Skip to main content
NCBI home page
The Journal of Physiology logoLink to The Journal of Physiology
. 2017 Dec 18;596(2):217–229. doi: 10.1113/JP275175

Regulation of TMEM16A/ANO1 and TMEM16F/ANO6 ion currents and phospholipid scrambling by Ca2+ and plasma membrane lipid

Rainer Schreiber 1, Jiraporn Ousingsawat 1, Podchanart Wanitchakool 1, Lalida Sirianant 1, Roberta Benedetto 1, Karina Reiss 2, Karl Kunzelmann 1,✉
PMCID: PMC5767690  PMID: 29134661

Abstract

Key points

  • TMEM16 proteins can operate as Ca2+‐activated Cl− channels or scramble membrane phospholipids, which are both highly relevant mechanisms during disease.

  • Overexpression of TMEM16A and TMEM16F were found to be partially active at 37°C and at resting intracellular Ca2+ concentrations.

  • We show that TMEM16 Cl− currents and phospholipid scrambling can be activated by modification of plasma membrane phospholipids, through reactive oxygen species and phospholipase A2.

  • While phospholipids and Cl− ions are likely to use the same pore within TMEM16F, TMEM16A only conducts Cl− ions.

  • Lipid regulation of TMEM16 proteins is highly relevant during inflammation and regulated cell death such as apoptosis and ferroptosis.

Abstract

TMEM16/anoctamin (ANO) proteins form Ca2+‐activated ion channels or phospholipid scramblases. We found that both TMEM16A/ANO1 and TMEM16F/ANO6 produced Cl− currents when activated by intracellular Ca2+, but only TMEM16F was able to expose phosphatidylserine to the outer leaflet of the plasma membrane. Mutations within TMEM16F or TMEM16A/F chimeras similarly changed Cl− currents and phospholipid scrambling, suggesting the same intramolecular pathway for Cl− and phospholipids. When overexpressed, TMEM16A and TMEM16F produced spontaneous Cl− currents at 37°C even at resting intracellular Ca2+ levels, which was abolished by inhibition of phospholipase A2 (PLA2). Connversely, activation of PLA2 or application of active PLA2, as well as lipid peroxidation induced by reactive oxygen species (ROS) using staurosporine or tert‐butyl hydroperoxide, enhanced ion currents by TMEM16A/F and in addition activated phospholipid scrambling by TMEM16F. Thus, TMEM16 proteins are activated by an increase in intracellular Ca2+, or independent of intracellular Ca2+, by modifications occurring in plasma and intracellular membrane phospholipids. These results may help to explain why regions distant to the TMEM16 pore and the Ca2+ binding sites control Cl− currents and phospholipid scrambling. Regulation of TMEM16 proteins through modification of membrane phospholipids occurs during regulated cell death such as apoptosis and ferroptosis. It contributes to inflammatory and nerve injury‐induced hypersensitivity and generation of pain and therefore provides a regulatory mechanism that is particularly relevant during disease.

Keywords: TMEM16A, TMEM16F, Anoctamin 1, Anoctamin 6, phospholipid scrambling, Ca2+ activated Cl− channel

Key points

  • TMEM16 proteins can operate as Ca2+‐activated Cl− channels or scramble membrane phospholipids, which are both highly relevant mechanisms during disease.

  • Overexpression of TMEM16A and TMEM16F were found to be partially active at 37°C and at resting intracellular Ca2+ concentrations.

  • We show that TMEM16 Cl− currents and phospholipid scrambling can be activated by modification of plasma membrane phospholipids, through reactive oxygen species and phospholipase A2.

  • While phospholipids and Cl− ions are likely to use the same pore within TMEM16F, TMEM16A only conducts Cl− ions.

  • Lipid regulation of TMEM16 proteins is highly relevant during inflammation and regulated cell death such as apoptosis and ferroptosis.

Abbreviations

7‐AAD

7‐aminoactinomycin D

ACA

N‐(p‐amylcinnamoyl) anthranilic acid

ANO

anoctamin

BELb

bromoenol lactone

FACS

fluorescence activated cell sorting

IONO

ionomycin

NEM

N‐ethylmaleimide

ROS

reactive oxygen species

tBHP

tert‐butyl hydroperoxide

Introduction

TMEM16 proteins [anoctamins (ANOs)] form Ca2+‐activated phospholipid scramblases or Ca2+‐activated ion channels (Caputo et al. 2008; Schroeder et al. 2008; Yang et al. 2008; Suzuki et al. 2010). TMEM16A/ANO1 is a chloride channel that does not transport phospholipid, while TMEM16F/ANO6 is a phospholipid scramblase and also produces Cl− currents (Kunzelmann et al. 2014; Pedemonte & Galietta, 2014). We previously reported that expression of different anoctamin paralogues together with purinergic P2Y2 receptors induce ion currents when stimulated with ATP (Tian et al. 2012a, b). We noted that anoctamin currents were partially active even without an increase in intracellular Ca2+. In contrast to most other laboratories, we perform patch clamp recordings at the physiological temperature of 37°C, which may explain basal Cl− currents in the absence of agonists.

It was previously shown that TMEM16F whole cell currents are strongly activated by phospholipase A2 (PLA2), which may be particularly relevant during pathological conditions such as inflammation (Sirianant et al. 2015). In the present study we therefore examined whether temperature, modification of plasma membrane phospholipids by PLA2 or reactive oxygen species (ROS) causing lipid peroxidation affect Cl− currents and phospholipid scrambling by TMEM16A and TMEM16F, respectively. The present data provide evidence for a phospholipid‐dependent but Ca2+‐independent regulation of TMEM16A and TMEM16F. Results from TMEM16F mutants and TMEM16A/F chimeras suggest that Cl− and phospholipids share the same intramolecular pathway, which is regulated in a Ca2+‐independent fashion by plasma membrane phospholipids and regions outside the pore. The present study on phospholipid‐dependent regulation of TMEM16 proteins is crucial during apoptosis and caspase‐independent ferroptosis. Lipid regulation of TMEM16 contributes to pathological conditions such as inflammation and generation of pain and may therefore be active during many diseases.

Methods

Cells, cDNA, chimera and mutants

HEK293 cells were grown as previously described (Martins et al. 2011; Botelho et al. 2015; Sirianant et al. 2016). If not indicated otherwise, all experiments were performed with human TMEM16A/ANO1, except the experiments shown in Fig. 1 A where also mouse TMEM16A/ANO1 was used. All experiments were performed with the TMEM16A/ANO1 splice variant abc (Ferrera et al. 2009). Throughout, the human TMEM16F/ANO6 isoform a (NP_001020527) was used. For the experiments shown in Fig. 5, additional isoforms were used: TMEM16F/ANO6 isoform b (NP_001136150; ΔExon1) and isoform d (NP_001191732; TMEM16F/ANO6‐L). Generation of cDNA, transfection and expression for human TMEM16A/ANO1 and human ANO6 has been previously reported (Almaca et al. 2009; Martins et al. 2011). ANO6ΔSD (Yu et al. 2015) was generated by using NEBuilder HiFi DNA Assembly (New England BioLabs, Frankfurt am Main, Germany). In brief, DNA fragments with overlapping ends were amplified by PCR using the primers ΔSD_1s and ΔSD_1as (Table 1) for the vector/ANO6 fragment and ΔSD_2s and ΔSD_2as to amplify the fragment that replaced the scramble domain of ANO6 by the homologue region of TMEM16A/ANO1. Replacement of the N‐terminus of ANO6 by the N‐terminus of TMEM16A/ANO1 (ANO1/6) was done by PCR to amplify the N‐terminus of TMEM16A/ANO1 (NA1_1s; NA1_a1s) and C‐terminus of ANO6 (CA6_1s, CA6_1as). Replacement of the N‐terminus of TMEM16A/ANO1 by the N‐terminus of ANO6 (ANO6/1) was done by PCR to amplify the N‐terminus of ANO6 (NA6_1s; NA6_1as) and the C‐terminus of TMEM16A/ANO1 (CA1_1s, CA1_1as). Replacement of the pore region of TMEM16A/ANO1 by the pore region of ANO6 (ANO1/6/1) was done by PCR to amplify the N‐terminus of TMEM16A/ANO1 (NA1_1s; NA1_2as), the pore region of ANO6 (PA6_1s, PA6_1as) and the C‐terminus of TMEM16A/ANO1 (CA1_2s, CA1_1as). For replacement of the pore region of ANO6 by that of TMEM16A/ANO1 (ANO6/1/6), the N‐terminus of ANO6 (NA6_1s, NA6_2as), the pore region of TMEM16A/ANO1 (PA1_s, PA1as) and the C‐terminus of ANO6 (CA6_2s, CA6_as) were amplified by PCR. All DNA fragments were first cloned in pBSSK− (Stratagene, La Jolla, CA, USA) and then assembled into pcDNA3.1. The Ano6_Scott construct without exon 13 was generated by amplifying two PCR fragments spanning exon 1 to exon 12 (NA6_1s, Sc_1as) and exon 14 to exon 20 (Sc_2s, CA6_1as). DNA fragments were assembled into pcDNA3.1. ANO6ΔExon1 (isoform b, NP_001136150) was generated by PCR from pIRES1‐CD8 hANO6 using the primer ΔExon1_s and ΔExon1_as, and the fragment was cloned into pIRES1‐CD8 vector (Fink et al. 1998). ANO6ΔExon6 was kindly provided from Professor Williamson's Lab, Amherst College, MA, USA. ANO6‐L (isoform d, NP_001191732) was assembled from three fragments and cloned into pcDNA3.1. The N‐terminal and the C‐terminal fragments were amplified by PCR (NA6_1s, A6‐L_as; A6‐L_3s, A6‐L_3as), and the third fragment A6‐L_2 was synthesized. D408G and D429G mutations were introduced into ANO6 and ANO6‐L by site‐directed mutagenesis using the primers DGs/DGas. All oligonucleotides (Table 1) were from Eurofins Genomics (Ebersberg, Germany) and all constructs were verified by sequencing (SeqLab, Göttingen, Germany).

Figure 1. Overexpressed TMEM16A/ANO1 and TMEM16F/ANO6 are partially active at 37°C.

Figure 1

Open in a new tab

A, whole cell currents and corresponding I–V relationships in non‐stimulated HEK293 cells expressing human or mouse ANO1. Voltage clamp (±100 mV for 1 s, 20 mV steps) was performed at 37°C and under asymmetric Cl− concentrations with 30 mm Cl− in standard pipette solution and 145 mm Cl− in bath Ringer solution. 30Cl−/5Cl− indicates replacement of extracellular Cl− by gluconate. B, experiments performed under symmetric 145/145Cl− concentrations with 145 mm CsCl (pipette) and 145 mm NaCl (bath). C, current densities in ANO1‐expressing cells obtained at different temperatures in the presence of standard pipette solution and bath Ringer solution (black columns). Effect of extracellular 5Cl− on outward currents measured at V c = +100 mV (red columns). D, current densities at different temperatures (black columns) and after additional stimulation with the Ca2+ ionophore ionomycin (1 μm; red columns). E, summary of TMEM16A/ANO1 current densities showing inhibition by CaCCinhAO1 (AO1; 20 μm). F, whole cell current densities obtained at 37°C in HT29 cells expressing endogenous TMEM16A/ANO1. G, activation of endogenous TMEM16A/ANO1 currents by ionomycin (1 μm) and inhibition by CaCCinhAO1 (20 μm) and 5Cl−. H, baseline current densities obtained in ANO6‐expressing HEK293 cells at different temperatures. Effect of 5Cl− (red columns). I, current densities after stimulation with ionomycin (1 μm). Values are mean ± SEM (number of experiments). *Significant difference when compared to mock (unpaired t test). #Significant activation by ionomycin or inhibition by blockers (P < 0.05; paired t test).

Figure 5. Phospholipid scrambling and Cl− currents by TMEM16F/ANO6 mutants and TMEM16A/TMEM16F chimeric proteins.

Figure 5

Open in a new tab

A, ionomycin (IONO; 1 μm) activated whole cell currents in HEK293 cells expressing different TMEM16F/ANO6 mutants and chimeric proteins. Cl− currents are shown relative to mock transfected cells and were related to expression of individual constructs in the plasma membrane as detected by GFP fluorescence. Red line indicates relative amplitude of whole cell currents generated by wild type TMEM16F/ANO6. B, IONO (10 μm/10 min) activated phospholipid scrambling related to plasma membrane expression. Red line indicates scrambling generated by wild type TMEM16F/ANO6. Values are mean ± SEM (number of cells measured or number of FACS assays). #Significant increase when compared to mock (P < 0.05, ANOVA). §Significant difference when compared to ANO6 (P < 0.05, ANOVA). [Color figure can be viewed at wileyonlinelibrary.com]

Table 1.

List of primers

Name Sequence (5′–3′) Cutting sides
ΔSD_1s TTCCTGCTGAAGTTTGTCAACTACTACTCTTCATG
ΔSD_1as ACACCTCGTCCAGAATCATGATAATTATAAAGCTG
ΔSD_2s ATTATCATGATTCTGGACGA GGTGTATGGCTGCAT
ΔSD_2as TAGTAGTTGACAAACTTCAGCAGGAAAGCCTTGAA
NA1_1s AAAAGCGGCCGCGGCCACGATGAGGGTC NotI
NA1_1as AAAATACTAGTCCGATCTTCTCCCCAAAATAC SpeI
CA6_1s TTTTACTAGTATACTTTGCTTGGCTGGGCTA SpeI
CA6_1as AAAACTCGAGAATTCTGATTTTGGCCGTAAATTG XhoI
NA6_1s TTAGCGGCCGCCATGAAAAAGATGAGCAGGAATG NotI
NA6_1as TTTTTACTAGTCCAATCTTCTCTCCATAGTATTT SpeI
CA1_1s TTTTACTAGTATACTTCGCCTGGCTGGG SpeI
CA1_1as AAAACTCGAGTTCAGGACGCCCCCGTGG XhoI
NA1_2as AAAAAACTAGTCTCTCCTCAAAGCTTTTCTCC SpeI
PA6_1s TTTTTACTAGTGTTCTTATTCCAGTTTGTCAAC SpeI
PA6_1as AAAAAGTCGACGAGAGCCAACAGAGGGG SalI
CA1_2s AAAAAGTCGACGCCAAAAAGTTTGTCACTG SalI
NA6_2as TTTTTACTAGTAACATCTTCATGGTGAGGCTG SpeI
PA1_1s AAAAAAACTAGTCTTCAAGGCTTTCCTGCTG SpeI
PA1_1as AAAAAGTCGACCAGCAGCGCAAACAGTGGG SalI
CA6_2s TTTTAAGTCGACAACAATATATTGGAAATAAGAGTGG SalI
Sc_1as AAAAAGAATTCCAGAAAAAGACAGCACTG EcoRI
Sc_2s AAAAAGAATTCCCAAGGACCC AGACTG EcoRI
ΔExon1_s AATTAATTGCGGCCGCCATGTTTTGTGCTGCTGTGTTGGAAAACCTTGGACAG NotI
ΔExon1_as CTTGATGATGCTTTCGTCTACAC
A6‐L_as TTTAATTGTCGACTGGCAGGAACATCACCGATATCCCCATCGTCGTCGTC SalI
A6‐L_2 TTATTTGTCGACGGCCTTTTCTGACTCCTCATACTCACCTCCCCTCGAGATATTA SalI /XhoI
A6‐L_3s TTATTACTCGAGCCTGGTGTTGGAAAACCTTGGACAG Xho I
A6‐L_3as TTTTTCTAGATTTTCTGATTTTGGCCGTAAATTG XbaI
DGs GAGTATGAATGGGGTACCGTTGAGTTACAGC
DGas GCTGTAACTCAACGGTACCCCATTCATACTC
Open in a new tab

Measurement of phospholipid scrambling in HEK cells using flow cytometry (FACS)

Cells were transfected with 1 μg of DNA using Lipofectamine 3000. After 72 h cells were collected using Accutase (Capricorn Scientific, Ebsdorfergrund, Germany), washed with cold Dulbecco's PBS (DPBS) and centrifuged at 500 g and 4°C for 10 min. Subsequently, cells were resuspended in 100 μl annexin binding buffer containing 5 μl annexin V‐FITC and 2.5 μl 7‐aminoactinomycin D (7‐AAD; BioLegend, Koblenz, Germany). To activate anoctamin, cells were incubated with 1 or 10 μm ionomycin for 10 min. Reactions were stopped by adding 400 μl DPBS and cells were analysed immediately. Fluorescence activated cell sorting (FACS) analyses was performed in Annexin V standard binding buffer (BioLegend) containing 10 mm Hepes, 140 mm NaCl and 2.5 mm CaCl. For each measurement, at least 10,000 cells were analysed by flow cytometry at 37°C (BD Accuri™ C6). 7‐AAD, a non‐permeant dye, was used to identify non‐viable cells.

Patch clamping

Cells were grown on coated glass cover slips. Patch pipettes were filled with a cytosolic‐like (standard) solution containing (mm): 30 KCl, 95 potassium gluconate, 1.2 NaH2PO4, 4.8 Na2HPO4, 1 EGTA, 0.758 calcium gluconate, 1.03 MgCl2, 5 d‐glucose, 3 ATP, pH 7.2. To examine currents under symmetrical Cl− concentrations (Fig. 1 B), patch pipettes were filled with a solution containing 145 mm CsCl. Shifts of the reversal potential were examined upon removal of extracellular Cl− (145 mm Cl− /145 mm Cl− vs. 145 mm Cl−/5 mm Cl−). In all experiments the bath was perfused for at least 5 min with control Ringer solution after establishing the whole cell configuration, in order to ensure stable recording conditions. In ANO1‐expressing cells and at 37°C, the whole cell currents were large before turning on bath perfusion, while perfusion‐induced (mechanical) activation of whole cell currents during the pre‐control phase was never observed. The intracellular (pipette) Ca2+ activity was 0.1 μm. In some experiments, all except 5 mm Cl− was replaced by impermeable gluconate (denoted 5Cl−). Fast whole cell current recordings were performed as described by Martins et al. (2011). In brief, the bath was perfused continuously with Ringer solution, containing (mm) 145 NaCl, 0.4 KH2PO4, 1.6 K2HPO, 4.6 d‐glucose, 1 MgCl2, 1.3 Ca2+ gluconate (pH 7.4) at a rate of 8 ml min−1. Patch pipettes had an input resistance of 2–4 MΩ and measured whole cell currents were corrected for serial resistance. Currents were recorded using a patch clamp amplifier (EPC 7, List Medical Electronics, Darmstadt, Germany), the LIH1600 interface and PULSE software (HEKA, Lambrecht, Germany) as well as Chart software (AD Instruments, Spechbach, Germany). In regular intervals, membrane voltage (V c) was clamped in steps of 20 mV from −100 to +100 mV from a holding voltage of −100 mV. Current densities at +100 mV clamp voltage were calculated by dividing the measured whole cell currents by cell capacitance.

Material and statistics

All compounds used were of the highest available grade of purity. Data are reported as means ± SEM. Student's t test (for paired or unpaired samples as appropriate) or ANOVA were used for statistical analysis. A P‐value <0.05 was accepted as indicating a significant difference.

Results

Overexpressed TMEM16A/ANO1 and TMEM16F/ANO6 are partially active at 37°C

We observed that overexpression of human or mouse TMEM16A/ANO1 (isoform abc; Ferrera et al. 2009) in HEK293 cells induced baseline Cl− currents at 37°C, even in the absence of any Ca2+ agonist. The currents showed properties characteristic for TMEM16A, such as outward rectification and delayed time‐dependent activation. This was not observed in mock transfected cells (Fig. 1 A–C). TMEM16A/ANO1 outward currents were inhibited by removal of extracellular Cl− (5Cl−). Baseline currents were observed under asymmetric (pipette 30 mm Cl−/bath 145 mm Cl−; Fig. 1 A) or symmetric (pipette 145 mm Cl−/bath 145 mm Cl−; Fig. 1 B) conditions. Surprisingly, right‐shifts of the reversal potential upon removal of extracellular Cl− (5Cl−) was only marginal in the presence of the standard pipette filling solution containing 30 mm Cl− (Fig. 1 A). We therefore also examined the effect of Cl− removal under symmetric Cl− concentrations and with 145 mm CsCl as the pipette solution (Fig. 1 B). Under symmetric Cl− concentrations the expected Nernst shift of approximately 80 mV was observed. This suggests that the cytosolic ion composition affects permeability properties of TMEM16A, similar to what has been observed for TMEM16F (Sirianant et al. 2015). The temperature dependence of TMEM16A/ANO1 noted here is possibly related to the TMEM16A/ANO1‐mediated heat sensing described in nociceptive neurons (Cho et al. 2012). An additional increase in intracellular Ca2+ by ionomycin (IONO; 1 μm) further augmented Cl− currents, suggesting that heat has a synergistic effect on the Ca2+ response of TMEM16A/ANO1, similar to the findings by Cho et al. (2012) (Fig. 1 D). Basal TMEM16A/ANO1 activity was inhibited by the ANO1 inhibitor T16Ainh‐A01 (AO1) (Namkung et al. 2011; Sirianant et al. 2015) (Fig. 1 E). Notably, basal activity at 37°C was not observed for TMEM16A/ANO1 expressed endogenously in HT29 cells and other cell lines expressing endogenous TMEM16A/ANO1 (Fig. 1 F and G). This result may correspond to earlier findings demonstrating distinct differences for endogenous and overexpressed TMEM16A/ANO1 currents (Tian et al. 2012b). Similar to overexpressed TMEM16A/ANO1, also overexpressed TMEM16F/ANO6 produced Cl− currents at 37°C, without the need to enhance intracellular Ca2+ (Fig. 1 H and I).

TMEM16A/ANO1 and TMEM16F/ANO6 are activated by PLA2 and lipid peroxidizing ROS

Basal TMEM16A/ANO1 and TMEM16F/ANO6 activities were inhibited by the two inhibitors of PLA2, namely N‐(p‐amylcinnamoyl) anthranilic acid (ACA) and bromoenol lactone (BEL) (Fig. 2 A). This may suggest that PLA2, a temperature‐dependent enzyme, activates overexpressed TMEM16A/ANO1 and TMEM16F/ANO6 at 37°C, without changing intracellular Ca2+, as demonstrated recently (Sirianant et al. 2015). We therefore exposed overexpressing cells to melittin, an activator of PLA2, which activated Cl− currents both by TMEM16A/ANO1 and by TMEM16F/ANO6 (Fig. 2 B). Again, TMEM16A/ANO1 and TMEM16F/ANO6 currents activated by melittin were inhibited by AO1 and the PLA2 inhibitors, indicating a specific action of melittin through PLA2 (Fig. 2 C). To further exclude any potential artefacts caused by melittin, we applied N‐ethylmaleimide (NEM), another potent activator of PLA2, or alternatively we used active PLA2 in the patch pipette. All procedures activated whole cell currents in HEK293 cells expressing TMEM16A/ANO1 or TMEM16F/ANO6, while little current was activated in mock transfected cells (probably due to endogenous expression of TMEM16F/ANO6; Schreiber et al. 2010; Tian et al. 2012a) (Fig. 2 D and E). Similar to PLA2, lipid peroxidation by accumulation of intracellular ROS is also known to change plasma membrane properties. We therefore incubated overexpressing or mock transfected cells with the ROS‐donors staurosporine (Stauro) and tert‐butyl‐hydroperoxide (tBHP). Both compounds activated whole cell Cl− currents in TMEM16A/ANO1‐ and TMEM16F/ANO6‐overexpressing cells, with little effect on mock transfected cells (Fig. 2 F and G). Activation of whole cell currents was antagonized by pre‐incubation of the cells with a membrane‐permeable synthetic derivative of glutathione [GSH ethyl ester (GSHEE)] (Simões et al. 2017). These data provide evidence for regulation of TMEM16A/ANO1 and TMEM16F/ANO6 by membrane phospholipids. It is likely that our results are related to the recent finding showing PIP2‐dependent regulation of ANO6 (Aoun et al. 2016).

Figure 2. TMEM16A/ANO1 and TMEM16F/ANO6 are activated by PLA2 and by lipid peroxidizing ROS.

Figure 2

Open in a new tab

A, summary of current densities in HEK293 cells overexpressing TMEM16A/ANO1 and TMEM16F/ANO6. Effect of PLA2 blockers ACA (20 μm) and BEL (30 μm) on spontaneous Cl− currents active at 37°C. B, activation of TMEM16A/ANO1 and TMEM16F/ANO6 whole cell currents by the PLA2 activator melittin (200 nm). C, summary of current densities and inhibition by CaCCinhAO1 (AO1, 20 μm), ACA and BEL. D and E, activation of TMEM16A/ANO1 and TMEM16F/ANO6 by acute exposure to the PLA2 activator N‐ethylmaleimide (NEM; 50 μm), or by a pipette filling solution containing active PLA2 (0.5 U ml−1). F and G, activation of TMEM16A/ANO1 and TMEM16F/ANO6 by ROS‐inducers staurosporine (Stauro, 2 μm/6 h) and by tert‐butyl hydroperoxide (tBHP; 100 μm/2 h). values are mean ± SEM (number of experiments). #Significant difference when compared to mock (P < 0.05, unpaired t test). *Significant inhibition by AO1, ACA or BEL (P < 0.05, paired t test).

Phospholipid scrambling by ANO6 is activated by PLA2 and ROS

TMEM16F/ANO6 but not TMEM16A/ANO1 scrambled phospholipids when activated by an increase in intracellular Ca2+ (Fig. 3 A). We examined if activation of PLA2 by melittin or NEM, or an increase in intracellular ROS by Stauro or tBHP only stimulates Cl− currents, or also activates phospholipid scrambling. No scrambling was observed for ANO1 by any of the procedures described above. In contrast, ANO6‐expressing cells demonstrated low but detectable scrambling activity under control conditions, which was enhanced by melittin, NEM, Stauro and tBHP, respectively. Our results suggest that Cl− currents and phospholipid scrambling are regulated in parallel and suggest that Cl− and phospholipids use the same conductive pore. The results may correspond to our previous observation of melittin‐activated scrambling in keratinocytes (Sommer et al. 2016).

Figure 3. Activation of phospholipid scrambling by TMEM16F/ANO6 but not by TMEM16A/ANO1.

Figure 3

Open in a new tab

A, activation of phospholipid scrambling by ionomycin (IONO, 10 μm/10 min). Dot blots from flow cytometry of HEK293 cells overexpressing TMEM16A/ANO1 or TMEM16F/ANO6 (left panels). Percentage of annexin V positive cells under control conditions and after incubation with ionomycin (right panel). B and C, activation of phospholipid scrambling by stimulation of PLA2 using melittin (200 nm/10 min) (B) or NEM (500 μm/10 min) (C). D and E, activation of phospholipid scrambling by staurosporine (Stauro, 2 μm/6 h) (D) and tert‐butyl hydroperoxide (tBHP; 100 μm/10 min) (E). Values are mean ± SEM (number of assays). #Significant activation of scrambling (P < 0.05, unpaired t test). Cells overexpressing ANO6 showed a small but significant basal scrambling activity at 37°C.

Regulatory sites beyond Ca2+ binding

The present experiments demonstrate that Cl− currents and phospholipid scrambling by TMEM16F/ANO6 are activated by similar mechanisms. To further substantiate this finding and to collect evidence for a common pathway for Cl− and phospholipids, we examined a number of TMEM16F/ANO6‐activating or inhibitory mutants along with TMEM16F/TMEM16A chimeric proteins (Fig. 4). Membrane expression of chimeric/mutant proteins was confirmed by immunocytochemistry. Chimeric proteins and other constructs were examined initially in YFP/I− quenching assays to detected halide permeability. We analysed the ability of the various constructs to produce Cl− currents and to scramble phospholipid when stimulated with the ionophore IONO. The data demonstrate that: (i) TMEM16F/ANO6 but not TMEM16A/ANO1 scramble phospholipid; (ii) mutants and chimeric proteins that show enhanced or inhibited Cl− currents also show enhanced or inhibited phospholipid scrambling – phospholipid scrambling was more sensitive towards inhibition by structural changes than Cl− currents; (iii) constructs that show enhanced basal Cl− currents also showed enhanced basal phospholipid scrambling; and (iv) regions away from pore and Ca2+ binding sites have an impact on Cl− currents/phospholipid scrambling (Fig. 5). The data suggest that regulation of TMEM16A/ANO1 and TMEM16F/ANO6 might be more complex than previously anticipated: Protein regions distant from the channel pore as well as plasma membrane phospholipids have a significant impact on pore conductance and scrambling activity (Mazzone et al. 2015; Strege et al. 2015).

Figure 4. TMEM16F/ANO6 chimeras and TMEM16F/ANO6 mutants.

Figure 4

Open in a new tab

Linear models for TMEM16A/TMEM16F chimeras and TMEM16F mutants. Putative scrambling domain (SD; Yu et al. 2015) and regions for Ca2+ binding (yellow stars), ion conductance and phospholipid movement are shown. Numbering of amino acids for TMEM16A (grey) and TMEM16F (red) fragments is provided.

Discussion

The present data provide evidence that TMEM16A/ANO1 and TMEM16F/ANO6 are similarly regulated by intracellular Ca2+ and by plasma membrane phospholipids. The study was triggered by the observation of spontaneous TMEM16A/ANO1 and TMEM16F/ANO6 whole cell currents at 37°C in the presence of resting Ca2+ levels. Activation of Cl− currents was demonstrated by (i) extracellular Cl− removal (5Cl−) and (ii) by the TMEM16 inhibitor CaCCinhAO1, which inhibited spontaneous currents (Fig. 1). Under asymmetric Cl− concentrations using 30 mm KCl in patch pipettes and 145 mm NaCl in the bath, outward currents were inhibited by 5Cl− but reversal potentials were only slightly shifted, suggesting a low selectivity of TMEM16A for Cl− (Fig. 1 A). In contrast, TMEM16A currents were perfectly Cl−‐selective in the presence of 145 mm CsCl in the patch pipette and 145 mm NaCl in the bath, and demonstrated large rights shifts of I–V curves with 5Cl− in the bath (Fig. 1 B). Although this behaviour has also been observed in previous studies, the reason remains unclear (Tian et al. 2012a; Sirianant et al. 2015). A similar apparent discrepancy of ion conductance/current and permeability (determined from reversal potentials) has been observed for K+ channels (Pavenstädt et al. 1991). In this study the conductance for Rb+ was zero, but its apparent permeability was high when calculated from the Goldman zero current equation. It was suggested that Rb+ entering the channel stays tightly bound to the ion‐binding site and therefore is not conducted. Tight binding of Rb+ inhibits movement of K+ in the opposite direction, thereby simulating reduced selectivity of the channel for K+. Future studies may detect regulation of TMEM16A/ANO1 based on intracellular or extracellular ionic strength, similar to TMEM16F/ANO6, cystic fibrosis transmembrane conductance regulator (CFTR) or epithelial Na+ channels (Schreiber et al. 2004; Broadbent et al. 2015; Sirianant et al. 2015).

Spontaneous current activity at 37°C was observed for both TMEM16A/ANO1 and TMEM16F/ANO6, but was more pronounced for TMEM16A/ANO1. It may correspond to the ‘heat activation’ of TMEM16A/ANO1 reported by Cho et al. (2012). They reported a synergistic effect of increased temperature on the Ca2+ response of TMEM16A/ANO1 (Cho et al. 2012). We made similar observations and found no TMEM16A/F Cl− currents at all at 37°C with 0 mm Ca2+ in the patch pipette (Fig. 6 A). Notably, spontaneous channel activity at 37°C was not observed for endogenous TMEM16A/ANO1 or TMEM16F/ANO6 in HT29 cells, head neck cancer cells, lymphocytes or many other cell lines (Ruiz et al. 2012; Tian et al. 2012b; Kmit et al. 2013). Although this difference remains unexplained, we speculate that overexpressed TMEM16A/ANO1 and TMEM16F/ANO6 may localize to plasma membrane compartments that normally do not contain these proteins. While endogenous TMEM16A/F may be localized in lipid rafts, membrane compartments enriched with distinct phospholipids and cholesterol, this may not be true for overexpressed anoctamins (Jin et al. 2013; Cabrita et al. 2017). These differences in regulation and pharmacological properties of endogenous vs. overexpressed TMEM16A/ANO1 may be of relevance in pharmacological screens for activators and inhibitors (Tian et al. 2012b).

Figure 6. Activation of TMEM16A/ANO1 and TMEM16F/ANO6 by Ca2+, temperature and PLA2 .

Figure 6

Open in a new tab

A, current densities obtained at 37°C at 0 nm and 100 nm pipette Ca2+. B, ionomycin (1 μm) induced current densities in TMEM16A/ANO1 and TMEM16F/ANO6 expressing cells and inhibition by CaCCinAO1 (AO1, 20 μm), N‐(p‐amylcinnamoyl) anthranilic acid (ACA) (20 μm) and bromoenol lactone (BEL; 30 μm). C, activation of wild type TMEM16A/ANO1 or the low Ca2+‐affinity mutant E272Q by ionomycin (IONO, 1 μm), melittin (200 nm) or both together. Values are mean ± SEM (number of experiments). #Significant difference when compared to 100 nm Ca2+ (A) or IONO (B) (P < 0.05, unpaired t test). *Significant inhibition (P < 0.05, paired t test). D, model for Cl− movement and phospholipid scrambling activated by intracellular Ca2+, ROS‐inducing lipid peroxidation and lysophospholipids generated by PLA2.

The present data provide evidence that the activity of TMEM16A/ANO1 and TMEM16F/ANO6 depend on biophysical properties of plasma membrane phospholipids. In particular, tBHP, a strongly lipid peroxidizing agent, activated TMEM16A and TMEM16F Cl− currents (Martin et al. 2001) (Fig. 1 F and G). ROS activation of TMEM16F/ANO6 was also detected in cultured human lymphocytes and airway epithelial cells, which express ANO6 endogenously (Kmit et al. 2013; Simões et al. 2017). We found recently that activation of TMEM16F/ANO6 Cl− currents and phospholipid scrambling by tBHP was inhibited by the membrane‐permeable antioxidant idebenone. In contrast, activation of Cl− currents and phospholipid scrambling by ionomycin was not blocked by idebenone (Simões et al. 2017). This may suggest that the inhibitory effect of idebenone on TMEM16A/ANO1 described earlier may be at least partially due to scavenging of ROS and not through direct inhibition of TMEM16A/ANO1 (Seo et al. 2015).

PLA2 also strongly affects plasma membrane properties by generating lysophospholipids. We show that activators of PLA2 (melittin, NEM) or direct application of active PLA2 stimulates phospholipid scrambling and Cl− currents, respectively. We have previously shown that activation of PLA2 or lipid peroxidation does not lead to a measurable increase in intracellular Ca2+ (Sirianant et al. 2015), indicating that lipid activation of TMEM16A/F does not require an increase in intracellular Ca2+, but basal Ca2+ levels of around 100 nm are sufficient. The present data and our previous report suggest that heat as well as lipid‐dependent activation are synergistic on the Ca2+ response of TMEM16F/ANO6 (Sirianant et al. 2015). We show that TMEM16A/ANO1 and TMEM16F/ANO6 Cl− currents, either spontaneously active at 37°C or activated by PLA2, are potently inhibited by the PLA2 inhibitors ACA and BEL, strongly supporting PLA2‐specific action (Fig. 2 A–C). In contrast, Ca2+‐activated TMEM16A/F currents were only slightly inhibited by PLA2 inhibitors (Fig. 6 B), supporting complementary effects of Ca2+ and PLA2 on TMEM16A/F activity. Moreover, TMEM16A/F currents that were maximally activated by an increase in intracellular Ca2+ (IONO) were not further activated by additional activation of PLA2 (melittin). We hypothesized that putative membrane curvature caused by PLA2‐induced lysophospholipids may distort TMEM16A/F and enhance accessibility of Ca2+ to their binding sites. In support of this we found that TMEM16A‐E727Q, which has a very low affinity for Ca2+ (Yu et al. 2012), was poorly activated by IONO but was well activated by the PLA2 activator melittin, or combined application of melittin and IONO (Fig. 6 C). Thus, ANO1 currents are activated through an increase in intracellular Ca2+ and by PLA2, similar to PLA2‐dependent regulation of ANO6 (Sirianant et al. 2015). Lipid‐dependent regulation of TMEM16 proteins might be particularly relevant during inflammation, hypoxia and tissue reperfusion, as well as regulated cell death (Ousingsawat et al. 2015, 2017; Kunzelmann, 2016).

The present study shows that Cl− currents and phospholipid scrambling by TMEM16F/ANO6 are activated by similar mechanisms. This was further supported in a number of experiments with TMEM16F/ANO6‐activating or inhibitory mutants and TMEM16F/TMEM16A chimeric proteins (Figs 4 and 5). TMEM16A/ANO1 itself did not scramble when activated by Ca2+, which confirms the results of Yu et al. (2015). This can now be understood on the basis of the recent cryo‐electron microscopy structure of TMEM16A/ANO1, which indicates that in contrast to TMEM16F/ANO6, the TMEM16A/ANO1 pore/channel is completely shielded by protein (Paulino et al. 2017). Access of lipids to the TMEM16A pore is provided only at the intracellular side where the detachment of transmembrane α‐helices 4 and 6 form a funnel‐shaped vestibule that is exposed to the cytoplasm and the lipid bilayer. As pointed out previously, this vestibule may be a relic of an ancestral scramblase and possibly destabilizes the bilayer, similar to the scramblase nhTMEM16, or may itself be stabilized by lysophospholipids (Brunner et al. 2014; Bethel & Grabe, 2016; Paulino et al. 2017). Based on this new structural information, phospholipid transport by ANO1 chimeras containing a ‘ANO6 scramblase domain’ remains somewhat ambiguous (Paulino et al. 2017). Regardless, removing the so‐called scramblase domain (Yu et al. 2015) from TMEM16F/ANO6 inhibited both Ca2+‐activated phospholipid scrambling and Cl− currents. Scott disease mutations (Munnix et al. 2003; Castoldi et al. 2011; Kmit et al. 2013), an exon 1 splice mutation (ANO6ΔExon1) (Ehlen et al. 2012), single amino acid exchanges (D408G) (Suzuki et al. 2010), the N‐terminal insertion (Segawa et al. 2011) and the chimeric proteins examined here demonstrated a parallel increase or inhibition of phospholipid scrambling and Cl− currents. We therefore suggest that phospholipids and Cl− ions share the same intramolecular pathway, as reported recently for nhTMEM16 by Jiang et al. (2017). Taken together, the present data suggest regulation of TMEM16A/ANO1 and TMEM16F/ANO6 being more complex than thought initially. Our findings relate to recent reports on a novel exon found in human TMEM16A/ANO1 that alters Ca2+ sensitivity in association with other exons controlling activation by Ca2+ (Mazzone et al. 2015; Strege et al. 2015). Thus, other molecular regions within TMEM16 proteins as well as plasma membrane phospholipids control Cl− current and scramblase activity, in addition to the well‐described Ca2+ binding sites (Fig. 6 D).

Additional information

Competing interests

There are no competing interests.

Author contributions

Conception or design of the work and writing of the manuscript: RS, KR, KK, JO, PW. Acquisition, analysis or interpretation of the data: RS, JO, PW. All authors approved the final version of the manuscript. All authors agree to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All persons designated as authors qualify for authorship, and all those who qualify for authorship are listed.

Funding

This study was supported by DFG SFB699‐A7/A12, DFG KU756/12‐1, SFB877/A4 and UK CF Trust SRC003 INOVCF.

Translational perspective

The present work will help to understand the physiological and pathological role of anoctamins. Control of anoctamin activity by Ca2+ and membrane phospholipids may be particularly relevant during inflammation, hypoxia and tissue reperfusion as well as regulated cell death.

Edited by: Kim Barrett & Hsiao Chang Chan

This is an Editor's Choice article from the 15 January 2018 issue.

References

  1. Almaca J, Tian Y, AlDehni F, Ousingsawat J, Kongsuphol P, Rock JR, Harfe BD, Schreiber R & Kunzelmann K (2009). TMEM16 proteins produce volume regulated chloride currents that are reduced in mice lacking TMEM16A. J Biol Chem 284, 28571–28578. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Aoun J, Hayashi M, Sheikh IA, Sarkar P, Saha T, Ghosh P, Bhowmick R, Ghosh D, Chatterjee T, Chakrabarti P, Chakrabarti MK & Hoque KM (2016). Anoctamin 6 contributes to Cl– secretion in accessory cholera enterotoxin (Ace)‐stimulated diarrhea: an essential role for phosphatidylinositol 4,5‐bisphosphate (PIP2) signaling in cholera. J Biol Chem 291, 26816–26836. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bethel NP & Grabe M (2016). Atomistic insight into lipid translocation by a TMEM16 scramblase. Proc Natl Acad Sci USA 113, 14049–14054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Botelho HM, Uliyakina I, Awatade NT, Proenca MC, Tischer C, Sirianant L, Kunzelmann K, Pepperkok R & Amaral MD (2015). Protein traffic disorders: an effective high‐throughput fluorescence microscopy pipeline for drug discovery. Sci Rep 5, 9038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Broadbent SD, Ramjeesingh M, Bear CE, Argent BE, Linsdell P & Gray MA (2015). The cystic fibrosis transmembrane conductance regulator is an extracellular chloride sensor. Pflugers Arch 467, 1783–1794. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Brunner JD, Lim NK, Schenck S, Duerst A & Dutzler R (2014). X‐ray structure of a calcium‐activated TMEM16 lipid scramblase. Nature 516, 207–212. [DOI] [PubMed] [Google Scholar]
  7. Cabrita I, Benedetto R, Fonseca A, Wanitchakool P, Sirianant L, Skryabin BV, Schenk LK, Pavenstadt H, Schreiber R & Kunzelmann K (2017). Differential effects of anoctamins on intracellular calcium signals. FASEB J 31, 2123–2134. [DOI] [PubMed] [Google Scholar]
  8. Caputo A, Caci E, Ferrera L, Pedemonte N, Barsanti C, Sondo E, Pfeffer U, Ravazzolo R, Zegarra‐Moran O & Galietta LJ (2008). TMEM16A, a membrane protein associated with calcium‐dependent chloride channel activity. Science 322, 590–594. [DOI] [PubMed] [Google Scholar]
  9. Castoldi E, Collins PW, Williamson PL & Bevers EM (2011). Compound heterozygosity for 2 novel TMEM16F mutations in a patient with Scott syndrome. Blood 117, 4399–4400. [DOI] [PubMed] [Google Scholar]
  10. Cho H, Yang YD, Lee J, Lee B, Kim T, Jang Y, Back SK, Na HS, Harfe BD, Wang F, Raouf R, Wood JN & Oh U (2012). The calcium‐activated chloride channel anoctamin 1 acts as a heat sensor in nociceptive neurons. Nat Neurosci 15, 1015–1021. [DOI] [PubMed] [Google Scholar]
  11. Ehlen HW, Chinenkova M, Moser M, Munter HM, Krause Y, Gross S, Brachvogel B, Wuelling M, Kornak U & Vortkamp A (2012). Inactivation of Anoctamin‐6/Tmem16f, a regulator of phosphatidylserine scrambling in osteoblasts, leads to decreased mineral deposition in skeletal tissues. J Bone Miner Res 28, 246–259. [DOI] [PubMed] [Google Scholar]
  12. Ferrera L, Caputo A, Ubby I, Bussani E, Zegarra‐Moran O, Ravazzolo R, Pagani F & Galietta LJ (2009). Regulation of TMEM16A chloride channel properties by alternative splicing. J Biol Chem 284, 33360–33368. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Fink M, Lesage F, Duprat F, Heurteaux C, Reyes R, Fosset M & Lazdunski M (1998). A neuronal two P domain K+ channel stimulated by arachidonic acid and polyunsaturated fatty acids. EMBO J 17, 3297–3308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Jiang T, Yu K, Hartzell HC & Tajkhorshid E (2017). Lipids and ions traverse the membrane by the same physical pathway in the nhTMEM16 scramblase. Elife 6, e28671. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Jin X, Shah S, Liu Y, Zhang H, Lees M, Fu Z, Lippiat JD, Beech DJ, Sivaprasadarao A, Baldwin SA, Zhang H & Gamper N (2013). Activation of the Cl– channel ANO1 by localized calcium signals in nociceptive sensory neurons requires coupling with the IP3 receptor. Sci Signal 6, ra73. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Kmit A, van Kruchten R, Ousingsawat J, Mattheij NJ, Senden‐Gijsbers B, Heemskerk JW, Bevers EM & Kunzelmann K (2013). Calcium‐activated and apoptotic phospholipid scrambling induced by Ano6 can occur independently of Ano6 ion currents. Cell death and disease 25, e611. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kunzelmann K (2016). Ion channels in regulated cell death. Cell Mol Life Sci 73, 2387–2403. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Kunzelmann K, Nilius B, Owsianik G, Schreiber R, Ousingsawat J, Sirianant L, Wanitchakool P, Bevers EM & Heemskerk JW (2014). Molecular functions of anoctamin 6 (TMEM16F): a chloride channel, cation channel or phospholipid scramblase? Pflügers Arch 466, 407–414. [DOI] [PubMed] [Google Scholar]
  19. Martin C, Martinez R, Navarro R, Ruiz‐Sanz JI, Lacort M & Ruiz‐Larrea MB (2001). tert‐Butyl hydroperoxide‐induced lipid signaling in hepatocytes: involvement of glutathione and free radicals. Biochem Pharmacol 62, 705–712. [DOI] [PubMed] [Google Scholar]
  20. Martins JR, Faria D, Kongsuphol P, Reisch B, Schreiber R & Kunzelmann K (2011). Anoctamin 6 is an essential component of the outwardly rectifying chloride channel. Proc Natl Acad Sci USA 108, 18168–18172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Mazzone A, Gibbons SJ, Bernard CE, Nowsheen S, Middha S, Almada LL, Ordog T, Kendrick ML, Reid LK, Shen KR, Galietta LJ, Fernandez‐Zapico ME & Farrugia G (2015). Identification and characterization of a novel promoter for the human ANO1 gene regulated by the transcription factor signal transducer and activator of transcription 6 (STAT6). FASEB J 29, 152–163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Munnix IC, Harmsma M, Giddings JC, Collins PW, Feijge MA, Comfurius P, Heemskerk JW & Bevers EM (2003). Store‐mediated calcium entry in the regulation of phosphatidylserine exposure in blood cells from Scott patients. Thromb Haemost 89, 687–695. [PubMed] [Google Scholar]
  23. Namkung W, Phuan PW & Verkman AS (2011). TMEM16A inhibitors reveal TMEM16A as a minor component of CaCC conductance in airway and intestinal epithelial cells. J Biol Chem 286, 2365–2374. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Ousingsawat J, Cabrita I, Wanitchakool P, Sirianant L, Krautwald S, Linkermann A, Schreiber R & Kunzelmann K (2017). Ca2+ signals, cell membrane disintegration, and activation of TMEM16F during necroptosis. Cell Mol Life Sci 74, 173–181. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Ousingsawat J, Wanitchakool P, Kmit A, Romao AM, Jantarajit W, Schreiber S & Kunzelmann K (2015). Anoctamin 6 mediates effects essential for innate immunity downstream of P2X7‐receptors in macrophages. Nat Commun 6, 6245. [DOI] [PubMed] [Google Scholar]
  26. Paulino C, Neldner Y, Lam AK, Kalienkova V, Brunner JD, Schenck S & Dutzler R (2017). Structural basis for anion conduction in the calcium‐activated chloride channel TMEM16A. Elife 6, e26232. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Pavenstädt H, Lindeman S, Lindeman V, Späth M, Kunzelmann K & Greger R (1991). Potassium conductance of smooth muscle cells from rabbit aorta in primary culture. Pflügers Arch 419, 57–68. [DOI] [PubMed] [Google Scholar]
  28. Pedemonte N & Galietta LJ (2014). Structure and function of TMEM16 proteins (anoctamins). Physiol Rev 94, 419–459. [DOI] [PubMed] [Google Scholar]
  29. Ruiz C, Martins JR, Rudin F, Schneider S, Dietsche T, Fischer CA, Tornillo L, Terracciano LM, Schreiber R, Bubendorf L & Kunzelmann K (2012). Enhanced expression of ANO1 in head and neck squamous cell carcinoma causes cell migration and correlates with poor prognosis. PLoS One 7, e43265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Schreiber R, Boucherot A, Mürle B, Sun J & Kunzelmann K (2004). Control of epithelial ion transport by Cl− and PDZ proteins. J Membr Biol 199, 89–98. [DOI] [PubMed] [Google Scholar]
  31. Schreiber R, Uliyakina I, Kongsuphol P, Warth R, Mirza M, Martins JR & Kunzelmann K (2010). Expression and function of epithelial anoctamins. J Biol Chem 285, 7838–7845. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Schroeder BC, Cheng T, Jan YN & Jan LY (2008). Expression cloning of TMEM16A as a calcium‐activated chloride channel subunit. Cell 134, 1019–1029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Segawa K, Suzuki J & Nagata S (2011). Constitutive exposure of phosphatidylserine on viable cells. Proc Natl Acad Sci USA 108, 19246–19251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Seo Y, Park J, Kim M, Lee HK, Kim JH, Jeong JH & Namkung W (2015). Inhibition of ANO1/TMEM16A chloride channel by idebenone and its cytotoxicity to cancer cell lines. PLoS One 10, e0133656. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Simões F, Ousingsawat J, Wanitchakool P, Fonseca A, Cabrita I, Benedetto R, Schreiber R & Kunzelmann K (2017). CFTR supports cell death through ROS‐dependent activation of TMEM16F (anoctamin 6). Pflugers Arch, https://doi.org/10.1007/s00424-017-2065-0. [DOI] [PubMed] [Google Scholar]
  36. Sirianant L, Ousingsawat J, Wanitchakool P, Schreiber R & Kunzelmann K (2015). Cellular volume regulation by anoctamin 6:Ca2+, phospholipase A2, osmosensing. Pflügers Arch 468, 335–349. [DOI] [PubMed] [Google Scholar]
  37. Sirianant L, Wanitchakool P, Ousingsawat J, Benedetto R, Zormpa A, Cabrita I, Schreiber R & Kunzelmann K (2016). Non‐essential contribution of LRRC8A to volume regulation. Pflügers Arch 468, 1789–1796. [DOI] [PubMed] [Google Scholar]
  38. Sommer A, Kordowski F, Buch J, Maretzky T, Evers A, Andra J, Dusterhoft S, Michalek M, Lorenzen I, Somasundaram P, Tholey A, Sonnichsen FD, Kunzelmann K, Heinbockel L, Nehls C, Gutsmann T, Grotzinger J, Bhakdi S & Reiss K (2016). Phosphatidylserine exposure is required for ADAM17 sheddase function. Nat Commun 7, 11523. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Strege PR, Bernard CE, Mazzone A, Linden DR, Beyder A, Gibbons SJ & Farrugia G (2015). A novel exon in the human Ca2+‐activated Cl– channel Ano1 imparts greater sensitivity to intracellular Ca2+ . Am J Physiol Gastrointest Liver Physiol 309, G743–749. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Suzuki J, Umeda M, Sims PJ & Nagata S (2010). Calcium‐dependent phospholipid scrambling by TMEM16F. Nature 468, 834–838. [DOI] [PubMed] [Google Scholar]
  41. Tian Y, Schreiber R & Kunzelmann K (2012a). Anoctamins are a family of Ca2+ activated Cl– channels. J Cell Sci 125, 4991–4998. [DOI] [PubMed] [Google Scholar]
  42. Tian Y, Schreiber R, Wanitchakool P, Kongsuphol P, Sousa M, Uliyakina I, Palma M, Faria D, Traynor‐Kaplen AE, Fragata JI, Amaral MD & Kunzelmann K (2012b). Control of TMEM16A by INO‐4995 and other inositolphosphates. Br J Pharmacol 168, 253–265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Yang YD, Cho H, Koo JY, Tak MH, Cho Y, Shim WS, Park SP, Lee J, Lee B, Kim BM, Raouf R, Shin YK & Oh U (2008). TMEM16A confers receptor‐activated calcium‐dependent chloride conductance. Nature 455, 1210–1215. [DOI] [PubMed] [Google Scholar]
  44. Yu K, Duran C, Qu Z, Cui YY & Hartzell HC (2012). Explaining calcium‐dependent gating of anoctamin‐1 chloride channels requires a revised topology. Circ Res 110, 990–999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Yu K, Whitlock JM, Lee K, Ortlund EA, Yuan CY & Hartzell HC (2015). Identification of a lipid scrambling domain in ANO6/TMEM16F. Elife 4, e06901. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The Journal of Physiology are provided here courtesy of The Physiological Society

RESOURCES