Summary
Ionotropic glutamate receptors (iGluRs) mediate neurotransmission at the majority of excitatory synapses in the brain. Little is known, however, about how glutamate reaches the recessed binding pocket in iGluR ligand-binding domains (LBDs). Here we report the process of glutamate binding to a prototypical iGluR, GluA2, in atomistic detail using unbiased molecular simulations. Charged residues on the LBD surface form pathways that facilitate glutamate binding by effectively reducing a three-dimensional diffusion process to a spatially constrained, two-dimensional one. Free energy calculations identify residues that metastably bind glutamate and help guide it into the binding pocket. These simulations also reveal that glutamate can bind in an inverted conformation and also reorient while in its pocket. Electrophysiological recordings demonstrate that eliminating these transient binding sites slows activation and deactivation, consistent with slower glutamate binding and unbinding. These results suggest that binding pathways have evolved to optimize rapid responses of AMPA-type iGluRs at synapses.
Keywords: ligand-gated ion channels, glutamate receptors, ligand binding, molecular dynamics simulations, free energy, electrophysiology
Highlights
-
•
Glutamate binds to AMPA receptors by following preferential pathways
-
•
All-atom simulations find metastable sites that speed binding and unbinding
-
•
Perturbing glutamate-binding pathways slows both activation and deactivation
-
•
Glutamate can bind in two orientations in its pocket
Yu et al. show that the ligand-binding domain of ionotropic glutamate receptors has structural features on its surface that guide the agonist glutamate to its binding site. This phenomenon serves to accelerate receptor activation.
Introduction
The speed of information processing in the brain is limited to a maximum rate of ∼1 kHz by the width of action potentials, the release rate of synaptic vesicles, and the duration of synaptic potentials (Attwell and Gibb, 2005, Lisman et al., 2007). Fast activation and deactivation of synaptic neurotransmitter receptors is therefore essential for normal signaling in the nervous system. One of the fastest-operating receptors is the AMPA-type ionotropic glutamate receptor (iGluR) (Baranovic and Plested, 2016), a ligand-gated ion channel found throughout the brain (Traynelis et al., 2010). Activation of these receptors is the final step in a cascade that allows cells releasing glutamate to excite downstream target neurons with millisecond precision (Mayer, 2011). Each receptor has four binding sites for glutamate that resemble clamshells, termed ligand-binding domains (LBDs). The four LBDs in each receptor assemble as a dimer of dimers (Mayer, 2016). Because glutamate-bound LBDs are closed, ligand binding is thought to pull open the gate of the attached ion channel pore. Alternatively, binding can drive separate conformational changes that result in an unresponsive, desensitized receptor (Sun et al., 2002). A paradox of AMPA receptor activation is how the dynamics of both binding and unbinding of glutamate are fast enough in order to allow both the onset and termination of activity to be rapid, yet robust and selective.
Over 100 high-resolution structures of genetically isolated iGluR LBDs have been determined, in complex with agonists and competitive antagonists, as well as in the apo state. These structures reveal common modes of ligand binding within the cleft (Mayer, 2016). Computational analyses, in turn, have shed light on both LBD and ligand dynamics and energetics (Arinaminpathy et al., 2002, Dai and Zhou, 2016, Lau and Roux, 2007, Lau and Roux, 2011, Mamonova et al., 2008, Mendieta et al., 2005, Okada et al., 2012, Postila et al., 2010, Sahai and Biggin, 2011, Speranskiy and Kurnikova, 2005, Wolter et al., 2013, Yao et al., 2013). Neither the structural nor computational studies, however, have comprehensively shown how glutamate finds its way into the binding site or how large-scale conformational changes in the LBD are coupled to glutamate binding. For example, does glutamate diffuse directly from bulk solvent into its binding pocket, only contacting the protein randomly, or does glutamate follow distinct pathways on the surface of the LBD to find its way into its pocket? If the latter, what structural features make up the pathways, and what is the nature of the protein-ligand interactions therein? In this study, long-timescale molecular dynamics (MD) simulations (totaling ∼50 μs) and free energy calculations of the GluA2 receptor suggest that strategically positioned flexible side chains on the surface of the LBD metastably interact with glutamate to help guide, or “funnel,” it into its recessed binding pocket, where it adopts two possible poses. These results were used to guide the design of a panel of LBD mutants that were tested using electrophysiological recordings. Elimination of the transient binding sites was found to slow both activation and deactivation of the receptor. Taken together, these results suggest that glutamate, and perhaps other iGluR ligands as well, binds via distinct pathways on the surface of the LBD, and disruption of these pathways significantly impacts the functional kinetics of the receptor.
Results
Glutamate Binds via Preferred Pathways and Metastable Interactions
In order to examine the processes by which a glutamate ligand either associates with or dissociates from the GluA2 AMPA receptor LBD, we performed unbiased all-atom MD simulations with explicit solvent using special-purpose hardware (Shaw et al., 2009) to generate 21 trajectories (17 trajectories involved the wild-type [WT] LBD, and 4 trajectories involved an LBD variant) with an aggregate simulation time of 49.1 μs. The four LBDs of an iGluR are arranged as a dimer of dimers; we simulated glutamate binding in both LBD dimers and monomers. The binding of glutamate is thought to involve the following: ligand entry into an open, solvent-exposed binding cleft; ligand docking to R485 in Lobe 1 of the LBD; then large-scale conformational changes that close the cleft, securing the ligand (Cheng et al., 2005). After glutamate has docked, cleft closure proceeds when the ligand, attached to R485, also attaches to E705 in Lobe 2 (Armstrong and Gouaux, 2000). The ligand forms both of these Lobe 1 and Lobe 2 interactions in all of the simulated binding trajectories, with the caveat that, in some of the simulations, the final orientation of glutamate was not the same as that observed in crystallographic studies (see below).
In our simulation systems (see Tables S1 and S2), glutamate ligand molecules were initially placed at random positions and orientations in bulk solvent, similar to the approach of Dror et al. (2011), at least 8 Å away from any non-water molecules. The effective ligand concentrations ranged from 3.9 mM (single ligand in a monomer system) to 71 mM (20 ligands in a dimer system). These concentrations are somewhat higher than estimates of the peak glutamate concentration during synaptic transmission (1–10 mM) (Clements et al., 1992, Rudolph et al., 2015), but our goal was to maximize the number of independent binding events that we could obtain with our allocation of computational resources. Despite the high concentrations, we did not observe any artifactual ligand-ligand or protein-ligand interactions. In all but one of the binding trajectories, the carboxyl groups of glutamate were exploited by positively charged side chains at the periphery of the binding cleft. Strikingly, glutamate was passed from one residue to the next by a select set of residues that funnel the neurotransmitter, via a series of metastable interactions, into its binding site.
In one such trajectory, the ligand first contacts the LBD at R453 on loop 2 (Figure 1; Movie S1). From there, its γ-carboxyl group swings toward Lobe 2, interacting with helix F residues E657, R660, and R661. Mutations in this region, a prominent metastable interaction site (occurring in three out of six binding simulations), alter AMPA receptor function (Weston et al., 2006). Unexpectedly, the guanidinium group of R485 in helix D rotates dramatically out of the binding pocket to contact the ligand. This surprising conformational flexibility occurs via rotations of –106°, –127°, –136°, and –111° around the R485 side chain’s χ1, χ2, χ3, and χ4 torsion angles, respectively (Figures 1E–1I). The ligand remains tethered to R485 as it leaves the metastable site, being pulled into the binding cleft. Finally, the ligand’s amine contacts E705 to close the cleft and secure the ligand in the crystallographic pose. Water molecules were observed to occupy approximately the same positions in the cleft as those seen in crystal structures (Armstrong and Gouaux, 2000). Prior to ligand binding, a water molecule (W1) contacts the E705 amine, and another (W2) mediates a hydrogen bond interaction between the L650 amine and the L703 backbone carbonyl. Contact between the ligand’s amine and E705 reduces the exchange frequency of water molecules in the cleft with bulk solvent. One water molecule (W3) is recruited during ligand binding to the base of helix F after the ligand’s amine contacts the E705 side chain. In our binding trajectories, the LBD does not close as fully as is seen crystallographically ((ξ1, ξ2) = (11.8, 10.8 Å) versus (ξ1, ξ2) = (9.5, 7.8 Å) for PDB: 1FTJ; see Discussion below). Comparison with the crystal structure reveals the ligand-bound complex lacks a γ-carboxyl group interaction with the backbone amine of T655 in Lobe 2. Details of individual trajectories are provided in Table S1.
The binding pathways in the dimer and monomer simulations are very similar. Given the functional independence of binding processes and the location of the pathways at the periphery of the LBD tetramer (Figure S1), we expect that the pathways we observe are the same in full-length, tetrameric receptors. In all trajectories, K730, in the hinge region between Lobes 1 and 2, shows substantial conformational flexibility and alternates between forming salt bridge interactions with E705 in Lobe 2 and D728 in the hinge. From our simulations, it is unclear how much these interactions contribute to “locking” the LBD closed, as proposed by Armstrong and Gouaux (2000).
Potential of Mean Force for Binding and Unbinding
To understand the energetics of funneling in each of the pathways, we computed a three-dimensional free energy landscape, or potential of mean force (PMF), from our binding and unbinding trajectories. The PMF, shown in Figure 2A, indicates three possible ligand-binding pathways. Contouring the PMF at lower energies reveals sites of metastable protein-ligand interactions (Figures 2B–2D). Situated inside the binding pocket, site 0 is the global free energy minimum, set to 0 kcal/mol. The next most stable sites, sites 1, 2, and 3, are local minima with free energies of 0.29, 0.83, and 0.75 kcal/mol, respectively, located at positions where the ligand forms metastable interactions with the LBD. Ligand positions in bulk solvent, on the other hand, have free energies of about 3.12 kcal/mol. The ligand traverses Pathway 1 in about half of the trajectories, pausing at site 1 prior to binding at site 0. In Pathway 2, the ligand interacts with sites 2 and 1 prior to binding. In Pathway 3, the ligand transitions from site 3 directly to site 0. Residue-ligand interactions play a role in passing the ligand from each site to the next. In particular, helix F residues (E657, R660, and R661) are involved in interactions at sites 1 and 2 as well as transitions from site 2 to site 1 and from site 1 to site 0. K449 is involved in shuttling the ligand into the binding pocket from site 3. A list of the residues that interact with the ligand at each site is provided in the legend for Figure 2A. An error analysis of the PMF is provided in Figure S2.
The association rate constant calculated from our simulations, kon = 1.4 × 107 M–1 s–1, using the approach of Dror et al. (2011) (see STAR Methods and Table S2), agrees closely with the experimentally measured value of 1.6 × 107 M–1 s–1 for the GluA4 LBD (Abele et al., 2000). To our knowledge, no experimentally measured kon for the GluA2 LBD has been reported, but the sub-millisecond activation lag at 10 mM glutamate reported here and elsewhere is consistent with this value.
Glutamate May Adopt an Inverted Pose during Binding
The lack of preference for binding the α- or γ-carboxylates of glutamate at metastable sites presents a paradox. How is glutamate delivered efficiently into the pose seen in crystallographic experiments? Two of the association trajectories resulted in glutamate binding into the crystallographically observed pose (Armstrong and Gouaux, 2000), in which the ligand’s α-carboxyl group is anchored by R485 in Lobe 1 while the γ-carboxyl group is stabilized by the backbone amine of S654 in Lobe 2 (Figure 3A). The other four trajectories unexpectedly resulted in glutamate binding into an “inverted” pose, in which the γ-carboxyl group binds to Lobe 1 and the α-carboxyl group binds to Lobe 2 (Figure 3B; Figure S3; Movie S2). However, in one simulation (Figure S4; Movie S3; Tdim2 in Table S1), glutamate rotates from the crystallographic pose to the inverted pose, suggesting that interconversion between poses is possible. In this case, the binding cleft was not fully closed. Free energy landscapes governing cleft closure have been described using the two-dimensional order parameter (ξ1, ξ2) (Figure 3C) (Lau and Roux, 2007, Lau and Roux, 2011, Yao et al., 2013, Yu et al., 2016). The extent of cleft closure with glutamate bound in the inverted pose is not as great as that seen in crystal structures or in simulations with the ligand in the crystallographic pose (Figure 3D). It is possible that an extension of Tdim2 could have resulted in the ligand returning to the crystallographic pose. In support of this notion, MD simulations of drug binding to G-protein-coupled receptors showed that a drug, initially bound in a non-crystallographic pose, eventually converted to the crystallographic pose (Dror et al., 2011). Our measurements do not indicate how stable the non-crystallographic, inverted pose is, but this binding mode could cause glutamate to act as a partial agonist with a smaller degree of cleft closure. Individual AMPA receptor activations show substantial sublevel activity, connected to LBD occupancy (Rosenmund et al., 1998). Stochastic fluctuations in the single channel current could additionally reflect dynamic conversions between crystallographic and non-crystallographic ligand poses. Experimental data are not yet available to confirm the physiological relevance of the non-crystallographic binding pose detected in our simulations. Additional biophysical studies are needed to understand how it might contribute to iGluR function.
Unbinding Pathways Mirror Binding Pathways
We also simulated ligand dissociation trajectories, which we initiated from either crystal structure-like configurations in which the LBD is fully closed with glutamate in the crystallographic pose (PDB: 1FTJ) or ligand-docked configurations in which the LBD is semi-closed or open (Table S1). The latter trajectories were continuations of prior ligand-association trajectories. As with the association trajectories, all dissociation trajectories occurred spontaneously. In general, for both the LBD dimer and monomer systems, binding and unbinding pathways appear to be the reverse of each other, with free energy barriers being traversed in opposite order. The ligand exited from the ξ1 side of the binding cleft in all five dissociation events involving the dimer. For the monomer, the ligand exited from the ξ1 side in four dissociation events and from the ξ2 side in two events. In one instance, a ligand that dissociated from the LBD in the crystallographic pose ended up rebinding in the inverted pose (Tmon4 to Tmon1, Table S1).
Disrupting Binding Pathways Selectively Slows Both Activation and Deactivation
The simulations suggest that clusters of charged residues along the binding pathways should interact with glutamate during both association and dissociation. To test this hypothesis, we designed a set of single, double, and triple mutants, removing or reversing the polarity of charged side chains at each metastable site in turn (Figure 4A). We hypothesized that these mutations should alter receptor activation, deactivation, and perhaps recovery from desensitization. Given that the metastable sites are formed by flexible residues lacking interactions with other parts of the receptor, we expected little effect of the mutations on downstream gating conformational changes. Additionally, we expected that entry into desensitization, which likely involves neither binding nor conformational changes of the individual LBDs, should be unaffected.
Association is the first step in the transition from resting to activated states. Therefore, we measured receptor activation by 10 mM glutamate in outside-out patches as a proxy for glutamate association. Anticipating that the mutations could slow activation, we used long pulses (200 ms) to ensure that the peak of the response was reached. This approach conveniently allowed us to measure the rate of desensitization from the same records (see below). Desensitization had minimal effect on the activation time, being ∼50-fold slower. Activation of WT GluA2 by 10 mM glutamate is very fast, with a 10%–90% rise time of 190 ± 30 μs. The rise time is probably slowed by the rate of solution exchange onto the excised patch. Strikingly, a substantial 3-fold increase in the 10%–90% rise time during activation, trise, was observed for R453D and a triple-alanine mutant, R453A-D456A-K458A (denoted RDK-AAA; trise = 610 ± 60 and 730 ± 80 μs, respectively; p < 0.005 versus WT GluA2, t test, n = 3–7; Figures 4B and 4C; Table S3).
We next examined receptor deactivation, a process limited by the glutamate unbinding rate, by applying short (1 ms) pulses of 10 mM glutamate. WT GluA2 deactivates rapidly, with a deactivation time constant, τdeact, of 1.5 ± 0.2 ms. Mutating residues involved in metastable site 1, we observed a robust increase in τdeact for R453D (τdeact = 3.6 ± 0.1 ms; Table S3) and RDK-AAA (τdeact = 3.7 ± 0.1 ms), compared with WT GluA2 (p = 0.003, t test, n = 3–5) (Figure 4D).
Single substitutions on helix F (R660 and R661; sites 1 and 2) had little effect on activation or deactivation, but the triple mutant E657A-R660A-R661A (denoted ERR-AAA, Figure 5A) exhibited the same profile of slower activation (trise = 550 ± 80 μs; Figure 5B; Table S3) and deactivation (τdeact = 3.8 ± 0.4 ms; Figure 5C) as the RDK-AAA mutant. A comparison of EC50 values for WT GluA2 (EC50 = 330 ± 90 μM) and ERR-AAA (EC50 = 410 ± 30 μM) revealed that the apparent affinity of the ERR-AAA mutant for glutamate is similar to that of WT (p = 0.5; t test, n = 3) (Figure 5D). Unfortunately, the poor expression of the RDK-AAA mutant precluded a concentration-response analysis for this mutant. Nonetheless, this result is expected if mutations remove metastable interactions but do not affect the initial or final conformational states, revealing a distinct mechanism to previous reports of LBD mutations that change binding (Robert et al., 2005, Weston et al., 2006).
We also tested the RDK-AAA mutant with 50 mM glutamate to ensure that ligand diffusion was not a factor in slowed activation. Both activation and deactivation remained substantially slower than in WT GluA2 with 50 mM glutamate (trise = 660 ± 70 μs versus 180 ± 40 μs for WT GluA2; p = 0.01 versus WT GluA2, t test, n = 3; τdeact = 3.7 ± 0.1 ms versus 1.2 ± 0.1 ms for WT GluA2; p = 0.0003 versus WT GluA2, t test, n = 3; Figures S5A and S5B; Table S3). This result strongly suggests that the binding kinetics are principally altered by mutations at metastable sites.
In order to determine how the ERR-AAA mutant perturbs glutamate binding, we performed unbiased simulations involving this mutant LBD (Table S4; Movie S4). PMF calculations indicate that this LBD lacks metastable interactions along Pathways 1 and 2, proximal to helix F (Figure 5E). The dominant binding pathway, which does not involve helix F interactions, is similar to Pathway 3 in the WT LBD.
As expected for mutations that perturb only binding kinetics, desensitization was weakly perturbed by mutations to the ligand-binding pathways. The time constant of entry to desensitization, τdesen, for RDK-AAA, ERR-AAA, and single-point mutants were similar to WT GluA2 (Figures S5C, S6A, and S6B; Table S3). For most mutants, the time constant of recovery from desensitization was similar to WT GluA2 (59 ± 4 ms), but the R453D and RDK-AAA mutants recovered about twice as fast (p = 0.01 and p = 0.02, t test, n = 3; Figures S6C and S6D). These results support the idea that entry to and recovery from desensitization occur with the clamshell closed and glutamate stably bound, even though glutamate must eventually unbind during recovery.
The second set of mutants that we generated targeted Pathway 3. The D447A-K449A double mutant in Lobe 1 (DK-AA) slowed activation (trise = 410 ± 40 μs; p = 0.01, versus WT GluA2, t test, n = 4–6; Figures 6A and 6B; Table S3) compared with WT GluA2. The very poor expression of this mutant precluded a robust measurement of deactivation (τdeact = 3.1 ± 0.5 ms; p = 0.1 versus WT GluA2, t test, n = 3; Figure 6C). The R684A-E688A double mutant in Lobe 2 (RE-AA), which targeted site 3, slowed both trise and τdeact to a greater extent (trise = 590 ± 50 μs and τdeact = 4.9 ± 0.7 ms; p < 0.05, t test, n = 3; Figures 6B and 6C). For the RE-AA mutant, we also observed an apparent acceleration in recovery from desensitization (τrec = 13 ± 1 ms, n = 3; Figure S7) compared with WT GluA2, although again, poor expression made proper estimation of the recovery time constant difficult.
Off-Pathway Mutants Have Little Effect on Kinetics
Substantial charge swap mutations on the surface of the LBD could have non-specific effects on binding a charged ligand. In particular, we were concerned that triple mutations in general might slow binding, independent of the pathways we had identified. Therefore, as negative controls, we generated complementary, off-pathway mutations that our simulations predicted did not interact with glutamate during binding and unbinding. Two triple-alanine mutations were generated: K409A-K410A-E422A (denoted KKE-AAA) in Lobe 1 and R715A-K716A-D769A (denoted RKD-AAA) in Lobe 2. These off-pathway mutants had smaller effects on kinetics (trise = 100 ± 5 μs, τdeact = 2.4 ± 0.1 ms for RKD; trise = 310 ± 10 μs, τdeact = 1.1 ± 0.1 ms for KKE; Figures 6D–6F). Their kinetics conformed to previously published mutants that influence closed-cleft stability. Quite distinct from the metastable binding sites presented here, for RKD-AAA, slower deactivation was accompanied by faster activation (Table S3; indicative of an increase in affinity). For KKE-AAA, the results were inverted, with faster deactivation and slower activation (consistent with reduced glutamate affinity). More sophisticated tests of the pathways themselves in the context of the LBD surface will be the subject of future work.
For most of the mutants tested, the decay rate is slowed more profoundly than the opening rate. The decay time constant varies in an approximately linear fashion as a function of the activation time, and changes in the decay are roughly 8-fold larger than that of activation (Figure 7C). Simulated currents using previously published kinetic models of AMPA receptor activation (Robert et al., 2005) show that this relationship is precisely what is expected from slowing glutamate association and dissociation rates by equal amounts. Moreover, these calculations were performed with realistic concentration jump profiles (Lape et al., 2012), indicating the physically plausible solution exchange rate of about 300 μs would be expected to yield a very similar, roughly linear relationship between activation and deactivation times (Figure 7). Notably, the off-pathway mutants KKE-AAA and RKD-AAA (Figures 6D–6F) lie away from the linear relation between activation and decay time (Figure 7C).
Taken together, these results strongly support the hypothesis that these metastable sites predicted in silico form preferential pathways to guide glutamate in and out of its binding site.
Discussion
By combining long, unbiased molecular simulations with direct measurements of receptor kinetics, we show a key role for charged residues in facilitating fast neurotransmitter access to a deep binding site. These studies suggest that neurotransmitter binding is a directed process for which kinetics have been optimized (presumably by evolution) without altering overall ligand affinity. Previous work has shown that electrodiffusion of glutamate in the synaptic cleft speeds up neurotransmission (Sylantyev et al., 2008). Our experiments reveal a strikingly elaborate management of ligand transport by AMPA receptors, whereby flexible positive charges ensure that glutamate binding reactions are fast. The existence of these pathways is surprising, and the fact that they alter the kinetics of receptor activity indicates that the molecular mechanisms that determine the action of neurotransmitters at receptors are more complex than previously thought. R660 is conserved between AMPA and NMDA receptors; in kainate receptors, R660 and R661 are replaced by lysine residues (Figure S8). It is possible that these helix F interactions also coordinate ligand binding in kainate and NMDA receptors. Given that electrostatic interactions are also important for coordination in other neurotransmitter binding sites (McCammon, 2009), these principles of ligand funneling may be general.
STAR★Methods
Key Resources Table
REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Experimental Models: Cell Lines | ||
Human: HEK293 cell line, Female | DSMZ (German Collection of Cell Cultures and Microorganisms | 300192/p777_HEK293 |
Oligonucleotides | ||
Primer: R453D Forward: TATGGGGCCGATGATGCCGAC |
This paper | N/A |
Primer: R453D Reverse: GTCGGCATCATCGGCCCCATA |
This paper | N/A |
Primer: K458D Forward: GATGCCGACACCGATATTTGG |
This paper | N/A |
Primer: K458D Reverse: CCAAATATCGGTGTCGGCATC |
This paper | N/A |
Primer: RDK-AAA Forward: TATGGGGCCGCTGATGCCGCTACCGCTATTTGG |
This paper | N/A |
Primer: RDK-AAA Reverse: CCAAATAGCGGTAGCGGCATCAGCGGCCCCATA |
This paper | N/A |
Primer: R660E Forward: GAGTTTTTCGGAAGATCTAAAATCGCAGTG |
This paper | N/A |
Primer: R660E Reverse: CACTGCGATTTTAGATCTTCCGAAAAACTC |
This paper | N/A |
Primer: R661E Forward: GAGTTTTTCAGGGGATCTAAAATCGCAGTG |
This paper | N/A |
Primer: R661E Reverse: CACTGCGATTTTAGATCCCCTGAAAAACTC |
This paper | N/A |
Primer: ERR-AAA Forward: GGCTCCACTAAAGCTTTTTTCGCTGCTTCTAAAATCGC |
This paper | N/A |
Primer: ERR-AAA Reverse: GCGATTTTAGAAGCAGCGAAAAAAGCTTTAGTGGAGCC |
This paper | N/A |
Primer: DK-AA Forward: ATTGTTGGGGCTGGCGCTTATGGGGCC |
This paper | N/A |
Primer: DK-AA Reverse: GGCCCCATAAGCGCCAGCCCCAACAAT |
This paper | N/A |
Primer: RE-AA Forward: GTGTTTGTGGCTACTACCGCAGCTGGAGTAGCC |
This paper | N/A |
Primer: RE-AA Reverse: GGCTACTCCAGCTGCGGTAGTAGCCACAAACAC |
This paper | N/A |
Primer: K409A, K410A Forward (for KKE-AAA): GTTATGATGGCTGCTAATCATGAA |
This paper | N/A |
Primer: K409A, K410A Reverse (for KKE-AAA): TTCATGATTAGCAGCCATCATAAC |
This paper | N/A |
Primer: E422A Forward (for KKE-AAA): GAGCGTTACGCTGGCTACTGT |
This paper | N/A |
Primer: E422A Reverse (for KKE-AAA): ACAGTAGCCAGCGTAACGCTC |
This paper | N/A |
Primer: R715A, K716A Forward (for RKD-AAA): ATCGAGCAGGCTGCTCCTTGTGAC |
This paper | N/A |
Primer: R715A, K716A Reverse (for RKD-AAA): GTCACAAGGAGCAGCCTGCTCGAT |
This paper | N/A |
Primer: D769A Forward (for RKD-AAA): TGGTGGTACGCTAAAGGTGAATGT |
This paper | N/A |
Primer: D769A Reverse (for RKD-AAA): ACATTCACCTTTAGCGTACCACCA |
This paper | N/A |
Recombinant DNA | ||
GluA2_IRES_eGFP pRK5 vector | Sun et al., 2002 | Mark Mayer’s lab |
Software and Algorithms | ||
CHARMM | Brooks et al., 2009 | https://www.charmm.org/ |
NAMD 2.9 | UIUC | http://www.ks.uiuc.edu/Research/namd/ |
VMD 1.9.1 | UIUC | http://www.ks.uiuc.edu/Research/vmd/ |
Pymol | Schrödinger, LLC | https://www.pymol.org |
Realistic Concentration Jumps (RCJ) scripts | Lape et al., 2012; this paper | https://github.com/aplested/aligator |
IGOR Pro | IGOR Pro | RRID: SCR_000325; http://www.wavemetrics.com/products/igorpro/igorpro.htm |
Axograph | Axograph | RRID: SCR_014284; https://www.axograph.com/ |
Adobe Illustrator | Adobe Systems | RRID: SCR_010279; http://www.adobe.com/products/illustrator.html |
Adobe Photoshop | Adobe Systems | RRID: SCR_014199; https://www.adobe.com/products/photoshop.html |
Contact for Reagent and Resource Sharing
Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Albert Lau (alau@jhmi.edu).
Experimental Model and Subject Details
HEK293 Cell Cultures and Transfections
HEK293 cells, female, were maintained in DMEM (GIBCO) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. For transfection experiments, cells were seeded in 2 mL culture dishes and, 48 hr later, transfected with Calcium phosphate (Sigma) and 2 μg total plasmid DNA.
Method Details
Simulation System Preparation
The initial atomic models for both the monomer and dimer systems were constructed from the crystal structure of the GluA2 ligand-binding core (S1S2) in complex with glutamate (PDB: 1FTJ). Missing amino acid residues were built using the Modloop server (Fiser and Sali, 2003), and missing side chains were built using SCWRL4 (Krivov et al., 2009). Crystallographic waters in the ligand-binding cleft were included. The monomer system, which contained a total of 47,227 atoms, was solvated with 14,369 water molecules and neutralized by adding Na+ and Cl– ions to the bulk solution until the salt concentration was 150 mM NaCl. Periodic boundary conditions were imposed on an orthorhombic cell with approximate dimensions 88 Å × 68 Å × 78 Å. The dimer system, which contained a total of 56,217 atoms, was solvated with 15,951 water molecules and neutralized to maintain 150 mM NaCl. Periodic boundary conditions were imposed on an orthorhombic unit cell of approximate dimensions 96 Å × 78 Å × 78 Å. The system was energy minimized and equilibrated using constant pressure and temperature (NPT) conditions at 1 atm and 300 K with a timestep of 2 fs. The all-atom potential energy function PARAM27 for proteins (MacKerell et al., 1998, 2004) and the TIP3P potential energy function for water (Jorgensen et al., 1983) were used. Electrostatic interactions were computed using the particle mesh Ewald (PME) algorithm and short-range, non-bonded interactions were truncated to 12 Å. The initial protein configuration of the system was relaxed with Langevin dynamics in the presence of harmonic restraints at constant volume for 30 ps before the barostat was switched on at 1 atm for a further 60 ps of simulation in NPT conditions. The cell dimensions were allowed to vary for 2 ns in NPT conditions before reaching the final box size. A 4 ns pre-production run in constant volume and temperature (NVT) conditions was carried out from which five, ligand-bound, starting coordinates for the monomer, and one, ligand-bound, starting coordinates for the dimer were selected for long-timescale simulation. The pre-production run was performed using NAMD 2.9 (Phillips et al., 2005), while minimization and equilibration procedures were performed using CHARMM (Brooks et al., 2009).
System Preparation for the ERR-AAA Simulations
Starting coordinates were selected from trajectory Tmon2, which involved the monomer system containing 10 ligands. Residues E657, R660, and R661 were mutated to alanine in CHARMM by deleting the side chain atoms and replacing with methyl groups. The salt concentration was adjusted to maintain 150 mM NaCl. The mutant system containing 47,080 atoms was energy minimized and briefly equilibrated in a 2 ns pre-production run in constant NVT conditions.
Simulations with Increased Ligand Concentration
Glutamate ligand molecules were initially placed at random positions and orientations in bulk solvent, similar to the approach of Dror et al. (2011). For the LBD monomer, 10 ligands were added at arbitrary positions in bulk solvent, each greater than 20 Å from the binding pocket, to a previously prepared system containing an LBD in an open conformation, derived from the apo crystal structure (PDB: 1FTO). Salt concentration was adjusted for ligand charge to maintain 150 mM NaCl. A 2 ns pre-production run was carried out in constant NVT conditions. For the LBD dimer, 20 ligands were added at arbitrary positions in bulk solvent greater than 20 Å from the binding pocket to a previously prepared system containing open conformations of the LBDs (PDB: 1FTO). Salt concentration was adjusted for ligand charge to maintain 150 mM NaCl. A 2 ns pre-production run was carried out in constant NVT conditions.
MD Simulations
All production runs used the NPT ensemble at 1 atm and 300K. Bond lengths for hydrogen atoms were constrained using the M-SHAKE algorithm (Kräutler et al., 2001). An r-RESPA integrator (Tuckerman et al., 1992) was used with a timestep of 2 fs; long-range electrostatics were computed every 6 fs. Long-range electrostatics interactions were calculated using the k-space Gaussian split Ewald method (Shan et al., 2005) with a 64 Å × 64 Å × 64 Å grid, σ = 2.02 Å, σs = 1.29 Å. Short-range interactions including van der Waals and short-range electrostatics were truncated at 9 Å. To prevent overall rotational and translational motion of the protein, positional harmonic restraints were applied on the backbone atoms of residues 426–428 (residues 37–39 in 1FTJ), residues 474–476 (residues 85–87 in 1FTJ), and residues 490–492 (residues 101–103 in 1FTJ) with a force constant of 0.3 kcal mol−1 Å−2. All productions simulations for the WT protein were carried out on the special purpose Anton machine at the Pittsburgh Supercomputing Center (PSC) (Shaw et al., 2009). Production simulations for the ERR-AAA mutant protein were carried out on the Anton2 machine at the PSC (Shaw et al., 2014). Simulations on Anton2 were carried out as they were on Anton, except using a temperature of 310K, which is the default for Anton2. A total of 21 trajectories were generated for an aggregate simulation time of 49.1 μs: 11.8 μs involved WT dimers, 36.1 μs involved WT monomers, and 1.2 μs involved the ERR-AAA monomer.
Molecular Biology
The mutants for functional studies were generated by overlap PCR on the GluA2flip template (GI: 8393475) in the pRK5 vector. The cDNA encoded a Q at the Q/R editing site. For each mutant, the entire amplified cassette was confirmed by double-stranded DNA sequencing. Numbering refers to the mature polypeptide chain.
Electrophysiology
WT and mutant glutamate receptors were overexpressed in HEK293 cells using calcium phosphate transfection. The external solution contained: 150 mM NaCl, 0.1 mM MgCl2, 0.1 mM CaCl2, and 5 mM HEPES, titrated to pH 7.3 with NaOH, to which we added drugs as required. Drugs were obtained from Ascent Scientific and Sigma. The pipette solution contained: 115 mM NaCl, 10 mM NaF, 0.5 mM CaCl2, 1 mM MgCl2, 5 mM Na4BAPTA, 5 mM HEPES and 10 mM Na2ATP (pH 7.3). The sampling rate was 10 kHz (100 μs time step) and during acquisition the data were filtered at 5 kHz (10%–90% rise time 66 μs). We were restricted to a 5 kHz filter because of the low expression (and hence poor signal to noise) for some of the mutants. We applied ligands to outside out patches via a piezo-driven fast perfusion system. Typical 10%–90% solution exchange times were faster than 300 μs, as measured from junction potentials at the open tip of the patch pipette. Simulations using realistic concentration jumps were done as described (Lape et al., 2012) using a suite of PYTHON scripts (https://github.com/aplested/aligator). The effective decay constant was back-calculated from the 90%–10% decay time assuming a single exponential decay to facilitate comparison. These simulations showed that a solution exchange of 300 μs reproduces all the observed features of glutamate-activated AMPA receptor currents, including the approximately 200 μs rise time of wild-type channels (Figure 7).
Quantification and Statistical Analysis
Ligand Binding PMF
The trajectories containing the monomeric LBD with 10 ligands (Tmon2,3 and Tmut1-4) were sampled at 0.12 ns intervals. The monomeric LBD system was chosen to avoid conformational change between the LBD subunits affecting the density calculations. Systems with 10 ligands were chosen for increased ligand sampling. Cartesian coordinates for the ligand’s non-hydrogen atoms, , were measured and used as three-dimensional order parameters to describe the states along the binding pathway. Each frame in the trajectory was aligned with respect to the backbone atoms of the LBD. The density of atomic positions, , was computed using a hard sphere van der Waals approximation onto a discretized grid with a spacing of 0.5 Å × 0.5 Å × 0.5 Å and subsequently weighted to produce the free energy maps using the standard Boltzmann re-weighting scheme, i.e., . Contour values for the PMF are indicated in the legends of Figures 2 and S2. The statistical uncertainty in the PMF was determined using the approach of block averaging (Zhu and Hummer, 2012) (Figure S2). The trajectory was subdivided into 10 blocks, and a PMF was calculated for each block. The standard deviation in the 10 PMFs was calculated. Using 5–15 blocks all gave qualitatively similar results.
Calculation of kon from Molecular Simulations
where is the total number of binding events, is the time the ligand spends in bulk solvent, is the free ligand concentration, is the number of protein subunits, and i is summed over all simulation systems. kon calculated irrespective of the bound pose of the ligand is 1.4 × 107 M–1 s–1; kon calculated for only the crystallographic pose is 0.5 × 107 M–1 s–1. These values suggest glutamate binding is not diffusion controlled since they are 100 times slower than the association rates of typical diffusion-limited binding processes (e.g., kon ∼109 – 1010 M–1 s–1) (Alberty and Hammes, 1958, Chou and Zhou, 1982). All quantities used in the calculation are provided in Table S2. We did not obtain enough events to accurately calculate a dissociation constant (Pan et al., 2017). Electrostatic steering may play a role in determining the overall association rates of the ligand to the binding site (Wade et al., 1998).
Functional Data Analysis
To measure deactivation and desensitization decay constants, we fitted currents with a single exponential function. The rise times were interpolated from the 10%–90% crossing times of a sigmoid function fitted from the baseline to the peak current. This procedure gave an estimate for the wild-type GluA2 receptor rise time very similar to previously published work (Robert et al., 2005); almost all the mutants we report here had slower rise times. We measured concentration-response curves for WT and the mutant receptor EKK-AAA. We obtained the EC50 and maximum extent of activation relative to glutamate from fits to the Hill equation
where n is the Hill coefficient, Imax is the maximum response, and [A] is the agonist concentration.
To measure recovery from desensitization, we used a two-pulse protocol with a variable interpulse interval. Recovery data were fitted by a Hodgkin-Huxley-type function (Robert and Howe, 2003)
where N is the active fraction of receptors at time t following the first pulse, N0 is the active fraction at the end of the conditioning pulse, and krec is the rate of recovery.
For all datasets, two-tailed unpaired Student’s t tests were used to assess statistical significance between means, where a p value < 0.05 was considered significant. The number of experiments and statistical information are stated in the corresponding figure legends.
Data and Software Availability
Realistic Concentration Jumps (RCJ) scripts are available at https://github.com/aplested/aligator. Data are available upon request from the Lead Contact.
Author Contributions
A.Y. and A.Y.L. designed the molecular simulations and analyzed the data. A.Y. performed the molecular simulations. H.S. and A.J.R.P. designed the electrophysiology and analyzed the data, H.S. performed the electrophysiology, and A.J.R.P. performed the kinetic modeling. A.Y., H.S., A.J.R.P., and A.Y.L. wrote the paper.
Acknowledgments
We thank Jelena Baranovic for comments on the manuscript. Anton computer time was provided by the Pittsburgh Supercomputing Center (PSC) through Grant R01GM116961 from the National Institutes of Health. The Anton machine at PSC was generously made available by D.E. Shaw Research. Resources provided by the Maryland Advanced Research Computing Center (MARCC) at Johns Hopkins University were used. This work was supported by the National Institutes of Health grant R01GM094495 (to A.Y.L.), the ERC grant “GluActive” (647895), and the DFG Cluster of Excellence “NeuroCure” (EXC-257) (to A.J.R.P.). A.J.R.P. is a Heisenberg Professor of the DFG (PL619-3.1). H.S. was the recipient of a fellowship from the Human Frontier Science Program (LT000079/2011-L).
Published: December 14, 2017
Footnotes
Supplemental Information includes eight figures, four tables, and four movies and can be found with this article online at https://doi.org/10.1016/j.neuron.2017.11.024.
Contributor Information
Andrew J.R. Plested, Email: plested@fmp-berlin.de.
Albert Y. Lau, Email: alau@jhmi.edu.
Supplemental Information
References
- Abele R., Keinanen K., Madden D.R. Agonist-induced isomerization in a glutamate receptor ligand-binding domain. A kinetic and mutagenetic analysis. J. Biol. Chem. 2000;275:21355–21363. doi: 10.1074/jbc.M909883199. [DOI] [PubMed] [Google Scholar]
- Alberty R.A., Hammes G.G. Application of the theory of diffusion-controlled reactions to enzyme kinetics. J. Phys. Chem. 1958;62:154–159. [Google Scholar]
- Arinaminpathy Y., Sansom M.S.P., Biggin P.C. Molecular dynamics simulations of the ligand-binding domain of the ionotropic glutamate receptor GluR2. Biophys. J. 2002;82:676–683. doi: 10.1016/S0006-3495(02)75430-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Armstrong N., Gouaux E. Mechanisms for activation and antagonism of an AMPA-sensitive glutamate receptor: crystal structures of the GluR2 ligand binding core. Neuron. 2000;28:165–181. doi: 10.1016/s0896-6273(00)00094-5. [DOI] [PubMed] [Google Scholar]
- Attwell D., Gibb A. Neuroenergetics and the kinetic design of excitatory synapses. Nat. Rev. Neurosci. 2005;6:841–849. doi: 10.1038/nrn1784. [DOI] [PubMed] [Google Scholar]
- Baranovic J., Plested A.J.R. How to build the fastest receptor on earth. Biol. Chem. 2016;397:195–205. doi: 10.1515/hsz-2015-0182. [DOI] [PubMed] [Google Scholar]
- Brooks B.R., Brooks C.L., 3rd, Mackerell A.D., Jr., Nilsson L., Petrella R.J., Roux B., Won Y., Archontis G., Bartels C., Boresch S. CHARMM: the biomolecular simulation program. J. Comput. Chem. 2009;30:1545–1614. doi: 10.1002/jcc.21287. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cheng Q., Du M., Ramanoudjame G., Jayaraman V. Evolution of glutamate interactions during binding to a glutamate receptor. Nat. Chem. Biol. 2005;1:329–332. doi: 10.1038/nchembio738. [DOI] [PubMed] [Google Scholar]
- Chou K.C., Zhou G.P. Role of the protein outside active site on the diffusion-controlled reaction of enzymes. J. Am. Chem. Soc. 1982;104:1409–1413. [Google Scholar]
- Clements J.D., Lester R.A., Tong G., Jahr C.E., Westbrook G.L. The time course of glutamate in the synaptic cleft. Science. 1992;258:1498–1501. doi: 10.1126/science.1359647. [DOI] [PubMed] [Google Scholar]
- Dai J., Zhou H.-X. Semiclosed conformations of the ligand-binding domains of NMDA receptors during stationary gating. Biophys. J. 2016;111:1418–1428. doi: 10.1016/j.bpj.2016.08.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dror R.O., Pan A.C., Arlow D.H., Borhani D.W., Maragakis P., Shan Y., Xu H., Shaw D.E. Pathway and mechanism of drug binding to G-protein-coupled receptors. Proc. Natl. Acad. Sci. USA. 2011;108:13118–13123. doi: 10.1073/pnas.1104614108. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fiser A., Sali A. ModLoop: automated modeling of loops in protein structures. Bioinformatics. 2003;19:2500–2501. doi: 10.1093/bioinformatics/btg362. [DOI] [PubMed] [Google Scholar]
- Jorgensen W.L., Chandrasekhar J., Madura J.D., Impey R.W., Klein M.L. Comparison of simple potential functions for simulating liquid water. J. Chem. Phys. 1983;79:926. [Google Scholar]
- Kräutler V., van Gunsteren W.F., Hünenberger P.H. A fast SHAKE algorithm to solve distance constraint equations for small molecules in molecular dynamics simulations. J. Comput. Chem. 2001;22:501–508. [Google Scholar]
- Krivov G.G., Shapovalov M.V., Dunbrack R.L., Jr. Improved prediction of protein side-chain conformations with SCWRL4. Proteins. 2009;77:778–795. doi: 10.1002/prot.22488. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lape R., Plested A.J.R., Moroni M., Colquhoun D., Sivilotti L.G. The α1K276E startle disease mutation reveals multiple intermediate states in the gating of glycine receptors. J. Neurosci. 2012;32:1336–1352. doi: 10.1523/JNEUROSCI.4346-11.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lau A.Y., Roux B. The free energy landscapes governing conformational changes in a glutamate receptor ligand-binding domain. Structure. 2007;15:1203–1214. doi: 10.1016/j.str.2007.07.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lau A.Y., Roux B. The hidden energetics of ligand binding and activation in a glutamate receptor. Nat. Struct. Mol. Biol. 2011;18:283–287. doi: 10.1038/nsmb.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lisman J.E., Raghavachari S., Tsien R.W. The sequence of events that underlie quantal transmission at central glutamatergic synapses. Nat. Rev. Neurosci. 2007;8:597–609. doi: 10.1038/nrn2191. [DOI] [PubMed] [Google Scholar]
- MacKerell A.D., Bashford D., Bellott M., Dunbrack R.L., Evanseck J.D., Field M.J., Fischer S., Gao J., Guo H., Ha S. All-atom empirical potential for molecular modeling and dynamics studies of proteins. J. Phys. Chem. B. 1998;102:3586–3616. doi: 10.1021/jp973084f. [DOI] [PubMed] [Google Scholar]
- Mackerell A.D., Jr., Feig M., Brooks C.L., 3rd Extending the treatment of backbone energetics in protein force fields: limitations of gas-phase quantum mechanics in reproducing protein conformational distributions in molecular dynamics simulations. J. Comput. Chem. 2004;25:1400–1415. doi: 10.1002/jcc.20065. [DOI] [PubMed] [Google Scholar]
- Mamonova T., Yonkunas M.J., Kurnikova M.G. Energetics of the cleft closing transition and the role of electrostatic interactions in conformational rearrangements of the glutamate receptor ligand binding domain. Biochemistry. 2008;47:11077–11085. doi: 10.1021/bi801367d. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mayer M.L. Emerging models of glutamate receptor ion channel structure and function. Structure. 2011;19:1370–1380. doi: 10.1016/j.str.2011.08.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mayer M.L. Structural biology of glutamate receptor ion channel complexes. Curr. Opin. Struct. Biol. 2016;41:119–127. doi: 10.1016/j.sbi.2016.07.002. [DOI] [PubMed] [Google Scholar]
- McCammon J.A. Darwinian biophysics: electrostatics and evolution in the kinetics of molecular binding. Proc. Natl. Acad. Sci. USA. 2009;106:7683–7684. doi: 10.1073/pnas.0902767106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mendieta J., Gago F., Ramírez G. Binding of 5′-GMP to the GluR2 AMPA receptor: insight from targeted molecular dynamics simulations. Biochemistry. 2005;44:14470–14476. doi: 10.1021/bi051084x. [DOI] [PubMed] [Google Scholar]
- Okada O., Odai K., Sugimoto T., Ito E. Molecular dynamics simulations for glutamate-binding and cleft-closing processes of the ligand-binding domain of GluR2. Biophys. Chem. 2012;162:35–44. doi: 10.1016/j.bpc.2011.12.004. [DOI] [PubMed] [Google Scholar]
- Pan A.C., Xu H., Palpant T., Shaw D.E. Quantitative characterization of the binding and unbinding of millimolar drug fragments with molecular dynamics simulations. J. Chem. Theory Comput. 2017;13:3372–3377. doi: 10.1021/acs.jctc.7b00172. [DOI] [PubMed] [Google Scholar]
- Phillips J.C., Braun R., Wang W., Gumbart J., Tajkhorshid E., Villa E., Chipot C., Skeel R.D., Kalé L., Schulten K. Scalable molecular dynamics with NAMD. J. Comput. Chem. 2005;26:1781–1802. doi: 10.1002/jcc.20289. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Postila P.A., Swanson G.T., Pentikäinen O.T. Exploring kainate receptor pharmacology using molecular dynamics simulations. Neuropharmacology. 2010;58:515–527. doi: 10.1016/j.neuropharm.2009.08.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Robert A., Howe J.R. How AMPA receptor desensitization depends on receptor occupancy. J. Neurosci. 2003;23:847–858. doi: 10.1523/JNEUROSCI.23-03-00847.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Robert A., Armstrong N., Gouaux J.E., Howe J.R. AMPA receptor binding cleft mutations that alter affinity, efficacy, and recovery from desensitization. J. Neurosci. 2005;25:3752–3762. doi: 10.1523/JNEUROSCI.0188-05.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rosenmund C., Stern-Bach Y., Stevens C.F. The tetrameric structure of a glutamate receptor channel. Science. 1998;280:1596–1599. doi: 10.1126/science.280.5369.1596. [DOI] [PubMed] [Google Scholar]
- Rudolph S., Tsai M.-C., von Gersdorff H., Wadiche J.I. The ubiquitous nature of multivesicular release. Trends Neurosci. 2015;38:428–438. doi: 10.1016/j.tins.2015.05.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sahai M.A., Biggin P.C. Quantifying water-mediated protein-ligand interactions in a glutamate receptor: a DFT study. J. Phys. Chem. B. 2011;115:7085–7096. doi: 10.1021/jp200776t. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shan Y., Klepeis J.L., Eastwood M.P., Dror R.O., Shaw D.E. Gaussian split Ewald: a fast Ewald mesh method for molecular simulation. J. Chem. Phys. 2005;122:54101. doi: 10.1063/1.1839571. [DOI] [PubMed] [Google Scholar]
- Shaw, D.E., Dror, R.O., Salmon, J.K., Grossman, J.P., Mackenzie, K.M., Bank, J.A., Young, C., Deneroff, M.M., Batson, B., Bowers, K.J., et al. (2009). Millisecond-Scale Molecular Dynamics Simulations on Anton. In Proceedings of the ACM/IEEE Conference on Supercomputing (ACM), 1–11.
- Shaw D.E., Grossman J.P., Bank J.A., Batson B., Butts J.A., Chao J.C., Deneroff M.M., Dror R.O., Even A., Fenton C.H. IEEE; 2014. Anton 2: Raising the Bar for Performance and Programmability in a Special-Purpose Molecular Dynamics Supercomputer; pp. 41–53. [Google Scholar]
- Speranskiy K., Kurnikova M. On the binding determinants of the glutamate agonist with the glutamate receptor ligand binding domain. Biochemistry. 2005;44:11508–11517. doi: 10.1021/bi050547w. [DOI] [PubMed] [Google Scholar]
- Sun Y., Olson R., Horning M., Armstrong N., Mayer M., Gouaux E. Mechanism of glutamate receptor desensitization. Nature. 2002;417:245–253. doi: 10.1038/417245a. [DOI] [PubMed] [Google Scholar]
- Sylantyev S., Savtchenko L.P., Niu Y.-P., Ivanov A.I., Jensen T.P., Kullmann D.M., Xiao M.-Y., Rusakov D.A. Electric fields due to synaptic currents sharpen excitatory transmission. Science. 2008;319:1845–1849. doi: 10.1126/science.1154330. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Traynelis S.F., Wollmuth L.P., McBain C.J., Menniti F.S., Vance K.M., Ogden K.K., Hansen K.B., Yuan H., Myers S.J., Dingledine R. Glutamate receptor ion channels: structure, regulation, and function. Pharmacol. Rev. 2010;62:405–496. doi: 10.1124/pr.109.002451. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tuckerman M., Berne B.J., Martyna G.J. Reversible multiple time scale molecular dynamics. J. Chem. Phys. 1992;97:1990. [Google Scholar]
- Wade R.C., Gabdoulline R.R., Lüdemann S.K., Lounnas V. Electrostatic steering and ionic tethering in enzyme-ligand binding: insights from simulations. Proc. Natl. Acad. Sci. USA. 1998;95:5942–5949. doi: 10.1073/pnas.95.11.5942. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Weston M.C., Gertler C., Mayer M.L., Rosenmund C. Interdomain interactions in AMPA and kainate receptors regulate affinity for glutamate. J. Neurosci. 2006;26:7650–7658. doi: 10.1523/JNEUROSCI.1519-06.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wolter T., Steinbrecher T., Elstner M. Computational study of synthetic agonist ligands of ionotropic glutamate receptors. PLoS ONE. 2013;8:e58774. doi: 10.1371/journal.pone.0058774. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yao Y., Belcher J., Berger A.J., Mayer M.L., Lau A.Y. Conformational analysis of NMDA receptor GluN1, GluN2, and GluN3 ligand-binding domains reveals subtype-specific characteristics. Structure. 2013;21:1788–1799. doi: 10.1016/j.str.2013.07.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yu A., Alberstein R., Thomas A., Zimmet A., Grey R., Mayer M.L., Lau A.Y. Molecular lock regulates binding of glycine to a primitive NMDA receptor. Proc. Natl. Acad. Sci. USA. 2016;113:E6786–E6795. doi: 10.1073/pnas.1607010113. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhu F., Hummer G. Convergence and error estimation in free energy calculations using the weighted histogram analysis method. J. Comput. Chem. 2012;33:453–465. doi: 10.1002/jcc.21989. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.