Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2018 Jan 13;8(1):76. doi: 10.1007/s13205-018-1086-5

Simultaneous detection of Escherichia coli O157:H7, Staphylococcus aureus and Salmonella by multiplex PCR in milk

Caijiao Wei 1, Junliang Zhong 1, Ting Hu 1, Xihong Zhao 1,✉
PMCID: PMC5767162  PMID: 29354387

Abstract

Escherichia coli O157:H7, Staphylococcus aureus, and Salmonella are food-borne pathogens that cause serious gastrointestinal illness and frequent food safety accidents. This study aimed to develop a practical multiplex polymerase chain reaction (mPCR) technique for the simultaneous detection of these food-borne pathogens in culture broth and artificial food matrix. Pathogen-specific DNA sequences in the rfbE, nuc, and invA genes were used as targets to design primers for the identification of E. coli O157:H7, S. aureus, and Salmonella, respectively. As expected, the method produced species-specific bands of amplified products without any contaminating non-specific bands. The highest species specificity was established with primer concentrations of 0.1, 0.2, and 0.4 μM for E. coli O157:H7, S. aureus, and Salmonella, correspondingly. The detection sensitivity of this assay was 103 CFU/mL in culture broth, and the limit of detection was consistent with singleplex PCR in the food sample. The mPCR assay proposed here is an easy and convenient detection method, which will be valuable for microbial epidemiology and food safety investigations.

Keywords: Multiplex PCR, Escherichia coli O157:H7, Staphylococcus aureus, Salmonella, Detection method

Introduction

In recent years, the situation of food safety has become critical and with the frequent emergence of various types of food safety incidents, it is important to find a solution to resolve those global problems. Among food safety incidents, food-borne pathogens are an important component of food safety, as they increase security risks and are of tremendous threat to people’s health and well-being (Zhao et al. 2017a). Therefore, the identification and control of food-borne pathogens are essential for food safety. Escherichia coli O157:H7 (Cowley et al. 2016; Poolman and Wacker 2016), Staphylococcus aureus (Zhao et al. 2016; Miao et al. 2016), and Salmonella (Wallace et al. 2014) are regarded as the three most important food-borne pathogens that are found in many foods and are also the cause of frequent food poisoning (Zhao et al. 2017b). The effective prevention and control of food-borne diseases depends on the accuracy of the detection technology. The current routine detection of food-borne pathogens at an international or national level still relies on the traditional microbiological techniques of separation, cultivation, and biochemical identification of the pathogens. However, the conventional methods have difficulties in meeting the challenges and demands of the new enterprises and the requirements of the related regulatory authorities for rapid and accurate detection of these pathogens (Zhao et al. 2013a; Li et al. 2017; Zhong and Zhao 2017). Therefore, there is some urgency in establishing a rapid, accurate, and efficient method for the detection of these food-borne pathogens.

Compared with the classical microbiological methods, polymerase chain reaction (PCR) is the most widely applied technology to date due to its advantages of short analysis time, low detection limit, and high specificity and automation potential (Forghani et al. 2016; Jiyeon et al. 2010; Löfström et al. 2010; Cantekin et al. 2015). To further increase the advantages of PCR, multiplex polymerase chain reaction (mPCR) has been developed to detect several pathogens together. Multiplex PCR technology is based on the PCR technology, which can amplify multiple fragments in a unique reaction system (Elizaquível and Aznar 2008; Kawasaki et al. 2010; Singh et al. 2012). Although the development of PCR is relatively mature, research on mPCR is still being conducted (Ertas et al. 2010; Pelisser et al. 2009). The objective of this study was to develop mPCR method for the detection of E. coli O157:H7, S. aureus, and Salmonella that can be applied to food samples and reduce the potential hazards of these harmful pathogens.

Materials and methods

Bacterial strain

Reference strains of Salmonella (ATCC 13076), S. aureus (ATCC 27664), and enterohemorrhagic E. coli O157:H7 (ATCC 47895) were used as positive controls in this study. E. coli (non-O157:H7, ATCC 25922), Pseudomonas aeruginosa (ATCC 27853), Listeria monocytogenes (ATCC 15313, 19115, 19119, 19111, 19113), Bacillus cereus (ATCC 13061, 11778, 12480, 14579, 25621, 53522), and Vibrio parahaemolyticus (ATCC 17802) were utilized as negative controls. All the strains (Table 2), obtained from the American Type Culture Collection (ATCC, USA), were preserved at − 20 °C in our laboratory until use.

Table 2.

Experimental bacteria and primer specificity verification

Bacteria Origin ID (strain ID) Target gene
rfbE nuc invA
E. coli O157:H7 ATCC 47895 + − −
S. aureus ATCC 27664 − + −
Salmonella enteritidis ATCC 13076 − − +
P. aeruginosa ATCC 27853 − − −
L. monocytogenes ATCC 15313
L. monocytogenes ATCC 19115 − − −
L. monocytogenes ATCC 19119 − − −
L. monocytogenes ATCC 19111 − − −
L. monocytogenes ATCC 19113 − − −
E. coli (non O157:H7) ATCC 25922 − − −
B. cereus ATCC 13061 − − −
B. cereus ATCC 11778 − − −
B. cereus ATCC 12480 − − −
B. cereus ATCC 14579 − − −
B. cereus ATCC 25621 − − −
B. cereus ATCC 53522 − − −
V. parahaemolyticus ATCC 17802 − − −
Open in a new tab

Result (+/−) indicates positive and negative signals

Primers

The gene targets chosen were the invA gene for Salmonella., the nuc gene for S. aureus, and the rfbE gene for E. coli O157:H7, since they were described in the recent literature as being among the most specific and reliable genetic targets for the considered microorganisms. The primer sequences employed for the detection of the three test organisms are presented in Table 1. All primers were synthesized by Tianyi Biotech (Wuhan, China).

Table 1.

Sequences and parameters of primers

Microorganism Target gene Primer sequence (5′–3′) G+C (%) Tm (°C) Amplicon length (bp) References
E. coli
O157:H7
(ATCC 47895)		 rfbE F:GCCACCCCCATTTTCGTTG
R:TCCTCTCTTTCCTCTGCGGT		 57.9
47.4		 63.2
51.7		 601 In this work
S. aureus (ATCC 27664) nuc F:TACAGGTGACTGCGGGCTTATC
R:CTTACCGGGCAATACACTCACTA		 50
45.4		 60.2
58.3		 484 Xu et al. (2006)
Salmonella
(ATCC 13076)		 invA F:CTTTAGCCAAGCCTTGACGAAC
R:AAAGGCAATACGCAAAGAGGT		 54.5
47.8		 62.1
60.6		 284 Xu et al. (2006)
Open in a new tab

DNA template extraction

The strains were inoculated on Luria–Bertani (LB) broth solid medium at 37 °C for 24 h and then cultured in LB liquid medium at 37 °C with 190 rpm for 12 h. Genomic DNA was extracted by thermal lysis according to the procedures described in previous research (Zhao et al. 2013b; Sun et al. 2014). Briefly, 1 mL of the cell suspension was centrifuged at 10,000×g for 5 min. Then, the supernatant was removed, the cell pellets were washed three times with physiological saline, followed by centrifugation at 10,000×g for 5 min. Further, the pelleted cells were used for DNA extraction. The cells suspended with Tris–EDTA Triton buffer solution were boiled in a water bath for 10 min, followed by immediate immersion in ice, where they remained for 10 min, and centrifugation at 10,000×g for 10 min. The supernatant containing DNA was treated as a template.

Reaction system and conditions

The PCR was performed in a final volume of the reaction mixture of 25 μL. The following master mix composition was used: 0.5 μL of TaKaRa Taq™ DNA polymerase (5 U/μL), 2.5 μL of TaKaRa Taq™ 10× PCR buffer (Mg2+ plus), 2.0 μL of dNTP mixture (2.5 mmoL/L), 1 μL of DNA templates, 1 μL of upstream primers, and 1 μL of downstream primers (TaKaRa Biotech, Dalian, China). Then, the volume was filled up to 25 μL with ultra-pure water. The PCR amplification was performed with an initial denaturation at 94 °C for 5 min, and then 30 cycles of denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, and elongation at 72 °C for 30 s, followed by 10 min of final extension at 72 °C in a Life Pro Thermal Cycler (Hangzhou Bioer Technology Co. Ltd., Hangzhou, China). Upon completion of the reaction, all PCR amplification products were detected by 2% agarose gel electrophoresis followed by imaging using the BD-3000 Gel Image Analysis system (Beijing QHBODA Technology Co., Ltd., Beijing, China). According to the protocol detailed in previous investigations (Zhang et al. 2014), the optimal PCR conditions were determined by optimization of the ratio of the three bacterial primer concentrations and the annealing temperature of PCR. To optimize the conditions, the reactions were designed with different temperatures and primer concentration ratios.

Specificity of mPCR

To verify the specificity of target primers, three pairs of primers with random combinations of DNA templates (E. coli O157:H7, S. aureus, and Salmonella) were added into the reaction mixture and were amplified by the optimized mPCR conditions. Meanwhile, the negative controls in mPCR reaction were also subjected to evaluation.

Sensitivity of mPCR

The sensitivity of the mPCR assay was tested using serial dilutions of each overnight-grown bacterial liquid culture. E. coli O157:H7 (ATCC 47895), S. aureus (ATCC 27664) and Salmonella (ATCC 13076) were incubated in fresh sterile nutrient broth medium at 37 °C for 12 h with shaking. The three bacterial numbers of colonies were, respectively, confirmed to be 4.36 × 109, 2.14 × 109, and 3.6 × 109 CFU/mL by the plate counting method. All target bacterial cell suspensions were diluted with normal saline ten times, ranging from 109 to 101 CFU/mL, and DNA was extracted using the above-mentioned method, subsequently tested by the optimized mPCR conditions.

Analysis of food artificially contaminated with E. coli O157:H7, S. aureus, and Salmonella

Each overnight-grown bacterial liquid culture was subjected to counting by the method of enumeration of microorganisms. The quantity of E. coli O157:H7 was approximately 5.1 × 108 CFU/mL, of S. aureus was about 3.0 × 108 CFU/mL, and of Salmonella was around 2.6 × 108 CFU/mL. Then, dilution was performed with physiological saline gradient. Contamination of aseptic deluxe pure milk (Inner Mongolia Mengniu Dairy Co., Ltd. Inner Mongolia, China) was performed with bacterial concentrations ranging from 101 CFU/mL to 108 CFU/mL. All samples were subjected to DNA extraction and mPCR sensitivity tests.

Results and discussion

Specificity of singleplex PCR

Details on the specificity of single PCR are presented in Fig. 1 and Table 2. The amplified fragment of E. coli O157:H7 between 500 and 750 bp was 601 bp, of S. aureus near 500 bp was 484 bp, and of Salmonella within 250–500 bp was 284 bp (Fig. 1). As can be seen from Table 2, P. aeruginosa, L. monocytogenes, and other non-target strains had no non-specific amplified bands of the target gene of rfbE, nuc, and invA. Each PCR amplification reaction generated a unique DNA fragment with the expected size, without producing PCR products from non-target species, which indicated that each primer set was highly species specific.

Fig. 1.

Fig. 1

Open in a new tab

Agarose gel electrophoresis of simplex PCR products. M: DL 2000 DNA marker; lane 1–4 are E. coli O157:H7, S. aureus, Salmonella spp., and negative control, respectively

Reaction conditions of the mPCR assay

Through the optimization of multiple PCR annealing temperatures, we obtained finally the optimal annealing temperature of 57 °C. The optimized reaction conditions were as follows: pre-denaturation at 94 °C for 5 min, denaturalization at 94 °C for 30 s, annealing at 57 °C for 30 s, extension at 72 °C for 30 s, 30 cycles of amplification, and a final extension at 72 °C for 10 min. Meanwhile, three types of bacterial target primers of concentration ratio were explored and repeatedly optimized by the optimization of multiple PCR (Fig. 2). As can be seen from the figure, optimal results of the mPCR assay were obtained at primer concentrations of E. coli O157:H7, S. aureus, and Salmonella of 0.1, 0.2, and 0.4, correspondingly. In contrast, under the conditions of the other primer concentrations, not all respective fragments were completely amplified, because of the competition between the three pairs of primers, which affected the PCR amplification results.

Fig. 2.

Fig. 2

Open in a new tab

The optimization of primer concentration ratio. M: DL 2000 DNA marker; the optimization of the primer concentration of E. coli O157:H7, S. aureus, and Salmonella (μM/L) were as follows: 1: 0.08, 0.16, 0.08; 2: 0.1, 0.2, 0.1; 3: 0.4, 0.8, 0.4; 4: 0.1, 0.2, 0.4; 5: 0.1, 0.2, 0.3

Specificity and sensitivity of mPCR

To evaluate the specificity, each reaction mixture, including three pairs of primers with random combinations of DNA templates, was amplified using the optimized mPCR conditions. In Fig. 3a, it can be observed that each primer could amplify the respective fragment only with the target template. The results of sensitivity of mPCR are illustrated in Fig. 3b. As determined by the agarose gel electrophoresis, the sensitivity of the detection limit achieved was 103 CFU/mL for the three bacteria. These results are in agreement with the marginal capacity of the PCR detection method.

Fig. 3.

Fig. 3

Open in a new tab

The specificity and sensitivity of mPCR. a The specificity test of the mPCR. M: DL 2000 DNA marker; lane 1: E. coli O157:H7, S. aureus, Salmonella; lane 2: E. coli O157:H7, S. aureus; lane 3: E. coli O157:H7, Salmonella; lane 4: S. aureus, Salmonella; lane 5: E. coli O157:H7; lane 6: S. aureus; lane 7: Salmonella; lane 8: negative control. b The sensitivity test of the mPCR. M: DL 2000 DNA marker; lane 1–9, varying concentrations of bacterial suspension (109,108, 107, 106, 105, 104, 103, 102 and 101 CFU/mL)

Testing of artificially contaminated food produce

The PCR in our examination was so sensitive that the presence of other macromolecules (such as fat, protein, and carbohydrates) in the reaction system might have obstructed the amplification reaction of the target sequences. We found that the complex matrix macromolecules available in the reaction system acted as inhibitors that reduced the sensitivity of PCR. Since more interference factors exist in the complex food matrix composition that influences the detection of the target bacteria, in this study, we used mPCR and singleplex PCR for identification of the artificially contaminated samples. Food samples consisting of aseptic milk, contaminated with E. coli O157:H7, S. aureus, and Salmonella, were utilized in this investigation. The results presented in Fig. 4 indicate the limits for detection of E. coli O157:H7, S. aureus, and Salmonella in the aseptic milk by singleplex PCR: 104, 105 and 104 CFU/mL, respectively. Our findings also indicate that the detection of S. aureus was not characterized by higher sensitivity than that of E. coli O157:H7 and Salmonella in the artificially contaminated food product. The incomplete release of plasmid DNA during the DNA extraction process could be due to the fact that S. aureus is a Gram-positive bacterium with thick and tough cell walls. As outlined earlier, the sensitivity of the mPCR assay was evaluated using aseptic milk artificially contaminated with three pathogenic bacteria, which is schematically depicted in Fig. 4d. Although the composition of the food matrix was more complex than that of the pure culture system, the detection sensitivity for the artificially simulated food contamination was slightly lower than that for the pure medium utilized in this experiment. In addition, the mPCR sensitivity was consistent with that of the singleplex PCR performed in aseptic milk. The results obtained clearly suggest that mPCR has good practicability, reliability, and excellent potential for the detection of contamination of food samples.

Fig. 4.

Fig. 4

Open in a new tab

Sensitivity of PCR in milk. a Sensitivity of PCR procedures for detecting E. coli O157:H7 in milk. M: DL 2000 DNA marker; lane 1–8, varying concentrations of bacterial suspension (108, 107, 106, 105, 104, 103, 102 and 101 CFU/mL); b sensitivity of PCR procedures for detecting S. aureus in milk. M: DL 2000 DNA marker; lane 1–8, varying concentrations of bacterial suspension (108, 107, 106, 105, 104, 103, 102 and 101 CFU/mL); c sensitivity of PCR procedures for detecting Salmonella in milk. M: DL 2000 DNA marker; lane 1–8, varying concentrations of bacterial suspension (108, 107, 106, 105, 104, 103, 102 and 101 CFU/mL); d sensitivity of mPCR in food sample. M: DL 2000 DNA marker; lane 1–8, varying concentrations of bacterial suspension (108, 107, 106, 105, 104, 103, 102 and 101 CFU/mL)

On the whole, E. coli O157:H7, S. aureus, and Salmonella are the most common causative agents of bacterial food poisoning outbreaks that cause millions of cases of human illness every year, resulting in major public health issues and substantial economic burden (Vugia et al. 2010). Therefore, rapid and accurate pathogen detection methods are required for the reduction of the effects of microbial risk factors. Conventional detection methods are based on selective plating combined with immunological or biochemical identification, which necessitates long time and high labor intensity (Abubakar et al. 2007). PCR assays using specific primers have been indicated to be efficient for the detection of pathogenic bacteria in food products (Lee et al. 2008). They are simpler and quicker than conventional methods. However, single-species PCR systems are laborious and logistically complex. At the same time, some researchers found that mPCR, used for the identification of pathogens isolated by conventional methods, had the potential to be used in routine diagnostic laboratories and ensured the obtaining of presumptive positive results (Saeki et al. 2013). Owing to the simultaneous amplification of more than one locus in a single reaction tube, mPCR has been identified as a rapid and convenient screening assay, with both clinical and research applications (Park et al. 2006). In this paper, the setting of mPCR method for the simultaneous detection of E. coli O157:H7, S. aureus, and Salmonella has been described and tested. The selection of pathogen-specific target genes and the design of compatible PCR primers are critical steps to achieving high detection specificity and avoidance of the competition in the multiplex target amplifications (Suo et al. 2010). Thus, on the basis of literature search and sequence homology analyses, in this study, we selected the rfbE, nuc, and invA genes as the target sequences for the detection of E. coli O157:H7, S. aureus, and Salmonella, respectively. In an earlier examination, Park et al. used Stx2A, the specific primer for E. coli O157:H7; Its, the specific primer for Salmonella; Cap8A-B, the specific primer for S. aureus; and Hly as the specific primer for L. monocytogenes mPCR to detect the pathogen DNA, the concentrations of which ranged from approximately 0.45 to 0.05 pM/μL (Park et al. 2006). Germini et al. (2009) reported that the mPCR assay was employed for the specificity and sensitivity detection of E. coli O157:H7, Salmonella and L. monocytogenes in liquid whole egg, and the limit of detection could be decreased to 10 cells/25 g. Our results showed that the mPCR assay was able to successfully detect E. coli O157:H7, S. aureus, Salmonella in both culture broth and a model food system. The limit of detection of those three pathogenic bacteria achieved was 103 CFU/mL in the culture broth, whereas it was 104 CFU/mL in the model food system. The sensitivity difference may be due to the different composition of the complex food matrix from that of the culture broth. In contrast, these detection sensitivity levels are consistent with the ones obtained by PCR for E. coli O157:H7, S. aureus, and Salmonella in the complex food matrix. The sensitivity for detection of S. aureus was lower than that for detection of E. coli O157:H7 and Salmonella. This result can be explained by the fact that S. aureus is a Gram-positive bacterium that could not completely release its plasmid DNA during the DNA extraction process. In this study, we chose to use the thermal lysis method to extract DNA because the boiling method saved time and eliminated the need for intensive labor (Zhang et al. 2014), although the microbial DNA isolation kit can be useful in reducing PCR inhibitors in pure bacterial cultures or food matrices (Yang et al. 2012). In addition, the newly developed mPCR system effectively eliminated the inhibitors by the re-suspension of the DNA samples from the boiled bacteria after the template dilution (Ceuppens et al. 2010). Nevertheless, the present method has some shortcomings, and its sensitivity could be further improved using various approaches. However, it is encouraging that the typical amounts of DNA used in any PCR appear to be sufficient for this type of detection. In addition, the sensitivity levels of mPCR were consistent with those for E. coli O157:H7, S. aureus, and Salmonella established in complex food matrix by PCR. In other words, the mPCR detection system has good stability and sensitivity.

In conclusion, a rapid and sensitive mPCR assay was developed to simultaneously detect E. coli O157:H7, S. aureus, and Salmonella, which was performed on a complex food matrix. The use of this method for detection of the here-studied three food-borne pathogens in food matrices is rapid and reliable. It is also an easy and convenient test that can be used for improvements in food sanitation and the maintenance of adequate food safety. Furthermore, it is likely to become a potential and valuable tool for the rapid identification of food-borne pathogens utilized by the personnel of food-monitoring agencies and commercial enterprises, and would potentially facilitate the further development of international trade.

Acknowledgements

This work has been supported by the National Natural Science Foundation of China (Grant no. 31501582) and open project program of key laboratory for Green Chemical Process of Ministry of Education in Wuhan Institute of Technology (2017007).

Compliance with ethical standards

Conflict of interest

All authors declare that they have no conflicts of interest.

Ethical approval

This article does not contain any studies with human participants or animals performed by any of the authors.

Informed consent

Not applicable.

References

  1. Abubakar I, Irvine L, Aldus CF, Wyatt GM, Fordham R, Schelenz S, Shepstone L, Howe A, Peck M, Hunter PR. A systematic review of the clinical, public health and cost-effectiveness of rapid diagnostic tests for the detection and identification of bacterial intestinal pathogens in faeces and food. Health Technol Assess. 2007;11(36):1–216. doi: 10.3310/hta11360. [DOI] [PubMed] [Google Scholar]
  2. Cantekin C, Ergun Y, Solmaz H, Özmen GÖ, Demi̇r M, Saidi R. PCR assay with host specific internal control for Staphylococcus aureus from bovine milk samples. Maced Vet Rev. 2015;38(1):97–100. [Google Scholar]
  3. Ceuppens S, Boon N, Rajkovic A, Heyndrickx M, Wiele TVD, Uyttendaele M. Quantification methods for Bacillus cereus vegetative cells and spores in the gastrointestinal environment. J Microbiol Methods. 2010;83(2):202–210. doi: 10.1016/j.mimet.2010.09.009. [DOI] [PubMed] [Google Scholar]
  4. Cowley LA, Dallman TJ, Fitzgerald S, Irvine N, Rooney PJ, McAteer SP, Day M, Perry NT, Bono JL, Jenkins C. Short-term evolution of Shiga toxin-producing Escherichia coli O157:H7 between two food-borne outbreaks. Microbial Genom. 2016;2(9):e000084. doi: 10.1099/mgen.0.000084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Elizaquível P, Aznar R. A multiplex RTi-PCR reaction for simultaneous detection of Escherichia coli O157:H7, Salmonella spp. and Staphylococcus aureus on fresh, minimally processed vegetables. Food Microbiol. 2008;25(5):705–713. doi: 10.1016/j.fm.2008.03.002. [DOI] [PubMed] [Google Scholar]
  6. Ertas N, Gonulalan Z, Yi̇ldi̇ri̇m Y, Kum E. Detection of Staphylococcus aureus enterotoxins in sheep cheese and dairy desserts by multiplex PCR technique. Int J Food Microbiol. 2010;142(1–2):74–77. doi: 10.1016/j.ijfoodmicro.2010.06.002. [DOI] [PubMed] [Google Scholar]
  7. Forghani F, Wei S, Oh DH. A rapid multiplex real-time PCR high-resolution melt curve assay for the simultaneous detection of Bacillus cereus, Listeria monocytogenes, and Staphylococcus aureus in Food. J Food Prot. 2016;79(5):821–824. doi: 10.4315/0362-028X.JFP-15-428. [DOI] [PubMed] [Google Scholar]
  8. Germini A, Masola A, Carnevali P, Marchelli R. Simultaneous detection of Escherichia coli O175:H7, Salmonella spp., and Listeria monocytogenes by multiplex PCR. Food Control. 2009;20(8):733–738. doi: 10.1016/j.foodcont.2008.09.010. [DOI] [Google Scholar]
  9. Jiyeon H, Ingyun H, Hyosun K, Chankyu P, Insoo C, Kunho S. Evaluation of PCR inhibitory effect of enrichment broths and comparison of DNA extraction methods for detection of Salmonella enteritidis using real-time PCR assay. J Vet Sci. 2010;11(2):143–149. doi: 10.4142/jvs.2010.11.2.143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Kawasaki S, Fratamico PM, Horikoshi N, Okada Y, Takeshita K, Sameshima T, Kawamoto S. Multiplex real-time polymerase chain reaction assay for simultaneous detection and quantification of Salmonella species, Listeria monocytogenes, and Escherichia coli O157:H7 in ground pork samples. Foodborne Pathog Dis. 2010;7(7):549–554. doi: 10.1089/fpd.2009.0465. [DOI] [PubMed] [Google Scholar]
  11. Lee DS, Kim KS, Kwon KS, Hong KW. A multiplex PCR assay for the detection and differentiation of enterotoxin-producing and emetic toxin-producing Bacillus cereus strains. Food Sci Biotechnol. 2008;17(4):761–765. [Google Scholar]
  12. Li WL, Wu A, Li ZC, Zhang G, Yu WY. A new calibration method between an optical sensor and a rotating platform in turbine blade inspection. Meas Sci Technol. 2017;28(3):035009. doi: 10.1088/1361-6501/aa50df. [DOI] [Google Scholar]
  13. Löfström C, Hansen F, Hoorfar J. Validation of a 20-h real-time PCR method for screening of Salmonella in poultry faecal samples. Vet Microbiol. 2010;144(3–4):511–514. doi: 10.1016/j.vetmic.2010.02.019. [DOI] [PubMed] [Google Scholar]
  14. Miao J, Peters BM, Li L, Li B, Zhao X, Xu Z. Evaluation of ERIC-PCR for fingerprinting methicillin-resistant Staphylococcus aureus strains. Basic Clin Pharmacol Toxicol. 2016;118:33. [Google Scholar]
  15. Park YS, Lee SR, Kim YG. Detection of Escherichia coli O157:H7, Salmonella spp., Staphylococcus aureus and Listeria monocytogenes in kimchi by multiplex polymerase chain reaction (mPCR) J Microbiol. 2006;44(1):92–97. [PubMed] [Google Scholar]
  16. Pelisser MR, Klein CS, Ascoli KR, Zotti TR, Arisi AC. Ocurrence of Staphylococcus aureus and multiplex pcr detection of classic enterotoxin genes in cheese and meat products. Braz J Microbiol. 2009;40(1):145–148. doi: 10.1590/S1517-83822009000100025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Poolman JT, Wacker M. Extraintestinal pathogenic Escherichia coli, a common human pathogen: challenges for vaccine development and progress in the field. J Infect Dis. 2016;213(1):6–13. doi: 10.1093/infdis/jiv429. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Saeki EK, Alves J, Bonfante RC, Hirooka EY. Multiplex PCR (mPCR) for the detection of Salmonella spp. and the differentiation of the Typhimurium and Enteritidis serovars in Chicken Meat. J Food Saf. 2013;33(1):25–29. doi: 10.1111/jfs.12019. [DOI] [Google Scholar]
  19. Singh J, Batish VK, Grover S. Simultaneous detection of Listeria monocytogenes and Salmonella spp. in dairy products using real time PCR-melt curve analysis. J Food Sci Technol. 2012;49(2):234–239. doi: 10.1007/s13197-011-0278-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Sun X, Wang C, Tong Y, Wang W, Wei J. Microalgae filtration by UF membranes: influence of three membrane materials. Desalination Water Treat. 2014;52(28–30):5229–5236. doi: 10.1080/19443994.2013.813103. [DOI] [Google Scholar]
  21. Suo B, He YP, Tu SI, Shi XM. A multiplex real-time polymerase chain reaction for simultaneous detection of Salmonella spp., Escherichia coli O157, and Listeria monocytogenes in meat products. Foodborne Pathog Dis. 2010;7(6):619–628. doi: 10.1089/fpd.2009.0430. [DOI] [PubMed] [Google Scholar]
  22. Vugia D, Cronquist A, Cartter M, Tobin-D’Angelo M, Blythe D, Smith K, Lathrop S, Morse D, Cieslak P, Dunn J. Preliminary FoodNet Data on the incidence of infection with pathogens transmitted commonly through food—10 States, 2008. MMWR Morb Mortal Wkly Rep. 2010;59(14):418–422. [PubMed] [Google Scholar]
  23. Wallace FM, Andaloro B, Fallon D, Corrigan N, Varkey S, DeMarco D, Farnum A, Tadler M, Hoelzer S, Weller J. Detection of Salmonella species in a variety of foods by the DuPont™ BAX® System Real-Time PCR Assay for Salmonella: first action 2013.02. J AOAC Int. 2014;97(3):868–875. doi: 10.5740/jaoacint.13-407. [DOI] [PubMed] [Google Scholar]
  24. Xu Y, Cheng W, Chen F. Detection of Salmonella spp., Escherichia coli and Staphylococcus aureus by multiplex PCR. J Microbiol. 2006;33(6):89–94. [Google Scholar]
  25. Yang Y, Wan C, Xu H, Lai W, Xiong Y, Xu F, You X, Xu H, Aguilar ZP, Sun J. Development of a multiplexed PCR assay combined with propidium monoazide treatment for rapid and accurate detection and identification of three viable Salmonella enterica serovars. Food Control. 2012;28(2):456–462. doi: 10.1016/j.foodcont.2012.05.061. [DOI] [Google Scholar]
  26. Zhang Z, Wang L, Xu H, Aguilar ZP, Liu C, Gan B, Xiong Y, Lai W, Xu F, Wei H. Detection of non-emetic and emetic Bacillus cereus by propidium monoazide multiplex PCR (PMA-mPCR) with internal amplification control. Food Control. 2014;35(1):401–406. doi: 10.1016/j.foodcont.2013.07.035. [DOI] [Google Scholar]
  27. Zhao X, Lin CW, Wang J, Oh DH. Advances in rapid detection methods for foodborne pathogens. J Microbiol Biotechnol. 2013;24(3):297–312. doi: 10.4014/jmb.1310.10013. [DOI] [PubMed] [Google Scholar]
  28. Zhao X, Wang J, Forghani F, Park JH, Park MS, Seo KH, Oh DH. Rapid detection of viable Escherichia coli O157 by coupling propidium monoazide with loop-mediated isothermal amplification. J Microbiol Biotechnol. 2013;23(12):1708–1716. doi: 10.4014/jmb.1306.06003. [DOI] [PubMed] [Google Scholar]
  29. Zhao X, Wei C, Zhong J, Jin S. Research advance in rapid detection of foodborne Staphylococcus aureus. Biotechnol Biotechnol Equip. 2016;30(5):1–7. doi: 10.1080/13102818.2016.1209433. [DOI] [Google Scholar]
  30. Zhao X, Zhao F, Wang J, Zhong N. Biofilm formation and control strategies of foodborne pathogens: food safety perspectives. Rsc Adv. 2017;7(58):36670–36683. doi: 10.1039/C7RA02497E. [DOI] [Google Scholar]
  31. Zhao X, Zhong J, Wei C, Lin CW, Ding T. Current Perspectives on Viable but Non-culturable State in Foodborne Pathogens. Frontiers in Microbiology. 2017;8(703813):580. doi: 10.3389/fmicb.2017.00580. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Zhong J, Zhao X. Detection of viable but non-culturable Escherichia coli O157:H7 by PCR in combination with propidium monoazide. 3 Biotech. 2017 doi: 10.1007/s13205-017-1052-7. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES