Skip to main content
NCBI home page
Asian Pacific Journal of Cancer Prevention : APJCP logoLink to Asian Pacific Journal of Cancer Prevention : APJCP
. 2017;18(11):3055–3061. doi: 10.22034/APJCP.2017.18.11.3055

Anti-Vascular Endothelial Growth Factor Targeting by Curcumin and Thalidomide in Acute Myeloid Leukemia Cells

Mahdieh Salemi 1, Saeed Mohammadi 2,3, Ardeshir Ghavamzadeh 2,3, Mohsen Nikbakht 2,3,*
PMCID: PMC5773791  PMID: 29172279

Abstract

Acute myeloid leukemias (AMLs) are blood disorders that exhibit uncontrolled growth and reduction of apoptosis rates. As with other malignancies, progression may be result of induction and formation of new blood vessels influenced by disease conditions. Cancer cells produce a variety of factors which play important roles in angiogenesis. Vascular endothelial growth factor (VEGF) is critical for many malignancies, including AMLs. Curcumin, as a natural compound, is able to enhance apoptosis via a mechanism affecting regulatory genes. As a new strategy we here evaluated anti-VEGF properties of curcumin, alone and in combination with thalidomide, in leukemic cell lines. Growth inhibitory effects were assessed by MTT assay and apoptosis was detected by annexin/PI staining in U937 and KG-1 cell lines. mRNA expression levels of VEGF isoforms were evaluated by qRT-PCR. Curcumin inhibited proliferation and induced apoptosis in both KG-1 and U937 cells and this effect was stronger in combination with thalidomide. In KG-1 cells, the level of VEGF (A, B, C and D) mRNA was decreased in curcumin-treated as compared to untreated cells. Maximum effects were obtained at the concentration of 40 μM curcumin in U937 cells. Taken together, the results indicate that the VEGF autocrine loop may have an impact on AML development and progression and could be considered as a therapeutic target. Thalidomide as a VEGF inhibitor in combination with curcumin appears to have a synergistic impact on inhibition of cell proliferation and promotion of apoptosis.

Keywords: Curcumin, thalidomide, vascular endothelial growth factor, acute myeloid leukemia

Introduction

Leukemia is the most prevalent type of malignancy among children (Abrahamsson et al., 2011; Alizad Ghandforoush et al., 2016). Acute myeloid leukemia (AML) is the most common hematopoietic stem cell disorder which known through clonal proliferation of myeloid precursors (Dick, 1997; Lim and Jamieson, 2014). In spite of high dose chemotherapy however relapse is common after conventional therapy. Recent studies demonstrated that leukemic populations are extremely heterogeneous and leukemia caused by increasing a group of leukemic cells which called leukemic stem cells (LSC)(Lane and Gilliland, 2010; Ghasemi et al., 2015; Panah et al., 2017). LSC contact with hematopoietic niche, keep self-generality property and alleviate the effect of chemotherapy(Mohammadi et al., 2017). LSC population in Human AML can be detected by surface markers, including CD34+ CD38- and CD123+ (Mohammadi et al., 2016b; Panah et al., 2017; Mohammadi et al., 2017b). Molecular characteristics associated with LSC are including mutations in kinase domain, transcription factor, tumor suppressor or involving changes in cell growth and survival mechanisms. Although many pathways are still unknown, inhibition of well-known pathways may be considered as an effective therapeutic target for leukemia (Mirzaei et al., 2017). Curcumin (CUR) is a phytochemical which extracted from Curcuma longa (turmeric) (Cheng et al., 2001; Haghi et al., 2017a; Mirzaei et al., 2017a). This natural compound is known as an effective anticancer agent. CUR affect the biochemical and molecular cascades in malignant cells (Jha et al., 2010) and also is able to enhance apoptosis (Pesakhov et al., 2010; Mohammadi et al., 2016a) through affecting on regulatory genes involved in cell proliferation and apoptosis (Kuo et al., 1996). Likewise, CUR can suppress angiogenesis by suppressing of TNF-α and INF-γ (Wnendt et al., 1996; Corral et al., 1999; Majumdar et al., 2002)(Figure-1). Vascular Endothelial Growth Factor (VEGF) is one of the major mediators of angiogenesis which controls angiogenic budding by guiding filopodial extension from endothelial tip cells, as a first step of new vessels formation. (Barnhill et al., 1984; Li et al., 2002). This factor has also been introduced as vascular permeability factor (VPF) which released by tumor cells.(Gerhardt et al., 2003; Mimura et al., 2007; Smith et al., 2010). VEGF consider as a critical factor for cancer cells, including AML(Spilsbury et al., 2000; Xu et al., 2003). Over expression of this factor has huge impact on the process of leukemic cell proliferation and subsequently disease progression. Based on anti- VEGF function of Thalidomide (THAL) (Figure-2), for the first time we decided to evaluate the combination effect of CUR and THAL as a new strategy with unique anti-VEGF properties and induction of apoptosis in leukemic cell lines. Also, the effect of these compounds on mRNA expression level of different isoform of VEGF were evaluated in these cell lines.

Figure 1.

Figure 1

Open in a new tab

Molecular Pathway of Curcumin: Curcumin Suppresses the Activation of NF-κB via Inhibition of IκKB Activity, Leading to Suppression of Many NF-κB-Regulated Genes Involved in Tumorigenesis.

Figure 2.

Figure 2

Open in a new tab

Molecular Pathway of Thalidomide Include PI 3K\AKT\mTOR. The receptor and its signal transduction pathway and potential antiangiogenic property

Materials and Methods

Reagents

CUR, Annexin V-FITC apoptosis detection kit, dimethylsulfoxide (DMSO) and DEPC treated water were obtained from the Sigma-Aldrich, USA (Sigma-Aldrich, St. Louis, MO), and THAL was purchase from the Santa Cruz (Santa Cruz, Dallas, Texas). RPMI 1640 medium and fetal bovine serum (FBS) were purchased from Gibco (Gibco, Carlsbad, CA). The cDNA synthesis kit was purchased from Takara (Takara Bio Inc., Otsu, Japan). TRI pure was obtained from Roche (Roche Applied Science, Germany).

Cell lines and cell culture

The human leukemia cell lines U937 and KG-1 were obtained from the National Cell Bank of Iran (Pasteur Institute, Tehran, Iran). These cell lines were cultured in complete RPMI-1640 medium with 10% and 20% heat inactivated FBS for U937 and KG-1 cell line respectively, and supplemented with 100 U/mL penicillin, 100 μg/mL streptomycin. All cells were cultured in a humidified atmosphere at 37°C with 5% CO2 incubator. Cells were seeded at 1x105 cells/ml.

Cell proliferation assay

U937 and KG-1 cell line were seeded at an initial density 5 × 103 cells per well in 96-well plate and were treated with CUR, THAL and their combinations at 37ºC and 5% CO2 atmosphere for 24, 48 and 72 hours. The proliferation rate of cells was analyzed by MTT assay. Results were expressed as a proliferation rate, with 100% representing control cells treated with 0.1% DMSO alone.

Annexin V/PI

U937 and KG-1 cell lines were seeded at density of 3 × 105 cell/well and incubated for 24 hours in absence and presence of CUR, THAL and their combinations. To assess the percentage of apoptosis induction by treated compounds, fluorescein-conjugated Annexin V (Annexin V-FITC) staining assay was accomplished based on manufacturer protocol. The percentage of apoptosis was determined as a percentage of the Annexin V+/PI- cells through flow cytometry by BD flow cytometer instrument and analyzed with flow jow program.(Vermes et al., 2000; Njoh et al., 2006; Edward, 2009; Rieger et al., 2010; Ganjalikhani-Hakemi et al., 2017).

DNA cell cycle analysis

Cells were treated with indicated concentrations of CUR and THAL, then fixed in 70% in ethanol and dye by PI. Cells were assessed by BD flow cytometer instrument analyzed with flow jow program. The apoptotic cell fraction could predict from hypodiploid sub-G0/G1 DNA fraction.

RNA isolation and Real time PCR

Total cellular RNA was isolated by phenol-chloroform method using Tri-Pure extraction solution (Roche Applied Science, Peuzberg, Germany) according to the manufacturer´s guidelines and quality control to determine concentration, a 260:280 assay was conducted, Individual qPCR reactions performed with the standard StepOnePlus (Applied Biosystems™) using SYBR green Premix Ex Taq technology (Takara Bio Inc.) according to manufactures instructions, for each qpcr the result exported into excel file for statistical analysis based on2−ΔΔCT method to estimate copy number of selected genes, The cDNA concentration was then normalized in series of PCR by using HPRT primer (Nikbakht et al., 2017). The normalized cDNAs were subjected to amplification, using Step One Plus™ ABI instrument (Apply Bio systems, USA). The levels of HPRT mRNA expression were used to estimate the relative expression levels. The comparative Ct method was used to compute relative expression values. The primers and their corresponding amplicon lengths were provided in Table 1.

Table 1.

Real-Time PCR Primers

primer sequence Ref
GAPDH TGAACGGGAAGCTCACTGG Kong et al., (2014a)
TCCACCACCCTGTTGCTGTA
HPRT GCTATAAATTCTTTGCTGACCTGCTG Gusenbauer et al., (2015)
AATTACTTTTATGTCCCCTGTTGACTGG
VEGFA AGGGCAGAATCATCACGAAGT Kong et al., (2014b)
AGGGTCTCGATTGGATGGCA
VEGFB GAGATGTCCCTGGAAGAACACA Yang et al., (2009)
GAGTGGGATGGGTGATGTCAG
VEGFC GAGGAGCAGTTACGGTCTGTG Awad et al., (2016)
TCCTTTCCTTAGCTGACACTTGT
VEGF-D GTATGGACTCTCGCTCAGCAT Niki et al., (2000)
AGGCTCTCTTCATTGCAACAG
Open in a new tab

Statistical Analysis

All in vitro experiments were performed in triplicate, and results have been expressed as the mean ± standard deviation (SE). Student’s t test and one-way analysis of variance (one-way ANOVA) were used to determine statistical significances of difference. Statistical significance were defined at *P< 0.05, **P< 0.01, and ***P < 0.001 compared to corresponding control.

Results

Cell proliferation

The cytotoxic effect of CUR and THAL was evaluated in KG1 and U937. After treatment with different concentrations of CUR and THAL, growth suppressive effects were assessed by MTT assay for 24h, 48h and 72h. Our result indicated that CUR inhibited cell proliferation with IC50 value of 40 μM for both cell lines (Figure-3: B), (Figure-4: B). THAL inhibited cell proliferation with IC50 value of 60μM for U937 and 80μM for KG-1 cells (Figure-3: A), (Figure-4: A). Our results showed that CUR had a significant cytotoxic effect on both cell lines in dose dependent manners. To investigate the synergistic effect of CUR in combination with THAL, the proliferation rate of treated cells also were assessed at 24h and 48h post-treatments (72h had not significantly difference in compere with 48h). Moreover, the combination treatment was shown a significant effect on inhibiting cell proliferation in compere with single treatment in cited leukemic cells (Figure 3: C), Figure-4: C).

Figure 3.

Figure 3

Open in a new tab

Cell Proliferation in KG-1. Effects of Curcumin and Thalidomide on cell proliferation of KG-1 cell lines. The anti-proliferative effects of Curcumin (0-100 μM)(B), Thalidomide (0-100 μM)(A) and their combinations(C) on KG-1 were assessed by MTT assay after 24 h-48h and 72 h treatment. Significant difference between 48h and 72h was not observed. After detection of suitable doses for Curcumin (40μM) and Thalidomide (80μM), we evaluated combination effect of Curcumin and Thalidomide. Combination effect of Curcumin and Thalidomide compared to the control or even single compound could significantly decrease cell proliferation in KG-1 cell lines. Data are mean ± S.E of three independent experiments. Statistical significance were defined at *P<0.05, **P<0.01 and ***P<0.001compared to corresponding control.

Figure 4.

Figure 4

Open in a new tab

Cell proliferation in U937. Effects of Curcumin and Thalidomide on cell proliferation of U937 cell lines. The anti-proliferative effects of Thalidomide (0-100 μM) (A), Curcumin (0-100 μM) (B), and their combinations(C) on U937 were assessed by MTT assay after 24 h-48h and 72 h treatment. Significant difference between 48h and 72h was not observed. After detection of suitable doses for Curcumin (40μM) and Thalidomide (60μM), we evaluated combination effect of Curcumin and Thalidomide. Combination effect of Curcumin and Thalidomide compared to the control or even single compound could significantly decrease cell proliferation in U937 cell lines. Data are mean ± S.E of three independent experiments. Statistical significance were defined at *P<0.05, **P<0.01 and ***P<0.001compared to corresponding control.

Apoptosis

To apoptotic induction effects of THAL and CUR in KG and U937 cells, were assessed by Annexin\PI staining. For this reason the cells were treated and incubated with indicated concentration of THAL and CUR for 24 h. Therefore, the AML cell lines of this study have been treated with indicated concentration of cited compounds and their combination for different period following analysis of percentage of apoptosis. We observed a significant increase in early apoptotic cells and minimum percentage of necrosis when cells were treated with concentration THAL-60 µM, CUR-40 µM and CUR-40 µM + THAL- 60 µM for U937 and THAL- 80µM, CUR-40 µM and CUR-40 µM + THAL-80 µM for KG-1 cells as compared with control in both cell lines (Figure-5), (Figure-6).

Figure 5.

Figure 5

Open in a new tab

Apoptosis Assay in KG-1 Cell Line after 24h. Cells in the Lower Right Quadrant Represented Apoptosis while in the Upper Right Quadrant Indicated Post-ApoptoticNecrosis. Data are mean ± S.E of three independent experiments. Statistical significance were defined at *P<0.05, **P<0.01 and ***P<0.001compared to corresponding control.

Figure 6.

Figure 6

Open in a new tab

Apoptosis Assay in U937 Cell Line after 24h. Cells in the lower right quadrant represented apoptosis while in the upper right quadrant indicated post-apoptotic necrosis. Data are mean ± S.E of three independent experiments. Statistical significance were defined at *P<0.05, **P<0.01 and ***P<0.001compared to corresponding control

DNA cell cycle analysis

DNA content of KG-1 and U937 cells was evaluated during cell cycle to get information about cell cycle progression. In present study after treatment of U937 the cell population in G0/G1 phase increased in all doses especially when cells were treated with CUR-40 µM +THAL-60 µM for 24h, the cell population in G0 phase increased from 1.44% to 8.2%. Moreover the cell population in G0/G1 phase increased in treated cited cell lines for all doses especially when cells were treated with CUR-40 µM +THAL-80 µM for 24h, the cell population in G0 phase increased up to 48.7% (Figure-7).

Figure 7.

Figure 7

Open in a new tab

The concentration-depended effects of Thalidomide and Curcumin and their combination on cell cycle. A) Following 24h of Thalidomide and Curcumin and their combination treatment flow cytometric analysis was used to measure of cellular DNA content. B) Percentages of cell populations in different phases of the cell cycle for U937 cells are plotted at different concentrations. Escalated doses of Thalidomide and Curcumin and their combination caused a significant accumulation of cells in theG0 /G1 phase.

VEGF mRNA expression level was increased in Curcumin and Thalidomide treated AML cells

The expression of VEGF isoforms in treated cells were evaluated by Real-time PCR. KG-1 cells were treated with selective concentrations of CUR (20μM - 100 μM), THAL-80μM and also their combination for 24h. We observed that the mRNA expression of VEGF (B, C and D) significantly downregulated when KG-1 cells were treated with CUR-40μM while significant change in mRNA expression of VEGFA was not observed. The significant downregulation VEGF isoforms observed when cells treated with 40 μM CUR in U937 cells. (Figure-8: A). The mRNA level of VEGF (B, C and D) was decreased in CUR-treated KG-1 cells as compared to the untreated cells (Figure-8: B).

Figure 8.

Figure 8

Open in a new tab

The Effects of Curcumin and Thalidomide and Their Combination on the mRNA Level of VEGF-A, VEGF-B, VEGF-C and VEGF-D in U937 Cells(A). The effect of curcumin (40 μM) and thalidomide (80 μM) and combination (curcumin 40 μM thalidomide 80 μM) on the expression levels of VEGF-A, VEGF-B, VEGF-C and VEGF-D was determined by qRT-PCR analysis in KG-1 cells(B). Values are given as mean ± S.E. of three independent experiments. Statistical significance was defined at *P < 0.05, **P < 0.01 and ***P < 0.001 compared to corresponding untreated controls.

The mRNA expression of VEGF-A decreased when cells treated with these concentrations and also their combination. In addition, the expression of VEGF-B mRNA declined when cells treated with CUR-40 μM, THAL-80 μM and their combination. In addition we observed that VEGF-C expression was down-regulated in response to CUR-40 µM treatment respectively but the THAL and its combination with CUR increased the expression level of VEGF-C mRNA. Furthermore the expression level of VEGF-D mRNA inhibited via CUR-40µM and decreased by THAL and its combination with CUR. In KG-1 cells the mRNA expression of VEGF-A decreased in THAL and combination of CUR-40 µM +THAL-80 µM. We also indicate that the level of VEGF-B, VEGF-C and VEGF-D mRNA expression decrease in response to all compounds and their combination (Figure-8: A-B).

Discussion

AML is a progressive disease which characterized (Rubnitz et al., 2010; Mohammadi et al., 2017c) by high proliferation of leukemic cells with repression of normal hematopoiesis in the bone marrow. Leukemic cells produce various factors in hypoxic condition to promote vascular formation. Among those factors, VEGF has critical role in enhancing proliferation, migration and differentiation of endothelial cells (Santos and Dias, 2004; Haghi et al., 2017). The level of VEGF mRNA expression, its receptors and also microvessel density as index of angiogenesis are admitted element in solid tumor(Ferrara et al., 2003). Recent studies indicated that growth of leukemias like solid tumor can be depend on angiogenesis (Schuch et al., 2002). Endothelia cell of bone marrow release leukemic growth factor including macrophage colony-stimulating factor, granulocyte, interleukin (IL-6) and IL-10. Perez-Atayde and his colleagues for the first time explained significant increase in microvessel density in the bone marrow in childhood ALL. They indicated that leukemic cells secrete VEGF and also other cytokines (Perez-Atayde et al., 1997). Fiedler and his colleagues indicated that AML blasts express VEGF as well as its receptors(Fiedler et al., 1997). Anti-angiogenic therapy known as one of the most promising strategy for human neoplasia (Li et al., 2002). Most of anti-angiogenesis agents are able to inhibit VEGF, TNF-α and bFGF production and consequently decrease the formation of new capillaries (KENYON et al., 1997). In present study for the first time we reported that combination of CUR and THAL can effectively decrease VEGF expression and consequently inhibit AML progress.

THAL is known to be a potent inhibitor of angiogenesis which used for the treatment of cancer, leprosy and chronic graft versus host disease (Komorowski et al., 2006). THAL has been proven to block VEGF-induced angiogenesis (Kenyon et al., 1997). Various studies demonstrated that CUR (the active principle of turmeric) as a phytochemical inhibits proliferation in different type of cancer cells via targeting multiple cellular signaling pathways such as NF-kB, the mitogen-activated protein kinase, Wnt, phosphoinositide-3 kinase/Akt/mammalian target of rapamycin and Notch-mediated signaling pathways (Wang et al., 2006; Yu et al., 2008). Furthermore, CUR could enhance apoptosis in various cancers cell line including human leukemia cell lines through downregulated NF-kB activity(Anto et al., 2002). Moreover CUR is able to inhibit VEGF- induced angiogenesis through MAPKs to prevent cancer pathogenesis (Binion et al., 2008). We observed that THAL and CUR promote apoptosis, repress cell proliferation and also decrease VEGF mRNA expression in KG-1 and U937 cell lines. In addition we observed significant difference in combination of compounds as compare with single agent. We also demonestrated that CUR in combination with anti-VEGF (THAL) enhanced anti-angiogenic activity as compared with CUR alone.

Komorowski et al., (2006) indicated that anti-angiogenic feature of THAL is related to direct inhibitory function of VEGF secretion and capillary microvessel formation in human endothelial cell line EA.hy 926. Li et al., (2002) in a research which focus on lung cancer cell line shown that THAL highly declined the protein levels of VEGF and bFGF in a dose- and time-dependent manner. Moreover, Steins et al., (2003) reported that THAL has significant anti-leukemic function with some evidence for anti-angiogenic activity in bone marrow.

Chakraborty et al., (2008) showed that CUR represses OPN-induced VEGF expression and tumor angiogenesis. In another study Yoysungnoen and his colleague explained that treatment with this phytochemical significantly reduce the tumor-induced over-expression of COX-2 and serum VEGF in hepatocellular carcinoma cell which exhibit that CUR is able to inhibit tumor angiogenesis (Yoysungnoen et al., 2006). In addition Gururaj et al., (2002) confirmed angio-inhibitory effect of this natural compound at the level of gene expression. furthermore Chen et al., (2005) indicated anti-angiogenesis effect of CUR through suppressing VEGF in U937 leukemic cell line.

In conclusion, to sum up, the VEGF autocrine loop may has potential impact on AML development and progression and could be considered as a therapeutic target. Thalidomide as a VEGF inhibitor in combination with Curcumin has a synergistic impact on inhibition of cell proliferation and promotion of apoptosis.

Conflicts of interest

The authors declare no conflicts of interest.

Acknowledgments

This study was performed in Hematology, Oncology and Stem Cell Transplantation Research Center, Tehran University of Medical Sciences.

References

  1. Abrahamsson J, Forestier E, Heldrup J, et al. Response-guided induction therapy in pediatric acute myeloid leukemia with excellent remission rate. J Clin Oncol. 2011;29:310–5. doi: 10.1200/JCO.2010.30.6829. [DOI] [PubMed] [Google Scholar]
  2. Alizad Ghandforoush N, Chahardouli B, Rostami S, et al. Evaluation of minimal residual disease in acute myeloid leukemia with NPM1 marker. Int J Hematol Oncol Stem Cell Res. 2016;10:147–52. [PMC free article] [PubMed] [Google Scholar]
  3. Anto RJ, Mukhopadhyay A, Denning K, et al. Curcumin (diferuloylmethane) induces apoptosis through activation of caspase-8, BID cleavage and cytochrome c release: its suppression by ectopic expression of Bcl-2 and Bcl-xl. Carcinogenesis. 2002;23:143–50. doi: 10.1093/carcin/23.1.143. [DOI] [PubMed] [Google Scholar]
  4. Awad KS, Elinoff JM, Wang S, et al. Raf/ERK drives the proliferative and invasive phenotype of BMPR2-silenced pulmonary artery endothelial cells. Am J Physiol Lung Cell Mol Physiol. 2016;310:187–201. doi: 10.1152/ajplung.00303.2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Barnhill RL, Doll NJ, Millikan LE, et al. Studies on the anti-inflammatory properties of thalidomide: effects on polymorphonuclear leukocytes and monocytes. J Am Acad Dermatol. 1984;11:814–9. doi: 10.1016/s0190-9622(84)80458-2. [DOI] [PubMed] [Google Scholar]
  6. Binion DG, Otterson MF, Rafiee P. Curcumin inhibits VEGF-mediated angiogenesis in human intestinal microvascular endothelial cells through COX-2 and MAPK inhibition. Gut. 2008;57:1509–17. doi: 10.1136/gut.2008.152496. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chakraborty G, Jain S, Kale S, et al. Curcumin suppresses breast tumor angiogenesis by abrogating osteopontin-induced VEGF expression. Mol Med Rep. 2008;1:641–6. doi: 10.3892/mmr_00000005. [DOI] [PubMed] [Google Scholar]
  8. Chen W-H, Chen Y, Cui G-H. Effects of TNF-alpha and curcumin on the expression of VEGF in Raji and U937 cells and on angiogenesis in ECV304 cells. Chin Med J. 2005;118:2052–7. [PubMed] [Google Scholar]
  9. Cheng A-L, Hsu C-H, Lin J-K, et al. Phase I clinical trial of curcumin, a chemopreventive agent, in patients with high-risk or pre-malignant lesions. Anticancer Res. 2001;21:2895–900. [PubMed] [Google Scholar]
  10. Corral LG, Haslett PA, Muller GW, et al. Differential cytokine modulation and T cell activation by two distinct classes of thalidomide analogues that are potent inhibitors of TNF-alpha. J Immunol. 1999;163:380–6. [PubMed] [Google Scholar]
  11. Dick D. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nature Med. 1997;3:730–7. doi: 10.1038/nm0797-730. [DOI] [PubMed] [Google Scholar]
  12. Edward R. Use of DNA-specific anthraquinone dyes to directly reveal cytoplasmic and nuclear boundaries in live and fixed cells. Mol Cell. 2009;27:391–6. doi: 10.1007/s10059-009-0066-3. [DOI] [PubMed] [Google Scholar]
  13. Ferrara N, Gerber H-P, LeCouter J. The biology of VEGF and its receptors. Nat Med. 2003;9:669–76. doi: 10.1038/nm0603-669. [DOI] [PubMed] [Google Scholar]
  14. Fiedler W, Graeven U, Ergün S, et al. Vascular endothelial growth factor, a possible paracrine growth factor in human acute myeloid leukemia. Blood. 1997;89:1870–5. [PubMed] [Google Scholar]
  15. Ganjalikhani-Hakemi M, Yazdani R, Esmaeili M, et al. Role of apoptosis in the pathogenesis of common variable immunodeficiency (CVID) Endocr Metab Immune Disord Drug Targets. 2017 doi: 10.2174/1871530317666170919120245. [DOI] [PubMed] [Google Scholar]
  16. Gerhardt H, Golding M, Fruttiger M, et al. VEGF guides angiogenic sprouting utilizing endothelial tip cell filopodia. J Cell Biol. 2003;161:1163–77. doi: 10.1083/jcb.200302047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Ghasemi A, Rostami S, Chahardouli B, et al. Study of SFRP1 and SFRP2 methylation status in patients with de novo Acute Myeloblastic Leukemia. Int J Hematol Oncol Stem Cell Res. 2015;9:15–21. [PMC free article] [PubMed] [Google Scholar]
  18. Gururaj AE, Belakavadi M, Venkatesh DA, et al. Molecular mechanisms of anti-angiogenic effect of curcumin. Biochem Biophys Res Commun. 2002;297:934–42. doi: 10.1016/s0006-291x(02)02306-9. [DOI] [PubMed] [Google Scholar]
  19. Gusenbauer S, Zanucco E, Knyazev P, Ullrich A. Erk2 but not Erk1 regulates crosstalk between Met and EGFR in squamous cell carcinoma cell lines. Mol Cancer. 2015;14:54. doi: 10.1186/s12943-015-0319-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Haghi A, Azimi H, Rahimi R. A Comprehensive Review on pharmacotherapeutics of three phytochemicals, curcumin, quercetin, and Allicin, in the treatment of gastric cancer. J Gastrointest Cancer. 2017a doi: 10.1007/s12029-017-9997-7. [DOI] [PubMed] [Google Scholar]
  21. Haghi A, Mohammadi S, Heshmati M, et al. Anti-vascular endothelial growth factor effects of sorafenib and arsenic trioxide in acute myeloid leukemia cell lines. Asian Pac J Cancer Prev. 2017b;18:1655–61. doi: 10.22034/APJCP.2017.18.6.1655. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Jha AK, Nikbakht M, Parashar G, et al. Reversal of hypermethylation and reactivation of the RARbeta2 gene by natural compounds in cervical cancer cell lines. Folia Biol (Praha) 2010;56:195–200. [PubMed] [Google Scholar]
  23. Kenyon BM, Browne F, D'amato RJ. Effects of thalidomide and related metabolites in a mouse corneal model of neovascularization. Exp Eye Res. 1997;64:971–8. doi: 10.1006/exer.1997.0292. [DOI] [PubMed] [Google Scholar]
  24. Komorowski J, Jerczyńska H, Siejka A, et al. Effect of thalidomide affecting VEGF secretion, cell migration, adhesion and capillary tube formation of human endothelial EAhy 926 cells. Life Sci. 2006;78:2558–63. doi: 10.1016/j.lfs.2005.10.016. [DOI] [PubMed] [Google Scholar]
  25. Kong X, Yao J, Luo W, et al. Estrogen regulates the tumour suppressor MiRNA-30c and its target gene, MTA-1, in endometrial cancer. PLoS One. 2014a;9:e90810. doi: 10.1371/journal.pone.0090810. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Kong X, Yao J, Luo W, et al. The expression and functional role of a FOXC1 related mRNA-lncRNA pair in oral squamous cell carcinoma. Mol Cell Biochem. 2014b;394:177–86. doi: 10.1007/s11010-014-2093-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Kuo M-L, Huang T-S, Lin J-K. Curcumin, an antioxidant and anti-tumor promoter, induces apoptosis in human leukemia cells. Biochim Biophys Acta. 1996;1317:95–100. doi: 10.1016/s0925-4439(96)00032-4. [DOI] [PubMed] [Google Scholar]
  28. Lane SW, Gilliland DG. Leukemia stem cells. Semin Cancer Biol. 2010:71–6. doi: 10.1016/j.semcancer.2009.12.001. [DOI] [PubMed] [Google Scholar]
  29. Li X, Liu X, Wang J, et al. Thalidomide down-regulates the expression of VEGF and bFGF in cisplatin-resistant human lung carcinoma cells. Anticancer Res. 2002;23:2481–7. [PubMed] [Google Scholar]
  30. Lim MY, Jamieson K. Profile of sapacitabine: potential for the treatment of newly diagnosed acute myeloid leukemia in elderly patients. Clin Interv Aging. 2014;9:753. doi: 10.2147/CIA.S39558. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Majumdar S, Lamothe B, Aggarwal BB. Thalidomide suppresses NF-kappa B activation induced by TNF and H2O2 but not that activated by ceramide, lipopolysaccharides, or phorbol ester. J Immunol. 2002;168:2644–51. doi: 10.4049/jimmunol.168.6.2644. [DOI] [PubMed] [Google Scholar]
  32. Mimura K, Kono K, Takahashi A, et al. Vascular endothelial growth factor inhibits the function of human mature dendritic cells mediated by VEGF receptor-2. Cancer Immunol Immunother. 2007;56:761–70. doi: 10.1007/s00262-006-0234-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Mirzaei A, Ghaffari SH, Nikbakht M, et al. OPN b and c isoforms doubtless veto anti-angiogenesis effects of curcumin in combination with conventional AML regiment. Asian Pac J Cancer Prev. 2017a;18:2591–9. doi: 10.22034/APJCP.2017.18.9.2591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Mirzaei A, Mohammadi S, Ghaffari SH, et al. Osteopontin b and c isoforms: Molecular candidates associated with leukemic stem cell chemoresistance in acute myeloid leukemia. Asian Pac J Cancer Prev. 2017b;18:1707–15. doi: 10.22034/APJCP.2017.18.6.1707. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Mohammadi S, Ghaffari SH, Shaiegan M, et al. Curcumin veto the effects of osteopontin (OPN) specific inhibitor on leukemic stem cell colony forming potential via promotion of OPN overexpression. Int J Hematol Oncol Stem Cell Res. 2016a;10:120–9. [PMC free article] [PubMed] [Google Scholar]
  36. Mohammadi S, Ghaffari SH, Shaiegan M, et al. Acquired expression of osteopontin selectively promotes enrichment of leukemia stem cells through AKT/mTOR/PTEN/beta-catenin pathways in AML cells. Life Sci. 2016b;152:190–8. doi: 10.1016/j.lfs.2016.04.003. [DOI] [PubMed] [Google Scholar]
  37. Mohammadi S, Nikbakht M, Sajjadi SM, et al. Reciprocal interactions of leukemic cells with bone marrow stromal cells promote enrichment of leukemic stell cell compartments in response to curcumin and daunorubicin. Asian Pac J Cancer Prev. 2017a;18:831–40. doi: 10.22034/APJCP.2017.18.3.831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Mohammadi S, Zahedpanah M, Ghaffari SH, et al. Osteopontin plays a unique role in resistance of CD34+/CD123+human leukemia cell lines KG1a to parthenolide. Life Sci. 2017b;189:89–95. doi: 10.1016/j.lfs.2017.09.019. [DOI] [PubMed] [Google Scholar]
  39. Mohammadi S, Zahedpanah M, Nikbakht M, et al. Parthenolide reduces gene transcription of prosurvival mediators in U937 cells. Exp Oncol. 2017c;39:30–5. [PubMed] [Google Scholar]
  40. Nikbakht M, Jha AK, Malekzadeh K, et al. Aberrant promoter hypermethylation of selected apoptotic genes in childhood acute lymphoblastic leukemia among North Indian population. Exp Oncol. 2017;39:57–64. [PubMed] [Google Scholar]
  41. Niki T, Iba S, Tokunou M, et al. Expression of vascular endothelial growth factors A, B, C, and D and their relationships to lymph node status in lung adenocarcinoma. Clin Cancer Res. 2000;6:2431–9. [PubMed] [Google Scholar]
  42. Njoh KL, Patterson LH, Zloh M, et al. Spectral analysis of the DNA targeting bisalkylaminoanthraquinone DRAQ5 in intact living cells. Cytometry Part A. 2006;69:805–14. doi: 10.1002/cyto.a.20308. [DOI] [PubMed] [Google Scholar]
  43. Panah MZ, Nikbakht M, Sajjadi SM, et al. Anti-apoptotic effects of osteopontin via the up-regulation of AKT/mTOR/β-catenin loop in acute myeloid leukemia cells. Int J Hematol Oncol Stem Cell Res. 2017;11:148–57. [PMC free article] [PubMed] [Google Scholar]
  44. Perez-Atayde AR, Sallan SE, Tedrow U, et al. Spectrum of tumor angiogenesis in the bone marrow of children with acute lymphoblastic leukemia. Am J pathol. 1997;150:815. [PMC free article] [PubMed] [Google Scholar]
  45. Pesakhov S, Khanin M, Studzinski GP, et al. Distinct combinatorial effects of the plant polyphenols curcumin, carnosic acid, and silibinin on proliferation and apoptosis in acute myeloid leukemia cells. Nutr Cancer. 2010;62:811–24. doi: 10.1080/01635581003693082. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Rieger AM, Hall BE, Schang LM, et al. Conventional apoptosis assays using propidium iodide generate a significant number of false positives that prevent accurate assessment of cell death. J Immunol Methods. 2010;358:81–92. doi: 10.1016/j.jim.2010.03.019. [DOI] [PubMed] [Google Scholar]
  47. Rubnitz JE, Gibson B, Smith FO. Acute myeloid leukemia. Hematol Oncol Clin North Am. 2010;24:35–63. doi: 10.1016/j.hoc.2009.11.008. [DOI] [PubMed] [Google Scholar]
  48. Santos SCR, Dias S. Internal and external autocrine VEGF/KDR loops regulate survival of subsets of acute leukemia through distinct signaling pathways. Blood. 2004;103:3883–9. doi: 10.1182/blood-2003-05-1634. [DOI] [PubMed] [Google Scholar]
  49. Schuch G, Machluf M, Bartsch G, et al. In vivo administration of vascular endothelial growth factor (VEGF) and its antagonist, soluble neuropilin-1, predicts a role of VEGF in the progression of acute myeloid leukemia in vivo. Blood. 2002;100:4622–8. doi: 10.1182/blood.V100.13.4622. [DOI] [PubMed] [Google Scholar]
  50. Smith NR, Baker D, James NH, et al. Vascular endothelial growth factor receptors VEGFR-2 and VEGFR-3 are localized primarily to the vasculature in human primary solid cancers. Clini Cancer Res. 2010;16:3548–61. doi: 10.1158/1078-0432.CCR-09-2797. [DOI] [PubMed] [Google Scholar]
  51. Spilsbury K, Garrett KL, Shen W-Y, et al. Overexpression of vascular endothelial growth factor (VEGF) in the retinal pigment epithelium leads to the development of choroidal neovascularization. Am J Pathol. 2000;157:135–44. doi: 10.1016/S0002-9440(10)64525-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Steins M, Bieker R, Padro T, et al. Thalidomide for the treatment of acute myeloid leukemia. Leuk Lymphoma. 2003;44:1489–93. doi: 10.3109/10428190309178769. [DOI] [PubMed] [Google Scholar]
  53. Vermes I, Haanen C, Reutelingsperger C. Flow cytometry of apoptotic cell death. J Immunol Methods. 2000;243:167–90. doi: 10.1016/s0022-1759(00)00233-7. [DOI] [PubMed] [Google Scholar]
  54. Wang Z, Zhang Y, Banerjee S, et al. Notch-1 down-regulation by curcumin is associated with the inhibition of cell growth and the induction of apoptosis in pancreatic cancer cells. Cancer. 2006;106:2503–13. doi: 10.1002/cncr.21904. [DOI] [PubMed] [Google Scholar]
  55. Wnendt S, Finkam M, Winter W, et al. Enantioselective inhibition of TNF-alpha release by thalidomide and thalidomide-analogues. Chirality. 1996;8:390–6. doi: 10.1002/(SICI)1520-636X(1996)8:5<390::AID-CHIR6>3.0.CO;2-I. [DOI] [PubMed] [Google Scholar]
  56. Xu D, Meng F, Yi Z. Role of vascular endothelial growth factor (VEGF) in development and progress of refractory acute myeloid leukemia. Chin J Cancer. 2003;22:844–8. [PubMed] [Google Scholar]
  57. Yang S, Dong Q, Yao M, et al. Establishment of an experimental human lung adenocarcinoma cell line SPC-A-1BM with high bone metastases potency by 99m Tc-MDP bone scintigraphy. Nucl Med Biol. 2009;36:313–21. doi: 10.1016/j.nucmedbio.2008.12.007. [DOI] [PubMed] [Google Scholar]
  58. Yoysungnoen P, Wirachwong P, Bhattarakosol P, et al. Effects of curcumin on tumor angiogenesis and biomarkers, COX-2 and VEGF, in hepatocellular carcinoma cell-implanted nude mice. Clin Hemorheol Microcirc. 2006;34:109–15. [PubMed] [Google Scholar]
  59. Yu S, Shen G, Khor TO, et al. Curcumin inhibits Akt/mammalian target of rapamycin signaling through protein phosphatase-dependent mechanism. Mol Cancer Ther. 2008;7:2609–20. doi: 10.1158/1535-7163.MCT-07-2400. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Asian Pacific Journal of Cancer Prevention : APJCP are provided here courtesy of West Asia Organization for Cancer Prevention

RESOURCES