manuscript. Moreover, whereas the lineage tracing is the most important aspect of this work it is presented as an add on.

To emphasize cell lineage analysis we put Figure 2 as a figure supplement to Figure 1 (new numbering: Figure 1—figure supplement 2) and removed the section from the main text. We also shortened some of the cell cycle discussion and instead of having this as the final discussion of the manuscript, we placed this part earlier in the Discussion (subsection “Cell cycle patterns of the 4d lineage”).

To emphasize the importance of the lineage analysis in a larger evo-devo picture, we have added an additional summary figure (Figure 9) that shows phylogenetic distribution of our current knowledge on teloblasts across annelids (and spiralians), and we conclude the manuscript with a discussion of these concepts (subsection “Formation of segmental and growth zone mesoderm in P. dumerilii”, last paragraph).

Finally, the authors appropriately acknowledge that even their extended lineage tracing does not allow them to trace the lineages until the morphologic segments are apparent. It would be important to more clearly present the argument that the linear arrangements of specific sub-lineages represent segmental anlagen.

To address this point we have made several additions to the manuscript (subsection “Each mesodermal hemisegment is the progeny of individual blast cells produced in successive divisions”, fourth paragraph):

1) We have added a figure supplement showing how the distinct mesodermal clonal cell clusters (i.e. one sub-lineage) align with the chaetal sacs of the corresponding hemisegment (Figure 3—figure supplement 2). This supplementary figure also demonstrates the position of the mesodermal clusters in relation to chaetal sacs more clearly.

2) To demonstrate how these early mesodermal clusters eventually encase the chaetal sacs in each hemisegment, and the cells mainly stay in their designated segmental anlage, we added a new time-lapse video and a corresponding figure (Figure 4—figure supplement 3, Video 8).

4) Videos 4.1 and 4.2 could not be converted. Videos 5.3 and 5.4 are missing.

5.3 and 5.4 do not exist, thus we removed these from the text. We uploaded new versions for all the other videos in correct formatting as required by eLife.

Bibliography:

Girstmair, J., Zakrzewski, A., Lapraz, F., Handberg-Thorsager, M., Tomancak, P., Pitrone, P.G., Simpson, F., Telford, M.J., 2016. Light-sheet microscopy for everyone? Experience of building an OpenSPIM to study flatworm development. BMC Dev. Biol. 16, 22. doi:10.1186/s12861-016-0122-0

Shah, G., Weber, M., Huisken, J., 2017. Light Sheet Microscopy, in: Fluorescence Microscopy. Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, Germany, pp. 243–265. doi:10.1002/9783527687732.ch7

Tomer, R., Khairy, K., Amat, F., Keller, P.J., 2012. Quantitative high-speed imaging of entire developing embryos with simultaneous multiview light-sheet microscopy. Nat. Methods 9, 755–763. doi:10.1038/nmeth.2062

Wu, Y., Ghitani, A., Christensen, R., Santella, A., Du, Z., Rondeau, G., Bao, Z., Colon-Ramos, D., Shroff, H., 2011. Inverted selective plane illumination microscopy (iSPIM) enables coupled cell identity lineaging and neurodevelopmental imaging in Caenorhabditis elegans. Proc. Natl. Acad. Sci. 108, 17708–17713. doi:10.1073/pnas.1108494108

[Editors' note: further revisions were requested prior to acceptance, as described below.]

The manuscript has been improved and in principle will be suitable for publication. However, there are some remaining issues that need to be addressed before acceptance, as outlined below:

The authors state that they have added to the figures labels explaining what fluorescent probes/proteins are shown in the images. Yet, it is not clear what we are looking at on Figure 3—figure supplement 2?

Same for Figure 4. The color key if the same should be also provided on the pages with figures supplemental to Figure 4.

Introduction, fourth paragraph: "PGCs" abbreviation should be explained.

Subsection “Establishment of a work flow for long time-lapse live imaging and cell lineage tracing in marine embryos and larvae”, second paragraph: "…each image stack acquisition (…) was acquired" revise "each image stack was acquired".

Subsection “Live imaging the 4d (M) lineage in P. dumerilii with a live-cell cycle reporter”: the sentence "As a result, behavior of specific lineages with detailed cell cycling characteristics at single-cell resolution was not possible," should be revised "behavior.…could not be discerned/observed” etc.

We addressed the requests by making the following changes: We have added fluorophore information to all the relevant figures, and if this wasn’t possible to add this information in the figure due to space limitations, we made sure to add the information into the legend. (The following figures and/or their legends were edited: Figure 2, Figure 3, Figure 3—figure supplements 1 and 2, Figure 4, Figure 4—figure supplements 1 and 2, Figure 5). We have also added a DOI link to the complete Z-stack dataset uploaded to a cloud server (Zenodo) for sharing this dataset with other researchers. This information can be found at the end of the subsection “Imaging”.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Figure 7—source data 1.
    DOI: 10.7554/eLife.30463.047
    Transparent reporting form
    DOI: 10.7554/eLife.30463.052

    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES