Skip to main content
NCBI home page
British Journal of Pharmacology logoLink to British Journal of Pharmacology
. 2017 Dec 22;175(3):456–468. doi: 10.1111/bph.14094

Up‐regulation of PYK2/PKCα‐dependent haem oxygenase‐1 by CO‐releasing molecule‐2 attenuates TNF‐α‐induced lung inflammation

Chih‐Chung Lin 1, Yu‐Ching Chiang 2, Rou‐Ling Cho 2, Wei‐Ning Lin 4, Chien‐Chung Yang 2,3, Li‐Der Hsiao 1, Chuen‐Mao Yang 1,2,5,✉
PMCID: PMC5774003  PMID: 29139546

Abstract

Background and Purpose

Haem oxygenase‐1 (HO‐1) could provide cytoprotection against various inflammatory diseases. However, the mechanisms underlying the protective effect of CO‐releasing molecule‐2 (CORM‐2)‐induced HO‐1 expression against TNF‐α‐induced inflammatory responses in human pulmonary alveolar epithelial cells (HPAEpiCs) remain unknown.

Experimental Approach

CORM‐2‐induced HO‐1 protein and mRNA expression, and signalling pathways were determined by Western blot and real‐time PCR, coupled with respective pharmacological inhibitors or transfection with siRNAs. The effect of CORM‐2 on TNF‐α‐induced increase in leukocyte counts in BAL fluid and VCAM‐1 expression in lung was determined by cell counting and Western blot analysis.

Key Results

CORM‐2 attenuated the TNF‐α‐induced pulmonary haematoma, VCAM‐1 expression and increase in leukocytes through an up‐regulation of HO‐1 in mice; this effect of CORM‐2 was reversed by the HO‐1 inhibitor zinc protoporphyrin IX. Furthermore, CORM‐2 increased HO‐1 protein and mRNA expression as well as the phosphorylation of PYK2, PKCα and ERK1/2 (p44/p42 MAPK) in HPAEpiCs; these effects were attenuated by their respective pharmacological inhibitors or transfection with siRNAs. Inhibition of PKCα by Gö6976 or Gö6983 attenuated CORM‐2‐induced stimulation of PKCα and ERK1/2 phosphorylation but had no effect on PYK2 phosphorylation. Moreover, inhibition of PYK2 by PF431396 reduced the phosphorylation of all three protein kinases. Finally, PYK2/PKCα/ERK1/2‐mediated stimulation of activator protein 1 was shown to play a key role in CORM‐2‐induced HO‐1 expression via an up‐regulation of c‐Fos mRNA.

Conclusions and Implications

CORM‐2 activates a PYK2/PKCα/ERK1/2/AP‐1 pathway leading to HO‐1 expression in HPAEpiCs. This HO‐1/CO system might have potential as a therapeutic target in pulmonary inflammation.

Abbreviations

COPD

chronic obstructive pulmonary disease

CORM‐2

carbon monoxide‐releasing molecule‐2

HO‐1

haem oxygenase‐1

HPAEpiCs

human pulmonary alveolar epithelial cells

ICAM‐1

intercellular adhesion molecule

MTT

3‐(4,5‐cimethylthiazol‐2‐yl)‐2,5‐diphenyl tetrazolium bromide

PMNs

polymorphonuclear cells

VCAM‐1

vascular cell adhesion molecule

ZnPPIX

zinc protoporphyrin IX

Introduction

Injuries of alveolar epithelial cells alter lung respiratory function resulting in various lung diseases such as chronic obstructive pulmonary disease (COPD), which is implicated in pulmonary inflammation (Barnes, 2008). During the inflammation, an up‐regulation of adhesion molecules, such as intercellular adhesion molecule (ICAM‐1) and vascular cell adhesion molecule (VCAM‐1), on the surface of endothelial cells or multiple airway resident cells contribute to the recruitment of polymorphonuclear cells (PMNs) to the regions of inflammation in response to TNF‐α or IL‐1β. Therefore, the attenuation of the recruitment of PMNs may be an effective therapeutic strategy for inflammation‐related pathologies. However, the induction of haem oxygenase‐1 (HO‐1) occurs as an adaptive response and has beneficial effects in several inflammatory conditions and has been implicated in many clinically relevant diseases (Lee et al., 2008). The main function of HO‐1 is to catalyse the rate‐limiting step of haem degradation, resulting in the formation of iron, carbon monoxide (CO), and biliverdin, which is subsequently converted to bilirubin by biliverdin reductase (Soares and Bach, 2009). HO‐1 exerts anti‐inflammatory and anti‐apoptotic functions which are mediated via a CO‐dependent mechanism, since the administration of low concentrations of CO showed similar effects to HO‐1 (Slebos et al., 2003). Since CO inhalation cannot be accurately regulated and prolonged exposure may be toxic to tissues, CO‐releasing molecules (CORMs) were developed to allow selective delivery and release of CO from a nontoxic pro‐drug. A transition metal carbonyl‐based compound, CORM‐2, can efficiently release controlled amounts of CO and is a safer alternative to inhaled CO (Constantin et al., 2012). Studies have demonstrated that the expression of HO‐1 is regulated by CORM‐2 in astrocytes, suggesting the possibility of amplified HO‐1/CO axis on tissue repair (Choi et al., 2010). The beneficial effects of HO‐1/CO are conveyed through the inhibition of inflammatory, apoptotic and proliferative processes. Thus, in this study, we attempted to investigate the mechanisms involved in CORM‐2‐induced HO‐1 expression in human pulmonary alveolar epithelial cells (HPAEpiCs) and the effects of HO‐1 against TNF‐α‐induced accumulation of PMNs.

The expression of the HO‐1 gene is tightly regulated; inhibition of non‐receptor tyrosine kinase, PYK2, by PF431396 was found to abolish HO‐1 expression in human cardiomyocytes (Chien et al., 2015). And phosphorylation of PKC is involved in parthenolide‐induced HO‐1 expression in cholangiocarcinoma (Yun et al., 2010). Selective inhibition of PKC and ERK1/2 (p44/42 MAPK) by calphostin C or PD98059 down‐regulated HO‐1 expression in cadmium‐stimulated lymphocytes (B cell line BJAB) (Nemmiche et al., 2012). Moreover, curcumin has been shown to dose‐dependently increase HO‐1 expression through the activation of PKCα (Hsu et al., 2008). Ferulic acid also induce HO‐1 expression via ERK1/2 (Ma et al., 2011). However, whether PYK2, PKCα and ERK1/2 participate in CORM‐2‐induced HO‐1 expression in HPAEpiCs remains largely unknown. Thus, whether PYK2, PKCα and ERK1/2 are involved in HO‐1 expression was investigated in CORM‐2‐stimualted HPAEpiCs.

Activator protein 1 (AP‐1) is a heterodimer of Fos and Jun oncoproteins and has been shown to bind to the tetradecanoylphorbol‐13‐acetate response element (Wagner and Eferl, 2005), which is responsible for the transcriptional activation of various genes via activation of PKCs, protein tyrosine kinase and MAPKs. In our previous studies, sphingosine‐1‐phosphate or TNF‐α was shown to regulate ICAM‐1 or cPLA2 gene expression via MAPK‐dependent activation of AP‐1 in HPAEpiCs (Lee et al., 2013a; Lin et al., 2015). Moreover, HO‐1 expression induced by sevoflurane is mediated through AP‐1 in the rat liver (Schwer et al., 2010). Thus, the role of AP‐1 in CORM‐2‐induced HO‐1 expression was also investigated in HPAEpiCs.

From the experiments performed in this study, we showed that CORM‐2‐induced increase in HO‐1 expression is mediated through AP‐1 activation in HPAEpiCs. These findings suggest that CORM‐2‐induced HO‐1 expression is, at least in part, mediated through a PYK2/PKCα/ERK1/2‐dependent AP‐1 pathway, which then attenuates TNF‐α‐induced inflammatory responses.

Methods

Animal care and experimental procedures

Male ICR mice aged 6–8 weeks were purchased from the National Laboratory Animal Centre (Taipei, Taiwan) and handled according to the guidelines of Animal Care Committee of Chang Gung University and NIH Guides for the Care and Use of Laboratory Animals. Animal studies are reported in accordance with the ARRIVE guidelines (Kilkenny et al., 2010; McGrath and Lilley, 2015). Animals were assigned randomly to different experimental groups for all in vivo studies. Data collection and evaluation of all in vivo and in vitro experiments were performed blindly of the group identity. Mice were divided into seven groups, five mice in each group per cage and kept in standard individually ventilated cages in an animal facility under standardized conditions (12 h light/dark cycle, 21–24°C, humidity of 50–60%) with food and water ad libitum. For the in vivo treatment, zinc protoporphyrin IX (ZnPPIX) (Fest et al., 2016) and CORM‐2 were dissolved in DMSO at a concentration of 10 and 50 mg·mL−1, respectively, and further diluted in PBS before injection. The final dosages for ZnPPIX and CORM‐2 were 1.64 and 8 mg·kg−1 (i.p.) respectively. The control mice were given 0.1 mL of DMSO‐PBS with 0.1% BSA. Mice were anaesthetized by i.p. injection of 200 μL of pentobarbital sodium (5 mg·mL−1). The depth of anaesthesia was evaluated by pinching the animal's paw with forceps and all efforts were made to minimize suffering. Mice were placed individually on a board in a near vertical position and the tongues were withdrawn with a lined forceps. Mice were given one dose of ZnPPIX (1.64 mg·kg−1, i.p.) for 2 h or CORM‐2 (8 mg·kg−1, i.p.) for 24 h. TNF‐α (0.25 mg·kg−1 body weight) was placed at the back of the throat and aspirated into lungs. After 24 h, mice were killed under isoflurane anaesthesia and then specimens were harvested. BAL fluid was obtained through a tracheal cannula using 1 mL aliquots of ice‐cold PBS solution. BAL fluid was centrifuged at 500× g at 4°C, and cell pellets were washed and re‐suspended in PBS. Leukocyte count was determined by a haemocytometer, as previously described (Matsumoto et al., 2006). To examine the levels of HO‐1 and VCAM‐1 expression in the mice treated with or without CORM‐2 followed by treatment with TNF‐α, lung tissues were collected, homogenized and subjected to Western blot to determine the levels of VCAM‐1, HO‐1 and β‐actin protein, as previously described (Matsumoto et al., 2006).

Cell culture and treatment

HPAEpiCs were purchased from the ScienCell Research Laboratories (San Diego, CA, USA) and grown as previously described (Lee et al., 2013b).

Transient transfection with siRNAs

Human siRNAs of PKCα (L‐003523‐00‐0020) was from Dharmacon (Lafayette, CO, USA); scrambled, PYK2 (SASI_Hs01_00032249) and p42 (SASI_Hs01_00058601) were from Sigma (St. Louis, MO, USA); and c‐Fos (FOS‐HSS103799) was from Invitrogen (Carsbad, CA, USA). Transient transfection of siRNAs (100 nM) was performed by using a GeneMute reagent according to the manufacturer's instructions from SignaGen Lab (Rockville, MD, USA).

Real‐time RT‐PCR

Total RNA was extracted by using TRIzol reagent. The mRNA was reverse‐transcribed into cDNA and analysed by real‐time PCR. Each PCR was performed using 100 ng of cDNA and TaqMan PCR Master Mixture. TaqMan gene expression assay components contain an FAM reporter dye at the 5′end of the TaqMan probe and a non‐fluorescent quencher at the 3′end of the probe. The sequences of primers and probes represented specific mRNAs:

HO‐1

  • Sense: 5′‐CTCCCAGGCTCCGCTTCT‐3′

  • Anti‐sense: 5′‐GCATGCCTGCATTCACATG‐3′

  • Probe: 5′‐CGATGGGTCCTTACACTCAGCTTTCTGG‐3′

c‐Fos

  • Sense: 5′‐TGGTGCATTACAGAGAGGAGAAA‐3′

  • Anti‐sense: 5′‐CCGGAAGAGGTAAGGACTTGA‐3′

  • Probe: 5′‐CATCTTCCCTAGAGGGTTCCTGTAGACC‐3′

GAPDH.

  • Sense: 5′‐GCCAGCCGAGCCACAT‐3′

  • Anti‐sense: 5′‐CTTTACCAGAGTTAAAAGCAGCCC‐3′

  • Probe: 5′‐CCAAATCCGTTGACTCCGACCTTCA‐3′

Human GAPDH was used as a control to verify the quality of the cDNA template. Real‐time PCR was performed and analysed using a StepOnePlus quantitative PCR instrument (Applied Biosystems). The levels of HO‐1 expressed were determined by normalizing to GAPDH expression. Relative gene expression was determined by the ΔΔCt method (Livak and Schmittgen, 2001), where Ct denotes threshold cycle. All experiments were performed in five independent experiments and determined in triplicate.

Preparation of cell extracts and Western blot

Growth‐arrested HPAEpiCs were incubated with CORM‐2 at 37°C for the indicated time intervals. The cells were washed, scraped, collected and centrifuged at 45 000× g at 4°C for 1 h to yield the whole cell extract, as previously described (Lee et al., 2008). Samples were denatured, subjected to SDS‐PAGE using a 12% (w.v‐1) running gel and transferred to a nitrocellulose membrane. Membranes were incubated with an anti‐HO‐1 antibody (1:1000) for 24 h and then incubated with an anti‐rabbit horseradish peroxidase antibody (1:1000) for 1 h. The immunoreactive bands were detected by ECL reagents and captured by a UVP BioSpectrum 500 Imaging System (Upland, CA, USA). The image densitometry analysis was quantified by use of UN‐SCAN‐IT gel software (Orem, UT, USA).

Cell viability

For measurement of cell viability, cells were seeded into 96‐well plates, cultured overnight in DMEM /F‐12 containing 10% (v.v‐1) FBS and then treated with CORM‐2 (0–100 μM) or pharmacological inhibitors for 24 h. Cell viability was determined by the 3‐(4,5‐cimethylthiazol‐2‐yl)‐2,5‐diphenyl tetrazolium bromide (MTT) assay.

Statistical analysis of data

The data and statistical analysis comply with the recommendations on experimental design and analysis in pharmacology (Curtis et al., 2015). All the data are expressed as the mean or mean ± SEM of five individual experiments performed in duplicate or triplicate. The significance of differences between two groups was determined by Student's paired two‐tailed t‐test for Western blot data. For all other statistical analyses and comparisons of multiple groups, a GraphPad Prism Programme (GraphPad, San Diego, CA, USA) using ANOVA followed by Tukey's post hoc test has been used. In all cases, P < 0.05 was considered to indicate statistical significance. Error bars were omitted when they fell within the dimensions of the symbols.

Materials

DMEM/F‐12 medium, FBS, TRIzol reagent and PLUS‐Lipofectamine were from Invitrogen (Carlsbad, CA, USA). PF431396 (Han et al., 2009a,b), Ro‐318220, Gö6976 (Martiny‐Baron et al., 1993), Gö6983 (Stempka et al., 1999), U0126 (Favata et al., 1998) and Tanshinone IIA (Jang et al., 2003) were from Biomol (Plymouth Meeting, PA, USA). ZnPPIX (Fest et al., 2016) was from Caynman Chemical (Ann Arbor, MI, USA). Luciferase assay kit was from Promega (Madison, WI, USA). Anti‐HO‐1, anti‐β‐actin, anti‐PYK2, anti‐PKCα, anti‐Gαs, anti‐GAPDH, anti‐p42, anti‐c‐Fos and anti‐ICAM‐1 antibodies were from Santa Cruz (Santa Cruz, CA, USA). Anti‐phospho‐PYK2 (#3291), anti‐phospho‐PKCα (#9375) and anti‐phospho‐ERK1/2 (#9101) antibodies were from Cell Signaling (Danvers, MA, USA). Tricarbonyldichlororuthenium (II) dimer (CORM‐2) and other chemicals were from Sigma (St. Louis, MO, USA). TaqMan PCR Master Mixture was from Thermo Fisher Scientific Inc (Waltham, MA, USA). SDS‐PAGE reagents were from MDBio Inc (Taipei, Taiwan).

Nomenclature of targets and ligands

Key protein targets and ligands in this article are hyperlinked to corresponding entries in http://www.guidetopharmacology.org, the common portal for data from the IUPHAR/BPS Guide to PHARMACOLOGY (Southan et al., 2016), and are permanently archived in the Concise Guide to PHARMACOLOGY 2017/18 (Alexander et al., 2017).

Results

CORM‐2 inhibits TNF‐α‐induced lung inflammation in mice

In our previous studies, TNF‐α has been shown to induce the expression of VCAM‐1 or ICAM‐1 in various cell types (Lee et al., 2009; 2013b). TNF‐α markedly induced VCAM‐1 protein expression in HPAEpiCs and leukocyte count in BAL fluid, which were also reduced by CORM‐2 (Figure 1A, B). We found that treatment of mice with ZnPPIX alone had no effect on the levels of HO‐1 and VCAM‐1 expression, and treatment with ZnPPIX plus TNF‐α enhanced the VCAM‐1 expression similar to that of treatment with TNF‐α alone. However, we noticed that pretreatment with ZnPPIX reversed the inhibitory effect of HO‐1 (approximate 85%) on TNF‐α‐induced increase in VCAM‐1 expression and leukocytes in mice challenged with TNF‐α (Figure 1, B). These results suggest that the CORM‐2‐induced suppression of the TNF‐α‐mediated inflammatory responses is, at least in part, mediated through an up‐regulation of HO‐1.

Figure 1.

Figure 1

Open in a new tab

CORM‐2 inhibits TNF‐α‐induced lung inflammation. Mice were given i.p. one dose of ZnPPIX (1.64 mg·kg−1) for 1 h, followed by CORM‐2 (8 mg·kg−1) for 24 h prior to TNF‐α (0.25 kg−1), and killed after 24 h. The animals in the sham group were given i.p. 0.1 mL PBS‐DMSO with 0.1% BSA. (A) The preparation of lung tissues was analysed by Western blot to determine the levels of VCAM‐1 (upper panel), HO‐1 (lower panel) and β‐actin protein. (B) BAL fluid was acquired and then leukocyte counts was determined by a haemocytometer. Data are expressed as mean ± SEM of five independent experiments. * P < 0.05, as compared with the mice indicated.

Effects of CORM‐2 on HO‐1 expression and cell viability

Our previous studies indicated that CORM‐2 up‐regulates HO‐1 expression in various cell types (Chi et al., 2014; 2015). Here, we evaluated the effects of CORM‐2 on HO‐1 expression in HPAEpiCs. The data showed that CORM‐2 markedly increased the expression of HO‐1 protein and mRNA in a time‐ and concentration‐dependent manner (Figure 2A, B). CORM‐2 significantly enhanced HO‐1 protein expression within 6 h and this reached a maximal response within 16 h during the period of observation. In addition, CORM‐2 induced a maximal expression of HO‐1 mRNA within 4–6 h. We also examined the effects of CORM‐2 (0–100 μM) on the cell viability of HPAEpiCs by using an MTT assay. As shown in Figure 2C, CORM‐2 (10 and 50 μM) had no effects on the cell viability of HPAEpiCs. However, only 100 μM CORM‐2 significantly decreased the cell viability of HPAEpiCs. Thus, 50 μM CORM‐2 was used for the following experiments.

Figure 2.

Figure 2

Open in a new tab

CORM‐2 induces HO‐1 expression in HPAEpiCs. (A) Cells were treated with CORM‐2 (1, 10, 25 or 50 μM) for the indicated time intervals. The protein expression of HO‐1 was determined by Western blot. (B) Cells were treated with 50 μM CORM‐2 for the indicated time intervals. The HO‐1 mRNA levels were determined by real‐time PCR. (C) HPAEpiCs were incubated with CORM‐2 (10, 50 or 100 μM) for the indicated time intervals, and then the cell viability was determined by MTT assay. Data are expressed as mean ± SEM of five independent experiments. * P < 0.01, as compared with the cells exposed to vehicle (0.5% DMSO) alone.

Involvement of PYK2 in CORM‐2‐induced HO‐1 expression

PYK2 has been shown to act as a critical player in the signal transduction pathways that regulate the expression of several genes and cellular functions (Cheng et al., 2002; Schindler et al., 2007; Lipinski and Loftus, 2010; Yang et al., 2013). Here, we investigated whether PYK2 was involved in CORM‐2‐induced increase in HO‐1 expression. As shown in Figure 3A, CORM‐2‐induced HO‐1 protein levels were markedly reduced by pretreatment with the inhibitor of PYK2 (PF431396) in a concentration‐dependent manner. In addition, CORM‐2‐induced HO‐1 mRNA expression was also inhibited by PF431396 (Figure 3B). We further confirmed the role of PYK2 in CORM‐2‐induced HO‐1 expression by using PYK2 siRNA. As shown in Figure 3C, transfection with PYK2 siRNA knocked down the PYK2 protein level and significantly reduced CORM‐2‐induced HO‐1 expression in HPAEpiCs. Finally, we investigated whether the involvement of PYK2 in HO‐1 expression was mediated through PYK2 phosphorylation. We observed that CORM‐2 time‐dependently stimulated PYK2 phosphorylation and this effect was reduced by PF431396 (Figure 3D). These results suggest that CORM‐2‐induced HO‐1 expression is mediated through PYK2 phosphorylation in HPAEpiCs.

Figure 3.

Figure 3

Open in a new tab

CORM‐2 induces HO‐1 expression via PYK2. (A) HPAEpiCs were pretreated with PF431396 (1, 2 and 3 μM) for 1 h and then incubated with 50 μM CORM‐2 for 16 h. The levels of HO‐1 protein were determined. (B) Cells were pretreated with PF431396 (3 μM) for 1 h and then incubated with 50 μM CORM‐2 for 6 h. The HO‐1 mRNA levels were determined by real‐time PCR. (C) Cells were transfected with either scrambled or PYK2 siRNA and then incubated with 50 μM CORM‐2 for 16 h. The levels of PYK2, HO‐1 and β‐actin protein were determined. (D) Cells were pretreated with Gö6976 (1 μM) or PF431396 (3 μM) for 1 h and then incubated with 50 μM CORM‐2 for the indicated time intervals. The levels of phospho‐PYK2 were observed. Data are expressed as mean ± SEM of five independent experiments. * P < 0.05, as compared with the cells exposed to CORM‐2 alone for the indicated time point.

CORM‐2 induces HO‐1 expression via PKCα

PKCs have been shown to regulate the expression of several genes associated with pathophysiological responses in various cell types (Yang et al., 2009; Lee and Yang, 2012; Lee et al., 2013a). Here, we investigated whether PKCα was involved in CORM‐2‐induced HO‐1 expression. As shown in Figure 4A, pretreatment with the inhibitor of pan‐PKC (Ro‐318 220) or PKCα (Gö6976 or Gö6983) markedly reduced CORM‐2‐induced HO‐1 protein levels. In addition, CORM‐2‐induced HO‐1 mRNA levels were also inhibited by these PKC inhibitors (Figure 4B). We further confirmed the role of PKCα in CORM‐2‐induced HO‐1 expression by using PKCα siRNA. As shown in Figure 4C, transfection with PKCα siRNA knocked down PKCα protein levels and significantly reduced CORM‐2‐induced HO‐1 expression in these cells. The relationship between PYK2 and PKCα was differentiated in HPAEpiCs challenged with CORM‐2. We observed that CORM‐2 time‐dependently induced an increase in PKCα phosphorylation, which was reduced by PF431396, Gö6983 or Gö6976 (Figure 4D). However, pretreatment with Gö6976 had no effect on CORM‐2‐stimulated PYK2 phosphorylation (Figure 3D). These results suggest that CORM‐2‐induced HO‐1 expression is mediated through a PYK2/PKCα cascade in HPAEpiCs.

Figure 4.

Figure 4

Open in a new tab

CORM‐2 induces HO‐1 expression via PKCα. (A) HPAEpiCs were pretreated with Ro‐318 220 (0.1, 3 and 10 μM), Gö6976 (0.1, 0.3 and 1 μM) or Gö6983 (0.1, 1 and 10 μM) for 1 h and then incubated with 50 μM CORM‐2 for 16 h. The levels of HO‐1 protein were determined. (B) Cells were pretreated with Gö6976 (1 μM), Gö6983 (10 μM) or Ro‐318 220 (10 μM) for 1 h and then incubated with 50 μM CORM‐2 for 6 h. The HO‐1 mRNA levels were determined by real‐time PCR. (C) Cells were transfected with either scrambled or PKCα siRNA and then incubated with 50 μM CORM‐2 for 16 h. The levels of PKCα and HO‐1 protein were determined. (D) Cells were pretreated with Gö6983 (10 μM), Gö6976 (1 μM) or PF431396 (10 μM) for 1 h and then incubated with 50 μM CORM‐2 for the indicated time intervals. The levels of phospho‐PKCα were observed. Data are expressed as mean ± SEM of five independent experiments. *P < 0.05, as compared with the cells exposed to CORM‐2 alone for the indicated time point.

CORM‐2 induces HO‐1 expression through ERK1/2

MAPKs exert multiple effects on the expression of various genes and cellular functions. Previously, ERK1/2 has also been shown to be involved in the induction of HO‐1 (Cheng et al., 2010). Here, we investigated whether ERK1/2 was involved in CORM‐2‐induced HO‐1 expression in HPAEpiCs. As shown in Figure 5A, pretreatment with the inhibitor of MEK1/2 (U0126) markedly reduced CORM‐2‐induced HO‐1 protein levels. In addition, CORM‐2‐induced HO‐1 mRNA levels were also inhibited by U0126 (Figure 5B). To confirm the role of ERK1/2 in CORM‐2‐induced HO‐1 expression, as shown in Figure 5C, transfection with p42 siRNA knocked down p42 protein level and significantly reduced CORM‐2‐induced HO‐1 expression in these cells. Finally, we observed whether the role of ERK1/2 in CORM‐2‐induced responses was mediated through its phosphorylation. We found that CORM‐2 time‐dependently stimulated ERK1/2 phosphorylation (Figure 5D). PYK2 and PKCα have been shown to be involved in ERK1/2 activation (Yao et al., 2009; Anfuso et al., 2014). We further differentiated the relationship among PYK2, PKCα and ERK1/2 in CORM‐2‐challenged HPAEpiCs. As shown in Figure 5D, pretreatment with U0126, PF431396 or Gö6983 inhibited CORM‐2‐stimulated ERK1/2 phosphorylation. These results suggested that CORM‐2‐induced HO‐1 expression is mediated through a PYK2/PKCα/ERK1/2 signalling pathway in HPAEpiCs.

Figure 5.

Figure 5

Open in a new tab

CORM‐2 induces HO‐1 expression via ERK1/2 (p44/42 MAPK). (A) HPAEpiCs were pretreated with U0126 (0.1, 1 and 10 μM) for 1 h and then incubated with 50 μM CORM‐2 for 16 h. The levels of HO‐1 protein were determined. (B) Cells were pretreated with U0126 (10 μM) for 1 h and then incubated with 50 μM CORM‐2 for 6 h. The HO‐1 mRNA levels were determined by real‐time PCR. (C) Cells were transfected with either scrambled or ERK2 (p42) siRNA and then incubated with 50 μM CORM‐2 for 16 h. The levels of ERK2 (p42) and HO‐1 protein were determined. (D) Cells were pretreated with U0126 (10 μM), PF431396 (3 μM) or Gö6983 (10 μM) for 1 h and then incubated with 50 μM CORM‐2 for the indicated time intervals. The levels of phospho‐ERK1/2 (p44/42) were observed. Data are expressed as mean ± SEM of five independent experiments. *P < 0.05, as compared with the cells exposed to CORM‐2 alone.

CORM‐2 induces HO‐1 expression via AP‐1

AP‐1 is an important transcription factor regulated by ERK1/2 leading to the expression of various genes including HO‐1 (Wright et al., 2009). In this study, we investigated whether AP‐1 was involved in CORM‐2‐induced HO‐1 expression in HPAEpiCs. As shown in Figure 6A, pretreatment with the inhibitor of AP‐1 (Tanshinone IIA) markedly reduced CORM‐2‐induced HO‐1 protein levels. In addition, the CORM‐2‐induced increase in HO‐1 mRNA levels was also inhibited by Tanshinone IIA (Figure 6B). Indeed, we observed that CORM‐2 time‐dependently induced an increase in c‐Fos mRNA expression with a maximal response within 2 h (Figure 6C), which was attenuated by pretreatment with PF431396, Gö6976, Gö6983 or U0126 (Figure 6D). To confirm that c‐Fos is involved in CORM‐2‐induced HO‐1 expression, as shown in Figure 6E, transfection with c‐Fos siRNA knocked down c‐Fos protein level and significantly reduced CORM‐2‐induced increase in HO‐1 expression in HPAEpiCs. These results suggest that CORM‐2‐induced HO‐1 expression is mediated through an AP‐1‐dependent mechanism in HPAEpiCs.

Figure 6.

Figure 6

Open in a new tab

CORM‐2 induces HO‐1 expression via AP‐1. (A) HPAEpiCs were pretreated with Tanshinone IIA (TSA IIA; 0.01, 0.1 and 1 μM) for 1 h and then incubated with 50 μM CORM‐2 for 16 h. The levels of HO‐1 protein were determined. (B) Cells were pretreated with Tanshinone IIA (1 μM) for 1 h and then incubated with 50 μM CORM‐2 for 6 h. The HO‐1 mRNA levels were determined by real‐time PCR. (C, D) Cells were pretreated without or with PF431396 (3 μM), Gö6976 (10 μM), Gö6983 (10 μM) or U0126 (10 μM) for 1 h and then incubated with 50 μM CORM‐2 for 2 h. The c‐Fos mRNA levels were measured by real‐time PCR. (E) Cells were transfected with scrambled or c‐Fos siRNA and then incubated with 50 μM CORM‐2 for 16 h. The levels of c‐Fos, HO‐1 and β‐actin protein were determined. Data are expressed as mean ± SEM of five independent experiments. *P < 0.05, as compared with the cells exposed to CORM‐2 alone (A, B, D) or vehicle (0.5% DMSO) alone (C). (F) Schematic signalling pathways are involved in CORM‐2‐induced HO‐1 expression. CORM‐2 activates the PYK2/PKCα pathway to enhance ERK1/2 (p44/42 MAPK) phosphorylation, which in turn initiates the activation of AP‐1 and ultimately induces HO‐1 expression in HPAEpiCs. Moreover, pretreatment with CORM‐2 inhibits TNF‐α‐induced lung inflammation via the induction of HO‐1.

Discussion

Several lines of evidence demonstrate that an elevation of CO generated from the catabolism of haem by HO protects against the inflammatory responses in pulmonary diseases (Constantin et al., 2012). The anti‐inflammatory properties of CO and CORMs have been demonstrated in a variety of animal models of inflammation, suggesting that they could possibly be used as a therapeutic for inflammatory diseases. However, the molecular mechanisms by which CORM‐2 induces HO‐1 expression are not fully understood in HPAEpiCs. Here, we observed that pretreatment with CORM‐2 inhibited TNF‐α‐induced lung inflammatory responses by inducing an increase in the expression of HO‐1 induction. Furthermore, the application of pharmacological inhibitors and genetic silencing through transfection with siRNA of PYK2, PKCα, p42 or c‐Fos attenuated the CORM‐2‐induced increase in HO‐1 expression. The present study clearly demonstrated that HO‐1 expression induced by CORM‐2 is mediated through a PYK2/PKCα/ERK1/2/AP‐1 pathway and this suppresses the inflammatory responses triggered by TNF‐α in both in vitro and in vivo studies (Figure 6F).

All cells catabolize haem using one of two isoforms of HO, HO‐1 or HO‐2, which are the inducible and constitutive isoforms respectively (Motterlini and Foresti, 2014). HO‐1 is activated within hours in a host exposed to various stressors including oxidants, pathogens, chemokines and growth factors (Ryter and Choi, 2009; Wegiel et al., 2013). The induction of HO‐1 expression by various stimuli has anti‐inflammatory and anti‐apoptotic effects in various cell types. CO generated by HO‐1 regulates, either positively or negatively, the intercellular and intracellular networks and communication within the tissues and organ systems, allowing them to respond appropriately to the stressor or change in environmental cues. Regulation of the HO‐1 gene is predominant at the transcriptional level. Various transcription factors interact with DNA binding domains in the HO‐1 promoter to regulate gene transcription. A number of signalling molecules have been ascertained to be involved in regulating HO‐1 expression.

HO‐1 expression has been shown to be mediated through the activation of non‐receptor tyrosine kinases including PYK2 in various types of cells (Choi and Alam, 1996; Han et al., 2009a,b; Chi et al., 2015; Yang et al., 2015). We noted that CORM‐2‐induced HO‐1 expression was attenuated by PF431396 or by transfection with PYK2 siRNA, confirming that PYK2 is involved in HO‐1 expression through the phosphorylation of PYK2 in HPAEpiCs. Moreover, PKCs also play important roles in many cellular responses in the lung, including permeability, contraction, migration, hypertrophy, proliferation, apoptosis and secretion (Lee and Yang, 2012; Lee et al., 2013a). We found that the inhibition of PKCα markedly reduced CORM‐2‐induced HO‐1 expression, which was confirmed by using a pharmacological inhibitor or siRNA. The relationship between PYK2 and PKCα in CORM‐2‐mediated responses was also differentiated by using respective inhibitors. Pretreatment with PF431396 inhibited the CORM‐2‐stimulated phosphorylation of PYK2 and PKCα; however, Gö6983 and Gö6976 only attenuated phosphorylation of PKCα, implying that PKCα was a downstream component of PYK2 in CORM‐2‐mediated responses. Both Gö6976 and Gö6983 were used to identify the PKC isoforms involved in HO‐1 expression. The specificities of these inhibitors may account for the differences observed. Thus, to confirm the efficacy of pharmacological inhibitors, we also performed experiments that used the transfection with siRNA to ensure the role of PKCα in CORM‐2‐induced HO‐1 expression. To the best of our knowledge, our results are the first to show the novel roles of PYK2 and PKCα in CORM‐2‐induced HO‐1 expression in HPAEpiCs. These data suggest that CORM‐2‐induced HO‐1 expression is mediated through a PYK2/PKCα pathway in HPAEpiCs. However, how CORM‐2 stimulates the phosphorylation of PKC/PYK2 in HPAEpiCs is still unknown.

The abnormal activation of MAPK has been implicated in a variety of inflammatory responses and tissue injury and the induction of several inflammatory mediators in different cell types (Alam and Gorska, 2011; Lee and Yang, 2012; Lee et al., 2013a). In the present study, we demonstrated that ERK1/2 was required for the CORM‐2‐induced increase in HO‐1 expression, which was attenuated by a selective MEK1/2 pharmacological inhibitor U0126 or transfection with p42 siRNA. The involvement of these kinases in CORM‐2‐stimulated pathways was further confirmed by showing that CORM‐2 mediated phosphorylation of ERK1/2. These results are consistent with the data that show the increase in HO‐1 expression in HepG2 cells (Yuan et al., 2006) and haem‐mediated neuronal injury (Foresti et al., 2008) are mediated by ERK1/2. In the present study, CORM‐2‐stimulated phosphorylation of ERK1/2 was attenuated by pretreatment with the inhibitor of PKCα (Gö6983), PYK2 (PF431396) or MEK1/2 (U0126), suggesting that PKCα/PYK2‐dependent ERK1/2 phosphorylation is crucial for CORM‐2‐induced increase in HO‐1 expression in HPAEpiCs. These results are also consistent with several reports that MAPKs including ERK1/2 are involved in the regulation of cellular functions in response to outside stimuli in several cell types (Pawate et al., 2004; Cheng et al., 2006; Hsieh et al., 2010). Indeed, in a previous study we and others found that inhibition of JNK1/2 or p38 MAPK also attenuates CORM‐2‐ or curcumin‐induced HO‐1 expression in HTSMCs (Yang et al., 2015) and in renal epithelial cells (Balogun et al., 2003). The roles of these protein kinases may be involved in CORM‐2‐induced increase in HO‐1 expression in HPAEpiCs and merit further study in the future.

AP‐1 transcription factor typically consists of a combination of Jun and Fos proteins, which bind to the promoters of target genes (Vesely et al., 2009). It is found to be responsible for the transcriptional activation of various genes that are activated by phorbol esters (such as PMA) via activation of PKC (Lee and Yang, 2012; Lee et al., 2013a). AP‐1 may be activated by PKCs and MAPKS in response to various cytokines, including TNF‐α and IL‐1β (Lee and Yang, 2012; Lee et al., 2013a). The activated transcription factors interact with response elements on the HO‐1 promoter to regulate gene transcription (Rochette et al., 2013). Here, we focused on the role of th etranscription factor AP‐1, which is well known to be modulated during inflammatory diseases (Sen and Packer, 1996). By using its pharmacological inhibitor Tanshinone IIA, we demonstrated that AP‐1 is involved in the CORM‐2‐induced HO‐1 expression. The involvement of AP‐1 in these responses was further verified by the results indicating that CORM‐2 induced c‐Fos mRNA expression via a PYK2/PKCα‐dependent ERK1/2 pathway. Moreover, the roles of c‐Fos/AP‐1 in CORM‐2‐induced HO‐1 expression were confirmed by transfection with c‐Fos siRNA, which was found to attenuate CORM‐2‐induced HO‐1 expression. These results are consistent with reports indicating that α‐lipoic acid induces HO‐1 expression in vascular smooth muscle cells (Cheng et al., 2006) and BK induces HO‐1 expression in brain astrocytes (Hsieh et al., 2010). Thus, CORM‐2‐induced HO‐1 expression is mediated through a PYK2/PKCα/ERK1/2/AP‐1 pathway in HPAEpiCs.

TNF‐α has been implicated in the pathophysiology of many inflammatory lung diseases, including chronic bronchitis, COPD, ARDS and asthma (Lee et al., 2009). Leukocytes and monocytes isolated from BAL fluid of asthmatics were shown to release more TNF‐α than those of cells from control subjects. It has been suggested that TNF‐α up‐regulates adhesion molecules and is directly responsible for the transendothelial migration of inflammatory cells, which is a central feature underlying inflammatory responses (Lee et al., 2013b). In this study, we also investigated the protective effects of CORM‐2 on TNF‐α‐induced inflammatory responses. We observed that TNF‐α (0.25 mg·kg−1 body weight) induced significant pulmonary haematoma in mice. In addition, TNF‐α also induced an increase in VCAM‐1 expression in lung tissues and leukocyte counts in BAL fluid in mice. These responses may further lead to lung inflammatory diseases. Moreover, pretreatment with CORM‐2 inhibited this TNF‐α‐induced increase in adhesion molecules expression and leukocyte counts in BAL fluid in mice, and this effect of CORM‐2 was reversed by ZnPPIX administration by about 85%, but not completely, as compared with that of TNF‐α treatment alone. These results suggest that CORM‐2 may have an alternative effect independent of HO‐1 that can result in the suppression of TNF‐α‐induced increase in VCAM‐1 expression and leukocyte counts.

In conclusion, based on previous observations and our findings, we have suggested a model (Figure 6F ) for the molecular mechanisms involved in the CORM‐2‐induced increase in HO‐1 expression in HPAEpiCs. These findings indicating that CORM‐2 induces an increase HO‐1 expression imply that HO‐1/CO might play a protective role in lung inflammatory diseases, and this effect is mediated via PYK2/PKCα/ERK1/2‐dependent AP‐1 activation in HPAEpiCs. These findings further support the application of CORM‐2 as a potential intervention for the prevention or treatment of pulmonary inflammatory diseases. Thus, as the induction of HO‐1 expression may hold therapeutic promise, continuous efforts towards identifying novel lung protective and anti‐inflammatory compounds that target HO‐1 and in vivo models that can properly evaluate the efficacy of these agents will be warranted.

Author contributions

C.‐C.L., Y.‐C.C., R.‐L.C., W.‐N.L., C.‐C.Y., L.‐D.H. and C.‐M.Y. conceived and designed the experiments; C.‐C.L., Y.‐C.C., R.‐L.C., W.‐N.L., C.‐C.Y. and L.‐D.H. performed the experiments; C.‐C.L., Y.‐C.C., R.‐L.C., W.‐N.L., C.‐C.Y., L.‐D.H. and C.‐M.Y. analysed the data and drafted relevant text; C.‐C.L., Y.‐C.C. and C.‐M.Y. wrote the manuscript. All authors have read and approved the final version of this manuscript.

Conflict of interest

The authors declare no conflicts of interest.

Declaration of transparency and scientific rigour

This Declaration acknowledges that this paper adheres to the principles for transparent reporting and scientific rigour of preclinical research recommended by funding agencies, publishers and other organisations engaged with supporting research.

Acknowledgements

This work was supported by the Ministry of Education, Taiwan, Grant numbers: EMRPD1G0171 and EMRPD1G0281; the Ministry of Science and Technology, Taiwan, Grant numbers: MOST104‐2320‐B‐182A‐003‐MY3, MOST104‐2320‐B‐182‐010 and MOST105‐2320‐B‐182‐005‐MY3; Chang Gung Medical Research Foundation, Taiwan, Grant numbers: CMRPD1F0022, CMRPD1F0023, CMRPD1F0551, CMRPD1F0552, CMRPG3E2232 and CMRPG3F1532; and Fu Jen Catholic University Research Foundation, Taiwan, Grant numbers:A0103017 and 410031034022.

Lin, C.‐C. , Chiang, Y.‐C. , Cho, R.‐L. , Lin, W.‐N. , Yang, C.‐C. , Hsiao, L.‐D. , and Yang, C.‐M. (2018) Up‐regulation of PYK2/PKCα‐dependent haem oxygenase‐1 by CO‐releasing molecule‐2 attenuates TNF‐α‐induced lung inflammation. British Journal of Pharmacology, 175: 456–468. doi: 10.1111/bph.14094.

References

  1. Alam R, Gorska MM (2011). Mitogen‐activated protein kinase signalling and ERK1/2 bistability in asthma. Clin Exp Allergy 41: 149–159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Alexander SPH, Fabbro D, Kelly E, Marrion NV, Peters JA, Faccenda E et al (2017). The Concise Guide to PHARMACOLOGY 2017/18: Enzymes. Br J Pharmacol 174: S272–S359. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Anfuso CD, Motta C, Giurdanella G, Arena V, Alberghina M, Lupo G (2014). Endothelial PKCα‐MAPK/ERK‐phospholipase A2 pathway activation as a response of glioma in a triple culture model. A new role for pericytes? Biochimie 99: 77–87. [DOI] [PubMed] [Google Scholar]
  4. Balogun E, Hoque M, Gong P, Killeen E, Green CJ, Foresti R et al (2003). Curcumin activates the haem oxygenase‐1 gene via regulation of Nrf2 and the antioxidant‐responsive element. Biochem J 371: 887–895. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Barnes PJ (2008). The cytokine network in asthma and chronic obstructive pulmonary disease. J Clin Invest 118: 3546–3556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cheng JJ, Chao YJ, Wang DL (2002). Cyclic strain activates redox‐sensitive proline‐rich tyrosine kinase 2 (PYK2) in endothelial cells. J Biol Chem 277: 48152–48157. [DOI] [PubMed] [Google Scholar]
  7. Cheng PY, Lee YM, Shih NL, Chen YC, Yen MH (2006). Heme oxygenase‐1 contributes to the cytoprotection of α‐lipoic acid via activation of p44/42 mitogen‐activated protein kinase in vascular smooth muscle cells. Free Radic Biol Med 40: 1313–1322. [DOI] [PubMed] [Google Scholar]
  8. Cheng SE, Lee IT, Lin CC, Kou YR, Yang CM (2010). Cigarette smoke particle‐phase extract induces HO‐1 expression in human tracheal smooth muscle cells: role of the c‐Src/NADPH oxidase/MAPK/Nrf2 signaling pathway. Free Radic Biol Med 48: 1410–1422. [DOI] [PubMed] [Google Scholar]
  9. Chi PL, Liu CJ, Lee IT, Chen YW, Hsiao LD, Yang CM (2014). HO‐1 induction by CO‐RM2 attenuates TNF‐α‐induced cytosolic phospholipase A2 expression via inhibition of PKCα‐dependent NADPH oxidase/ROS and NF‐κB. Mediators Inflamm 2014: 279171. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chi PL, Lin CC, Chen YW, Hsiao LD, Yang CM (2015). CO induces Nrf2‐dependent heme oxygenase‐1 transcription by cooperating with Sp1 and c‐Jun in rat brain astrocytes. Mol Neurobiol 52: 277–292. [DOI] [PubMed] [Google Scholar]
  11. Chien PT, Lin CC, Hsiao LD, Yang CM (2015). Induction of HO‐1 by carbon monoxide releasing molecule‐2 attenuates thrombin‐induced COX‐2 expression and hypertrophy in primary human cardiomyocytes. Toxicol Appl Pharmacol 289: 349–359. [DOI] [PubMed] [Google Scholar]
  12. Choi AM, Alam J (1996). Heme oxygenase‐1: function, regulation, and implication of a novel stress‐inducible protein in oxidant‐induced lung injury. Am J Respir Cell Mol Biol 15: 9–19. [DOI] [PubMed] [Google Scholar]
  13. Choi YK, Kim CK, Lee H, Jeoung D, Ha KS, Kwon YG et al (2010). Carbon monoxide promotes VEGF expression by increasing HIF‐1α protein level via two distinct mechanisms, translational activation and stabilization of HIF‐1alpha protein. J Biol Chem 285: 32116–32125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Constantin M, Choi AJ, Cloonan SM, Ryter SW (2012). Therapeutic potential of heme oxygenase‐1/carbon monoxide in lung disease. Int J Hypertens 2012: 859235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Curtis MJ, Bond RA, Spina D, Ahluwalia A, Alexander SPA, Giembycz MA et al (2015). Experimental design and analysis and their reporting: new guidance for publication in BJP. Br J Pharmacol 172: 3461–3471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Favata MF, Horiuchi KY, Manos EJ, Daulerio AJ, Stradley DA, Feeser WS et al (1998). Identification of a novel inhibitor of mitogen‐activated protein kinase kinase. J Biol Chem 273: 18623–18632. [DOI] [PubMed] [Google Scholar]
  17. Fest S, Soldati R, Christiansen NM, Zenclussen ML, Kilz J, Berger E et al (2016). Targeting of heme oxygenase‐1 as a novel immune regulator of neuroblastoma. Int J Cancer 138: 2030–2042. [DOI] [PubMed] [Google Scholar]
  18. Foresti R, Bani‐Hani MG, Motterlini R (2008). Use of carbon monoxide as a therapeutic agent: promises and challenges. Intensive Care Med 34: 649–658. [DOI] [PubMed] [Google Scholar]
  19. Han S, Mistry A, Chang JS, Cunningham D, Griffor M, Bonnette PC et al (2009a). Structural characterization of proline‐rich tyrosine kinase 2 (PYK2) reveals a unique (DFG‐out) conformation and enables inhibitor design. J Biol Chem 284: 13193–13201. https://doi.org/10.1074/jbc.M809038200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Han Z, Varadharaj S, Giedt RJ, Zweier JL, Szeto HH, Alevriadou BR (2009b). Mitochondria‐derived reactive oxygen species mediate heme oxygenase‐1 expression in sheared endothelial cells. J Pharmacol Exp Ther 329: 94–101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hsieh HL, Wang HH, Wu CY, Yang CM (2010). Reactive oxygen species‐dependent c‐Fos/activator protein 1 induction upregulates heme oxygenase‐1 expression by bradykinin in brain astrocytes. Antioxid Redox Signal 13: 1829–1844. [DOI] [PubMed] [Google Scholar]
  22. Hsu HY, Chu LC, Hua KF, Chao LK (2008). Heme oxygenase‐1 mediates the anti‐inflammatory effect of Curcumin within LPS‐stimulated human monocytes. J Cell Physiol 215: 603–612. [DOI] [PubMed] [Google Scholar]
  23. Jang SI, Jeong SI, Kim KJ, Kim HJ, Yu HH, Park R et al (2003). Tanshinone IIA from Salvia miltiorrhiza inhibits inducible nitric oxide synthase expression and production of TNF‐α, IL‐1β and IL‐6 in activated RAW 264.7 cells. Planta Med 69: 1057–1059. [DOI] [PubMed] [Google Scholar]
  24. Kilkenny C, Browne W, Cuthill IC, Emerson M, Altman DG (2010). Animal research: reporting in vivo experiments: the ARRIVE guidelines. Br J Pharmacol 160: 1577–1579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Lee IT, Yang CM (2012). Role of NADPH oxidase/ROS in pro‐inflammatory mediators‐induced airway and pulmonary diseases. Biochem Pharmacol 84: 581–590. [DOI] [PubMed] [Google Scholar]
  26. Lee IT, Wang SW, Lee CW, Chang CC, Lin CC, Luo SF et al (2008). Lipoteichoic acid induces HO‐1 expression via the TLR2/MyD88/c‐Src/NADPH oxidase pathway and Nrf2 in human tracheal smooth muscle cells. J Immunol 181: 5098–5110. [DOI] [PubMed] [Google Scholar]
  27. Lee IT, Luo SF, Lee CW, Wang SW, Lin CC, Chang CC et al (2009). Overexpression of HO‐1 protects against TNF‐α‐mediated airway inflammation by down‐regulation of TNFR1‐dependent oxidative stress. Am J Pathol 175: 519–532. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lee IT, Lin CC, Cheng SE, Hsiao LD, Hsiao YC, Yang CM (2013a). TNF‐α induces cytosolic phospholipase A2 expression in human lung epithelial cells via JNK1/2‐ and p38 MAPK‐dependent AP‐1 activation. PLoS One 8: e72783. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  29. Lee IT, Lin CC, Lee CY, Hsieh PW, Yang CM (2013b). Protective effects of (−)‐epigallocatechin‐3‐gallate against TNF‐α‐induced lung inflammation via ROS‐dependent ICAM‐1 inhibition. J Nutr Biochem 24: 124–136. [DOI] [PubMed] [Google Scholar]
  30. Lin CC, Lee IT, Hsu CH, Hsu CK, Chi PL, Hsiao LD et al (2015). Sphingosine‐1‐phosphate mediates ICAM‐1‐dependent monocyte adhesion through p38 MAPK and p42/p44 MAPK‐dependent Akt activation. PLoS One 10: e0118473. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Lipinski CA, Loftus JC (2010). Targeting Pyk2 for therapeutic intervention. Expert Opin Ther Targets 14: 95–108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Livak KJ, Schmittgen D (2001). Analysis of relative gene expression data using real‐time quantitative PCR and the 2‐ΔΔCT method. Methods 25: 402–408. [DOI] [PubMed] [Google Scholar]
  33. Ma ZC, Hong Q, Wang YG, Liang QD, Tan HL, Xiao CR et al (2011). Ferulic acid induces heme oxygenase‐1 via activation of ERK and Nrf2. Drug Discov Ther 5: 299–305. [DOI] [PubMed] [Google Scholar]
  34. Martiny‐Baron G, Kazanietzs MG, Mischakll H, Blumbergs PM, Kochs G, Hug H et al (1993). Selective inhibition of protein kinase C isozymes by the indolocarbazole Gö6976. J Biol Chem 268: 9194–9197. [PubMed] [Google Scholar]
  35. Matsumoto H, Ishikawa K, Itabe H, Maruyama Y (2006). Carbon monoxide and bilirubin from heme oxygenase‐1 suppresses reactive oxygen species generation and plasminogen activator inhibitor‐1 induction. Mol Cell Biochem 291: 21–28. [DOI] [PubMed] [Google Scholar]
  36. McGrath JC, Lilley E (2015). Implementing guidelines on reporting research using animals (ARRIVE etc.): new requirements for publication in BJP. Br J Pharmacol 172: 3189–3193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Motterlini R, Foresti R (2014). Heme oxygenase‐1 as a target for drug discovery. Antioxid Redox Signal 20: 1810–1826. [DOI] [PubMed] [Google Scholar]
  38. Nemmiche S, Chabane‐Sari D, Kadri M, Guiraud P (2012). Cadmium‐induced apoptosis in the BJAB human B cell line: involvement of PKC/ERK1/2/JNK signaling pathways in HO‐1 expression. Toxicology 300: 103–111. [DOI] [PubMed] [Google Scholar]
  39. Pawate S, Shen Q, Fan F, Bhat NR (2004). Redox regulation of glial inflammatory response to lipopolysaccharide and interferon‐γ. J Neurosci Res 77: 540–551. [DOI] [PubMed] [Google Scholar]
  40. Rochette L, Cottin Y, Zeller M, Vergely C (2013). Carbon monoxide: mechanisms of action and potential clinical implications. Pharmacol Ther 137: 133–152. [DOI] [PubMed] [Google Scholar]
  41. Ryter SW, Choi AM (2009). Heme oxygenase‐1/carbon monoxide: from metabolism to molecular therapy. Am J Respir Cell Mol Biol 41: 251–260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Schindler EM, Baumgartner M, Gribben EM, Li L, Efimova T (2007). The role of proline‐rich protein tyrosine kinase 2 in differentiation‐dependent signaling in human epidermal keratinocytes. J Invest Dermatol 127: 1094–1106. [DOI] [PubMed] [Google Scholar]
  43. Schwer CI, Stoll P, Pietsch U, Stein P, Laqua J, Goebel U et al (2010). Up‐regulation of heme oxygenase‐1 by sevoflurane is not dependent on Kupffer cells and associates with ERK1/2 and AP‐1 activation in the rat liver. Int J Biochem Cell Biol 42: 1876–1883. [DOI] [PubMed] [Google Scholar]
  44. Sen CK, Packer L (1996). Antioxidant and redox regulation of gene transcription. FASEB J 10: 709–720. [DOI] [PubMed] [Google Scholar]
  45. Slebos DJ, Ryter SW, Choi AM (2003). Heme oxygenase‐1 and carbon monoxide in pulmonary medicine. Respir Res 4: 7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Soares MP, Bach FH (2009). Heme oxygenase‐1: from biology to therapeutic potential. Trends Mol Med 15: 50–58. [DOI] [PubMed] [Google Scholar]
  47. Southan C, Sharman JL, Benson HE, Faccenda E, Pawson AJ, Alexander SPH et al (2016). The IUPHAR/BPS guide to PHARMACOLOGY in 2016: towards curated quantitative interactions between 1300 protein targets and 6000 ligands. Nucl Acids Res 44: D1054–D1068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Stempka L, Schnölzer M, Radke S, Rincke G, Marks F, Gschwendt M (1999). Requirements of protein kinase cdelta for catalytic function: role of glutamic acid 500 and autophosphorylation on serine 643. J Biol Chem 274: 8886–8892. [DOI] [PubMed] [Google Scholar]
  49. Vesely PW, Staber PB, Hoefler G, Kenner L (2009). Translational regulation mechanisms of AP‐1 proteins. Mutat Res 682: 7–12. [DOI] [PubMed] [Google Scholar]
  50. Wagner EF, Eferl R (2005). Fos/AP‐1 proteins in bone and the immune system. Immunol Rev 208: 126–140. [DOI] [PubMed] [Google Scholar]
  51. Wegiel B, Hanto DW, Otterbein LE (2013). The social network of carbon monoxide in medicine. Trends Mol Med 19: 3–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Wright MM, Kim J, Hock TD, Leitinger N, Freeman BA, Agarwal A (2009). Human haem oxygenase‐1 induction by nitro‐linoleic acid is mediated by cAMP, AP‐1 and E‐box response element interactions. Biochem J 422: 353–361. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Yang CM, Lee IT, Lin CC, Yang YL, Luo SF, Kou YR et al (2009). Cigarette smoke extract induces COX‐2 expression via a PKCα/c‐Src/EGFR, PDGFR/PI3K/Akt/NF‐κB pathway and p300 in tracheal smooth muscle cells. Am J Physiol Lung Cell Mol Physiol 297: L892–L902. [DOI] [PubMed] [Google Scholar]
  54. Yang CM, Lee IT, Hsu RC, Chi PL, Hsiao LD (2013). NADPH oxidase/ROS‐dependent PYK2 activation is involved in TNF‐α‐induced matrix metalloproteinase‐9 expression in rat heart‐derived H9c2 cells. Toxicol Appl Pharmacol 272: 431–442. [DOI] [PubMed] [Google Scholar]
  55. Yang CM, Lin CC, Lee IT, Hsu CK, Tai YC, Hsieh HL et al (2015). c‐Src‐dependent transactivation of EGFR mediates CORM‐2‐induced HO‐1 expression in human tracheal smooth muscle cells. J Cell Physiol 230: 2351–2361. [DOI] [PubMed] [Google Scholar]
  56. Yao H, Peng F, Fan Y, Zhu X, Hu G, Buch SJ (2009). TRPC channel‐mediated neuroprotection by PDGF involves Pyk2/ERK/CREB pathway. Cell Death Differ 16: 1681–1693. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Yuan X, Xu C, Pan Z, Keum YS, Kim JH, Shen G et al (2006). Butylated hydroxyanisole regulates ARE‐mediated gene expression via Nrf2 coupled with ERK and JNK signaling pathway in HepG2 cells. Mol Carcinog 45: 841–850. [DOI] [PubMed] [Google Scholar]
  58. Yun BR, Lee MJ, Kim JH, Kim IH, Yu GR, Kim DG (2010). Enhancement of parthenolide‐induced apoptosis by a PKC‐α inhibition through heme oxygenase‐1 blockage in cholangiocarcinoma cells. Exp Mol Med 42: 787–797. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from British Journal of Pharmacology are provided here courtesy of The British Pharmacological Society

RESOURCES