Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2018 Jan 17;92(3):e01748-17. doi: 10.1128/JVI.01748-17

ALT-803 Transiently Reduces Simian Immunodeficiency Virus Replication in the Absence of Antiretroviral Treatment

Amy L Ellis-Connell a, Alexis J Balgeman a, Katie R Zarbock b, Gabrielle Barry b, Andrea Weiler b, Jack O Egan c, Emily K Jeng c, Thomas Friedrich b,d, Jeffrey S Miller e, Ashley T Haase f, Timothy W Schacker g, Hing C Wong c, Eva Rakasz b, Shelby L O'Connor a,b,✉
Editor: Viviana Simonh
PMCID: PMC5774892  PMID: 29118125

ABSTRACT

Developing biological interventions to control human immunodeficiency virus (HIV) replication in the absence of antiretroviral therapy (ART) could contribute to the development of a functional cure. As a potential alternative to ART, the interleukin-15 (IL-15) superagonist ALT-803 has been shown to boost the number and function of HIV-specific CD8+ T and NK cell populations in vitro. Four simian immunodeficiency virus (SIV)-positive rhesus macaques, three of whom possessed major histocompatibility complex alleles associated with control of SIV and all of whom had received SIV vaccine vectors that had the potential to elicit CD8+ T cell responses, were given ALT-803 in three treatment cycles. The first and second cycles of treatment were separated by 2 weeks, while the third cycle was administered after a 29-week break. ALT-803 transiently elevated the total CD8+ effector and central memory T cell and NK cell populations in peripheral blood, while viral loads transiently decreased by ∼2 logs in all animals. Virus suppression was not sustained as T cells became less responsive to ALT-803 and waned in numbers. No effect on viral loads was observed in the second cycle of ALT-803, concurrent with downregulation of the IL-2/15 common γC and β chain receptors on both CD8+ T cells and NK cells. Furthermore, populations of immunosuppressive T cells increased during the second cycle of ALT-803 treatment. During the third treatment cycle, responsiveness to ALT-803 was restored. CD8+ T cells and NK cells increased again 3- to 5-fold, and viral loads transiently decreased again by 1 to 2 logs.

IMPORTANCE Overall, our data show that ALT-803 has the potential to be used as an immunomodulatory agent to elicit effective immune control of HIV/SIV replication. We identify mechanisms to explain why virus control is transient, so that this model can be used to define a clinically appropriate treatment regimen.

KEYWORDS: ALT-803, ART-naive, IL-15 superagonist, SIV, SIV treatment, nonhuman primate, virus

INTRODUCTION

Despite the ability of modern antiretroviral therapy (ART) to control human immunodeficiency virus (HIV) infection, a cure remains elusive. Even with ART, the virus establishes latent infection in resting CD4+ T cells from which reactivation can occur. Development of alternative biological interventions that harness the strength of the host immune system to control virus replication could contribute to the development of a functional cure.

Even though ART treatment exhibits phenomenal success for HIV+ patients, effective non-ART-based clinical approaches to enhance the effectiveness of ART are not yet available. Recently, there has been great interest in developing non-ART-based therapies that can work alone or together with ART. One approach is to use prophylactic vaccines to boost CD8+ T cell responses, as these cells play a crucial role in the control of virus replication (1–4). The need to enhance CD8+ T cells during ART was recently highlighted by Cartwright et al., who found that CD8+ T cells were needed to control virus replication in SIV-infected nonhuman primates being treated with ART (5).

There has been recent enthusiasm for approaches that increase the transcription of viral genes from latent reservoirs while boosting both adaptive and innate immune cell populations to eliminate the newly activated virus-infected cells. For example, both Toll-like receptor 7 (TLR7) agonists and α4β7 integrin molecules have been used with some success to promote virologic control in simian immunodeficiency virus (SIV)-positive nonhuman primates (6, 7). While these therapies work by different mechanisms, they demonstrate the enthusiasm for non-ART-based approaches that harness host immunity to control HIV/SIV replication.

Interleukin-15 (IL-15) agonists, such as IL-15:IL-15Rα-Fc complexes, are another class of compounds that may promote antiviral functions of the host immune response. These agonists are broad activators of several innate and adaptive immune populations, in particular CD8+ T cells and NK cells (8, 9). There is some evidence that IL-15 agonists also can act as latency-reversing agents and drive virus transcription in latently infected CD4+ T cells in vitro (10). Although treatment with IL-15 was unable to suppress plasma viremia (11–14), using IL-15 agonists as molecular adjuvants to vaccine vectors has led to some virologic benefit (15, 16).

A novel IL-15 superagonist, ALT-803, recently has been shown to boost in vitro CD8+ T cell and NK cell responses to HIV infection (10). ALT-803 is a soluble IL-15 superagonist complex (IL-15N72D:IL-15RαSuFc) in which a mutant IL-15 (N72D) is bound to the sushi domain of IL-15Rα fused to the Fc region of IgG1 (17–19). ALT-803 promotes rapid expansion of CD8+ T cell and NK cell populations in vitro in human donors and mice and in vivo in nonhuman primates (20). In contrast to recombinant IL-15, ALT-803 has superior in vivo lymph tissue retention in mouse biodistribution studies and more potent antitumor activity (20). Previous data of ALT-803 in several mouse models of cancer suggest broad therapeutic applications in hematologic and solid tumors (21–23). Furthermore, clinical trials evaluating ALT-803 are under way for treatment of hematologic and solid cancers and HIV (ClinicalTrials registration no. NCT02191098).

Given that ALT-803 has such a potentiating effect on cellular immunity, we tested the hypothesis that ALT-803 modulation of cellular immunity could suppress SIV replication in nonhuman primates. We treated ART-naive chronic-phase SIV+ rhesus macaques weekly with 0.1 mg/kg of body weight of ALT-803 subcutaneously for four consecutive weeks. We observed a dramatic 1- to 2-log decline to levels below the limit of detection in plasma viremia during the first 7 to 14 days of treatment. The effect was transient, such that virus loads rebounded concomitantly with IL-15 receptor internalization and changes in the sequences of the virus population. Sensitivity to ALT-803 returned after the animals received a 29-week break from treatment. This study provides evidence that treatment with the IL-15 superagonist ALT-803 can suppress SIV replication in the absence of ART in nonhuman primates.

RESULTS

Initial subcutaneous ALT-803 treatment transiently reduces viremia of SIV+ progressor rhesus macaques.

Four rhesus macaques infected with SIVmac239 for a minimum of 1.5 years were selected for this study. All animals had been part of previous studies and had received a variety of vector vaccines expressing SIV antigens that could or could not elicit CD8+ T cell responses (24). Even though they all initially controlled viremia to nearly undetectable levels (24), their plasma viral loads ranged from 103 to 104 viral copy equivalents (CEQ)/ml at the time of this study (Fig. 1A). Three of these animals expressed Mamu-B*08 and 1 animal expressed Mamu-A*01 major histocompatibility complex (MHC) class I allele (Table 1).

FIG 1.

FIG 1

ALT-803 treatment alters lymphocyte cell populations and viral loads in SIV+ macaques. (A) Log10 virus copy equivalents/ml in plasma were measured as described in Materials and Methods for each animal. Arrowheads mark days on which animals received ALT-803. (B and C) Total CD8+ and CD4+ T lymphocyte populations per μl of blood were determined as described in Materials and Methods using antibodies described in Table 4 and using complete blood counts determined for each time point. (D) Flow cytometry to measure NK cell populations present in PBMC was performed according to Materials and Methods using antibodies described in Table 2. The percentage of NK cells was determined as indicated in Materials and Methods. Total NK cell counts per μl of blood then were calculated based on complete blood counts for each time point. (E to G) Pearson's correlation coefficients (R) were calculated as previously described in Materials and Methods by comparing the log10 viral loads/ml plasma to the log10 total cell counts for CD8+ (E), CD4+ (F), and NK (G) cells.

TABLE 1.

Animal information for animals involved in study

Animal Age (at time of ALT-803), yr Known MHC allele expression Infecting virus Dose (TCID50; IRa administration) Years post-SIV infection (at time of ALT-803), yr
r11021 5 Mamu-A*01 SIVmac239 200 1.5
r08016 8 Mamu-B*08 SIVmac239 200 3
r08054 6 Mamu-B*08 SIVmac239 200 3
r09089 7 Mamu-B*08 SIVmac239 200 3
a

IR, intrarectal.

To test the hypothesis that ALT-803 modulation of cellular immunity can suppress SIV replication in nonhuman primates, we treated all animals subcutaneously with 0.1 mg/kg ALT-803 weekly for 4 weeks. This dose had been previously used to boost cellular immunity in SIV-naive macaques with no adverse side effects (20). Plasma SIV gag viral loads were measured biweekly during treatment. During the first 7 to 10 days of ALT-803 treatment, we observed a precipitous decline in the SIV viral loads (Fig. 1A), such that the viral loads in all 4 animals dropped below the limit of detection on day 10. Unfortunately, suppression of virus replication was transient and the duration was variable across animals.

Increasing absolute number of CD8+ T cells and NK cells correlates with decreasing SIV viral loads.

Previously, ALT-803 was reported to increase the absolute numbers of T cells and NK cells in healthy cynomolgus macaques (20), but this reagent had not yet been studied in SIV+ animals. We measured the absolute number of T cell and NK cell populations prior to and during ALT-803 treatment in SIV+ animals. Consistent with data obtained from healthy animals (20), we observed an increase in both CD8+ T cells and NK cells after the first dose of ALT-803 (Fig. 1B and D), but there were no marked effects on the total number of CD4+ T cells (Fig. 1C). We performed Spearman's correlation analyses to determine if the frequency of CD8+ T cells or NK cells correlated with changes in viral load. The absolute cell counts for CD8+, CD4+, and NK cells, as well as the viral loads, were converted to log-scale numbers for each time point before and during ALT-803 treatment. We observed a significant negative correlation between CD8+ (R = −0.67) and NK (R = −0.54) cell numbers and viral load (Fig. 1E and G, respectively). In contrast, the correlation observed between CD4+ T cells and viral load yielded a low spearman correlation R value (R = −0.43; Fig. 1F) and therefore was not significant.

We further examined changes in the frequency of CD8+ T, CD4+ T, and NK cell subpopulations (Fig. 2). Consistent with previous IL-15 and ALT-803 studies (20, 25), the majority of the upregulated CD8+ T cells had an effector memory (EM) phenotype (Fig. 2B), with minor increases in central memory (Fig. 2A) and naive (Fig. 2C) CD8+ T cells as well. For the NK cells, the majority of the upregulated cells consisted of CD16+ cells, with minor increases in both CD16− CD56− and CD56+ populations (Fig. 2G to I). There were no significant changes in CD4+ T cell subsets (Fig. 2D to F).

FIG 2.

FIG 2

Assessment of memory CD4+ and CD8+ T cell populations and NK cell populations during cycle 1 of ALT-803 treatment. (A to F) Fresh PBMC were isolated from whole-blood samples and were stained as described in Materials and Methods and Table 4, and central memory (CM; CD28+ CD95+ CCR7+) (A and D), effector memory (EM; CD28− CD95+ CCR7−) (B and E), and naive (CD28+ CD95− CCR7+) (C and F) CD4+ and CD8+ T cells were defined from the CD3+ CD4+ and CD3+ CD8+ parent populations, respectively. Total cell numbers were determined based on complete blood counts. (G to I) Fresh PBMC were isolated as described for panels A to F and were stained as indicated in Materials and Methods and Table 2. CD16+ CD56− (G), CD56+ CD16− (H), and CD16− CD56− (I) NK cells were defined from the CD3− CD8+ NKG2A+ parent population. Total cell numbers were determined based on complete blood counts.

Sensitivity to ALT-803 returns after an extended break from treatment.

We wanted to determine if suppression of SIV viremia would return in the presence of ongoing ALT-803 treatment or if a break from ALT-803 was needed to restore sensitivity to the drug. Three of the animals, two of which were Mamu-B*08+ and one of which was Mamu-A*01+, were included in this part of the study. The fourth animal had to be removed for unrelated reasons but otherwise appeared healthy. These three animals were given an additional 4-week course of ALT-803 immediately after the first cycle of treatment (defined as cycle 2) (Fig. 3A), the animals were given a break for 29 weeks, and then they received a final 4-week course of ALT-803 (defined as cycle 3) (Fig. 3A). We found that there was no suppression of SIV viremia during cycle 2, but remarkably, sensitivity to ALT-803 returned during cycle 3 and plasma SIV viral loads were again suppressed, although less substantially than during cycle 1 (Fig. 3B).

FIG 3.

FIG 3

Subsequent cycles of ALT-803 treatment have a similar ability to boost cell populations but differential effects on viral loads. (A) Schematic of ALT-803 treatment. Days of ALT-803 delivery are indicated with arrowheads. (B) Plasma viral loads (log10 virus copy equivalents/ml) determined at each time point. (C and D) Total CD8+ cells (C) or NK cells (D) present in PBMC were determined as indicated in Materials and Methods and Fig. 1. Total CD8+ T cells or NK cells per μl of blood were calculated based on complete blood counts. (E and F) The ki-67+ subpopulations of CD8+ T cells (CD3+ CD8+ NKG2A−) (E) or NK cells (CD3− CD8+ NKG2A+) (F) from PBMC were stained according to Table 2. The fold change in ki-67 relative to the pretreatment level was calculated for each time point. Student's unpaired t test analysis was performed as indicated in Materials and Methods; significance relative to all pretreatment time points (*, P ≤ 0.05; **, P ≤ 0.01) is shown. (G and H) Pearson correlation coefficients (R) were calculated as indicated in Materials and Methods to determine the relationship between plasma viral loads (log10 CEQ/ml) and log10 CD8+ T cells/μl plasma (G) or log10 NK cells/μl plasma (H) during ALT-803 cycle 2 (left) and cycle 3 (right). N.S., not significant.

CD8+ T and NK cell numbers are still boosted during subsequent ALT-803 treatment cycles in the peripheral blood.

One possibility for the lack of suppression of plasma viremia observed during cycle 2 of ALT-803 is that CD8+ T cells and NK cells did not expand in the peripheral blood. Therefore, we assessed whether CD8+ T cell and NK cell populations increased in the blood during cycles 2 and 3. While there were still increased numbers of CD8+ T cells (Fig. 3C) and NK cells (Fig. 3D) in the peripheral blood relative to pretreatment levels, the increases were more modest than those we observed during the initial ALT-803 treatment (Fig. 1). We then assessed the relationship between the number of CD8+ T cells and NK cells and plasma viral loads. We did not observe a negative relationship between CD8+ T cells or NK cells and viral load in the second cycle of ALT-803 treatment (Fig. 3G and H), but the negative correlation between CD8+ T cells and viral loads was restored when ALT-803 treatment resumed after a 29-week break (cycle 3) (Fig. 3G). There were no other differences between the number of naive or memory subpopulations of CD8+ T cells or the cytotoxic or cytokine-producing NK cells across the three treatment cycles (Fig. 4).

FIG 4.

FIG 4

Assessment of memory CD8+ T cell populations and NK cell populations during cycles 1 to 3 of ALT-803 treatment. (A to C) Fresh PBMC were isolated from whole-blood samples and were stained as described in Materials and Methods and Table 4, and central memory (CM; CD28+ CD95+ CCR7+) (A), effector memory (EM; CD28− CD95+ CCR7−) (B), and naive (CD28+ CD95− CCR7+) (C) CD8+ T cells were defined from the CD3+ CD8+ parent population. Total cell numbers were determined based on complete blood counts. (D to F) Fresh PBMC were isolated as described for panels A to C and were stained as indicated in Materials and Methods and Table 2. CD16+ CD56− (D), CD56+ CD16− (E), and CD16− CD56− (F) NK cell populations were defined from the CD3− CD8+ NKG2A+ parent population. Total cell numbers were determined based on complete blood counts.

To determine if the increased numbers of peripheral CD8+ T cells and NK cells were due to redistribution from tissues or proliferation in the blood, we measured changes in the population of cells expressing the proliferation marker ki-67. Relative to pretreatment controls, CD8+ T cells and NK cells expressed significantly higher ki-67 levels during the first cycle of ALT-803 (Fig. 3E and F), suggesting that these populations of cells proliferated in the peripheral blood rather than redistributed from the tissues. This increase was transient and consistent with previous findings that use other IL-15 agonists in macaques (11, 25). ki-67 expression was markedly attenuated during the second cycle of ALT-803 for both cell populations, whereas transient upregulation of ki-67 was restored for CD8+ T cells but not for NK cells for the third cycle of ALT-803 treatment.

No significant changes in peripheral CD4+ T cells during ALT-803 treatment.

We explored the possibility that the number of CD4+ T cells changed during additional cycles of ALT-803 treatment, thus altering the number of target cells for SIV replication. No significant changes were observed in total CD4+ T cells throughout the study (Fig. 5A). When we examined subpopulations of CD4+ T cells, we found no significant changes in central memory (Fig. 5B), effector memory (Fig. 5C), or naive (Fig. 5D) CD4+ T cell subpopulations during treatment with ALT-803.

FIG 5.

FIG 5

CD4+ T cell populations are minimally altered during ALT-803 treatment. (A to D) Peripheral blood samples were stained as indicated in Table 4. Total CD4+ T cells (A), central memory (CM) CD4+ T cells (CD28+ CD95+ CCR7+) (B), effector memory CD4+ T cells (CD28− CD95+ CCR7−) (C), and naive CD4+ T cells (CD28+ CD95− CCR7+) (D) in the peripheral blood were determined as indicated in Materials and Methods and calculated based on complete blood counts.

Ex vivo virus-specific CD8+ T cell and NK cell function do not correlate with ALT-803-dependent virus suppression.

Both CD8+ T cells and NK cells play key roles in control of SIV replication (26–28). Therefore, we wanted to determine if virus-specific CD8+ T cells exhibited an ALT-803-dependent increase in their capacity to produce the cytokines gamma interferon (IFN-γ) and tumor necrosis factor alpha (TNF-α) as well as increased surface expression of CD107a as a marker of degranulation. We performed peripheral blood mononuclear cell (PBMC) intracellular cytokine staining (ICS) assays at several time points after ALT-803 treatment in the presence or absence of SIV peptides known to be presented by either Mamu-B*08 (Env573–581KL9, Nef137–146RL10, and Vif123–131RL9 [29–31]) or Mamu-A*01 (Gag181–189CM9, Tat28–35SL8, and Vif100–109VL10 [32, 33]). The percentages of CD107a, TNF-α, and IFN-γ+ CD8+ T cells were measured and normalized to a no-peptide control for each time point. We saw no consistent evidence of increased CD8+ T cell function during cycle 1, when there was the greatest virus suppression (Fig. 6A to C). We observed occasional increases in CD8+ T cell function in individual animals that coincided with each ALT-803 treatment cycle (i.e., upregulation of CD107a in animal r11021 at day 7 compared to pretreatment for Vif100–109VL10 peptide); however, no statistically significant common trend was observed in cytokine or degranulation marker upregulation among all animals (data not shown). These data suggest that there was no clear correlation between in vivo virus suppression and the function of the peripheral CD8+ T cells specific for the peptides that we tested. It is possible that CD8+ T cells targeting entirely different peptides exhibited ALT-803-dependent increased function or that CD8+ T cells in the tissues were more effective, but we were unable to explore these possibilities in this study.

FIG 6.

FIG 6

CD8+ T cell responsiveness to peptide in ICS assays is similar in all three cycles of ALT-803 treatment. (A to C) Frozen PBMC were rested overnight, and ICS assays were performed as described in Materials and Methods using the indicated A*01-restricted (Gag181–189CM9, Tat28–35SL8, and Vif100–109VL10; animal r11021) (A) or B*08-restricted (Env573–581KL9, Nef137–146RL10, Vif123–131RL9; animals r08016 and r09089) (B and C) peptides or a no-peptide control. Cells were stained as shown in Table 6, and live CD8+ T cells were defined as CD3+ CD8+ CD4−. Within the CD8+ T cell gate, the percentages of CD107a+ (top), TNF-α+ (middle), and IFN-γ+ (bottom) were determined individually. The data then were normalized to the no-peptide control for each individual time point. (D) Fresh PBMC were used to perform ICS assays as indicated in Materials and Methods. Cells were stained with antibodies according to Table 3. NK cells were defined as CD3− CD8+ NKG2A+. The percentages of CD107a+ (top), TNF-α+ (middle), and IFN-γ+ (bottom) cells were determined and normalized to a control sample (no. 721.221 cells).

We also measured ALT-803 enhancement of NK cell function at the same time points using a method described previously (34) (Fig. 6D). Although ALT-803 appeared to transiently increase the function of NK cells, there was no statistically significant correlation between NK cell activity and virus suppression across the three cycles of ALT-803 treatment.

The amino acid composition of a subset of CD8+ T cell epitopes is altered by ALT-803 treatment.

We wanted to determine if ALT-803-dependent expansion of CD8+ T cells preceded changes in the sequences of the replicating virus population. We deep sequenced virus populations in duplicate from two of the Mamu-B*08+ animals at two time points before and two time points after treatment with ALT-803. We quantified the frequency of different amino acid sequences of epitopes that are restricted by Mamu-B*08.

For animal r09089, we found that the composition of amino acid sequences in the epitopes Nef137–146RL10 (Fig. 7A), Nef8–16RL9 (Fig. 7B), and Vif123–131RL9 (Fig. 7C) were different before and after ALT-803 treatment. For animal r08016, there were fluctuations in the frequencies of variants in Nef8–16RL9 (Fig. 7F), and we detected a new variant in the Vif172–179RL8 epitope (Fig. 7H) on day 56. The other epitopes for this animal displayed no dramatic changes (Fig. 7E and G). Unfortunately, we cannot determine if these changes in the virus populations were a consequence of latent virus reactivation or selection of new virus populations, but it does indicate that perturbing the homeostasis of the CD8+ T cell population corresponded to an effect on the sequences of the replicating virus population.

FIG 7.

FIG 7

Distinct viral variants appear in several Mamu-B*08-restricted epitopes during ALT-803 treatment. (A) Deep-sequencing analysis was performed, as described in Materials and Methods, on plasma samples from animals r09089 and r08016. The time points shown are relative to the first ALT-803 treatment. Viral variant frequencies were determined for Nef137–146RL10 (A and E), Nef8–16RL9 (B and F), Vif123–131RL9 (C and G), and Vif172–179RL8 (D and H). Amino acid variation relative to the wild-type sequence for each epitope is indicated by letters; amino acids that were the same as those of the wild-type sequence are shown as dots.

ALT-803 promotes upregulation of inhibitory markers CD39 and PD-1 on CD8+ T cells and the development of regulatory CD4 T cells.

We next wanted to determine if there were changes in the phenotypes of CD8+ T cell and NK cell populations that may have had an effect on their in vivo function. We measured activation (HLA-DR, CD25, and CD69) and inhibitory/exhaustion (CD39 and PD-1) markers present on CD4+ and CD8+ T cell memory populations and NK populations throughout all three ALT-803 treatment cycles by flow cytometry.

We detected notable changes in the expression of CD39 on CD8+ T cells during the course of treatment. CD39 is an ectonucleotidase that hydrolyzes extracellular ATP (35), and CD4+ and CD8+ T cells expressing CD39 can inhibit cytokine production from CD39-negative T cells (36–38). High surface expression of CD39 has been linked to terminal exhaustion of CD8+ T cells in chronic HIV infection (39). We found that CD39+ central memory CD8+ T cells increased most prominently during the second cycle of ALT-803, whereas effector memory CD8+ T cells increased over the baseline during each cycle of ALT-803 treatment (Fig. 8A and B). While no significant changes were observed in overall PD-1 expression in either effector memory or central memory CD8+ T cells (data not shown), we did not find many changes in CD39/PD-1 double-positive cells in the central memory CD8+ T cell subpopulations (Fig. 8C); we found significant increases in the effector memory CD8+ T cell populations that coexpressed both CD39 and PD-1 (Fig. 8D). This double-positive population was statistically significant during the second cycle of ALT-803 treatment, coincident with reduced effect of ALT-803 on viral loads (Fig. 3B). The expression of these markers alone is not necessarily a hallmark of immune exhaustion (40). Furthermore, we did not measure peptide-specific stimulation from this double-positive population of cells; therefore, the CD39+ PD-1+ cells cannot definitively be declared exhausted. However, these data suggest that continuous ALT-803 treatment does lead to an increase in a population of CD8+ T cells that express regulatory markers and inhibit in vivo cytokine production.

FIG 8.

FIG 8

ALT-803 increases CD39+ CD8+ effector memory and central memory T cells and regulatory T cells (Tregs) (A and B) CD39+ cells were determined for the parent central memory (CM; CD3+ CD8+ CD28+ CD95+ CCR7+) and effector memory (EM; CD3+ CD8+ CD28+ CD95+ CCR7−) CD8+ T cell populations as described in Materials and Methods and Table 4. The fold change in CD39 expression was determined relative to the average of the pretreatment time points. Student's unpaired t test analysis was performed as described in Materials and Methods; significance relative to all pretreatment time points (*, P ≤ 0.05; **, P ≤ 0.01) is shown. (C and D) PD-1+ cell levels were determined for each of the CD39+ CM and EM CD8+ T cell parent populations. The fold changes in PD-1+ CD39+ for CM and EM CD8+ T cells were calculated as described for panels A and B. Statistics were performed as described for panels A and B. (E) Tregs were defined as CD45+ CD3+ CD4+ cells that were both CD25 and CD39 positive. The fold change in Tregs was determined as described for panels A to D. Statistics were performed as indicated for panels A and B.

We additionally observed increases in CD39+ CD25+ CD4+ T cells in all three cycles of treatment (Fig. 8E). The coexpression of CD39 with CD25 on CD4+ or CD8+ T cells is indicative of a T regulatory (Treg) phenotype (36, 41, 42). Thus, continuous ALT-803 treatment boosted the frequencies of regulatory T cells.

Surface expression of the IL-15 receptor declines during the second cycle of ALT-803 treatment.

ALT-803-dependent cell activation requires that the modified IL-15 of the ALT-803 molecule interacts with the IL-15/IL-2 β (CD122) and the common γC (CD132) receptors present on target cells. Modulation of the surface expression of these receptors has been observed in other in vivo IL-15 treatment models (25). To determine if ALT-803 modulated surface expression of the IL-15 receptor, we used flow cytometry to measure the mean fluorescence intensity (MFI) of these two receptors during treatment. We found a significant increase in surface expression of CD122 (as indicated by MFI) on CD8+ EM T cells at days 7 and 10 after the first ALT-803 treatment (Fig. 9A, left). However, the surface expression of CD122 returned to pretreatment levels with continued ALT-803 treatment. We found that the surface expression of CD122 did not increase during the second phase of treatment but once again transiently increased during the first 7 days of the third cycle of ALT-803 treatment (Fig. 9A, left). We did not observe any significant changes in the expression of CD132 during ALT-803 treatment in the CD8+ EM T cell population (Fig. 9A, right).

FIG 9.

FIG 9

IL-15 receptors β (CD122) and γC (CD132) fluctuate with continued ALT-803 delivery. (A) Frozen PBMC were stained as described in Table 5, and effector memory (EM) CD8+ T cells were defined as CD3+ CD8+ CD28+ CD95− CCR7−. From this population of cells, the mean fluorescence intensity (MFI) was determined for CD122 (left) and CD132 (right). Student's unpaired t tests were performed as described in Materials and Methods; statistically significant events (*, P ≤ 0.05; **, P ≤ 0.01) are marked. (B) Frozen PBMC were stained as described for panel A, and central memory CD8+ T cells were defined as CD3+ CD8+ CD28+ CD95+ CCR7+. The MFI then was determined for CD122 (left) and CD132 (right) for this parent population for the indicated times. Statistics were performed as indicated for panel A. (C) NK cells were defined as CD3− CD8+ NKG2A+. CD122 (left) and CD132 (right) MFI are shown. Statistics were performed as indicated for panel A.

In contrast, we found that CD8+ CM T cells exhibited a transient decline in the surface expression of both CD122 (Fig. 9B, left) and CD132 (Fig. 9B, right) during the second phase of ALT-803 treatment. In addition, NK cells exhibited a decline in the expression of CD122 during the second phase of ALT-803 treatment (Fig. 9C).

Overall, the changes in the expression of these receptors are consistent with the hypothesis that memory CD8+ T cells and NK cells initially respond to ALT-803 but then surface expression of the receptor declines, likely translating to reduced responsiveness of these cell populations over time.

DISCUSSION

In this study, we show that treatment of SIV+ animals with the IL-15 superagonist ALT-803 can suppress virus replication to undetectable levels in the absence of ART. We selected four SIV+ rhesus macaques who had been infected for more than 1.5 years and who had plasma viremia ranging from 103 to 104 copies/ml. Within the first 2 weeks after the initial treatment with ALT-803, SIV plasma viremia reached undetectable levels in all four animals. Virus suppression was coincident with increased peripheral CD8+ T cell and NK cell counts. Virus suppression, however, was only transient. Even with ongoing ALT-803 treatment, plasma viremia rebounded. Remarkably, ALT-803-dependent virus suppression was partially restored in the three animals that resumed ALT-803 treatment after a break of 29 weeks. These data together suggest that the host immune response can be modulated by ALT-803 to control SIV replication in chronically infected macaques, even without ART.

Unfortunately, the specific mechanism of virus suppression remains unknown. Our data suggest that the expansion of immune cells in the peripheral blood played a key role in this suppression. We found that the frequencies of CD8+ T cells and NK cells were inversely correlated with plasma viremia during the treatment cycles when animals responded to ALT-803. We did observe significant increases in the population of ki-67+ CD8+ T cells and NK cells in the first cycle and then a significant increase in ki-67+ CD8+ T cells during the third cycle of ALT-803 (Fig. 4), suggesting that increased T cell proliferation in the blood was a factor in improving antiviral immunity. We also measured the function of SIV-specific CD8+ T cells by intracellular cytokine assays, but there was no correlation between increased epitope-specific cytokine production and suppression of plasma SIV viremia. Additional studies will need to be performed to elucidate the immunological mechanism explaining how ALT-803 reduced viral loads in the first and third treatment cycles, so that altered treatment regimens can be identified to sustain virus suppression for a longer period of time.

For an anti-HIV immunomodulatory therapeutic to be effective, it will need to stimulate host immunity to continuously suppress viremia for a long period of time, even though mechanisms exist to prevent overactivation of the host immune system. We chose animals who were ART naive to assess whether immunomodulation, without ART, could induce and maintain virus suppression in these specific animals. Not surprisingly, suppression of virus replication was only transient, as these animals employed mechanisms to prevent overstimulation. These mechanisms included downregulation of the IL-15 receptors (CD122 and CD132) on target cells. We found that CD122 expression on effector memory cells increased during the first treatment cycle (Fig. 9A), but then the expression of both CD122 and CD132 on effector and central memory CD8+ T cells declined as viral loads rebounded (Fig. 9A and B). Expression of CD122 was restored by the third cycle of treatment. These data indicate that (i) downregulation of CD122 and CD132 occurs during continuous ALT-803 treatment, thereby reducing the efficacy of the agent, and (ii) IL-15 responsiveness can be restored after a sufficient recovery period.

We observed increased expression of PD-1 and CD39 on CD8+ T cells as an additional mechanism to prevent overstimulation of the host immune response. Enhanced expression of these markers was particularly noticeable during the second cycle of ALT-803, when there was no suppression of viremia. While this was only observational, it suggests that with continuous ALT-803 treatment, particularly during chronic SIV infection, these cell populations have decreased in vivo cytokine production. One caveat is that increased expression of PD-1 and CD39 was observed coincident with the decline in viremia during the first treatment cycle (Fig. 3B and 8C and D). It is possible that expression of PD-1 and CD39 was increased after the necessary immune response brought about virus suppression. Perhaps more frequent characterization of these cell populations during the first week of ALT-803 treatment in future studies will better define the timeline of virus suppression and corresponding changes in cellular phenotypes. It also is possible that the expression of PD-1 and CD39 on these populations of CD8+ T cells was not indicative of exhaustion. Studies have suggested that PD-1 and CD39 can be upregulated during early CD8+ T cell activation (43) and may not always mark exhausted T cells (40). Our ICS data (Fig. 6) measured cytokine production from the overall population of epitope-specific CD8+ T cells rather than the PD-1+ CD39+ subpopulation. Future work can elucidate the mechanism and timing of PD-1 and CD39 upregulation and whether their increased expression is linked to virus rebound. Furthermore, if upregulation of these factors proves to be linked to decreased effectiveness of ALT-803, future studies could address how we might limit their upregulation to sustain the effects of ALT-803 in vivo.

Any intervention that includes an immune-activating agent, such as ALT-803, will need to enhance efficacy and minimize toxicity. We observed no adverse effects of ALT-803 on the health of the animals. It is likely that the high dose of ALT-803 that we used overstimulated the immune response, such that negative regulation was required by the host immune system to achieve homeostasis until the animal recovered after many weeks off treatment. This would not be surprising, as the ALT-803 dose of 0.1 mg/kg is more than 10-fold greater than the dose being used in HIV clinical trials (44). Thus, altered regimens of ALT-803 that use either a lower dose or a different schedule should be considered in future studies.

Another possibility to explain the rise in viremia is that mutations accumulated in targeted T cell epitopes that were not recognized by the circulating population of T cells. Several variants that were present in the plasma virus populations of these animals either have been previously identified as escape mutations or were detected in virus populations from other Mamu-B*08+ SIV+ rhesus macaques. These variants include Nef137–146RL10 (R2G, R2K, and I8T), Nef8–16RL9 (R4K), Vif172–179RL8 (R2G and R6G), and Vif123–131RL9 (A3V) (24, 31, 45, 46). We do not know whether the rebound viremia was derived from archival virus or whether there was selection for new escape variants in the population. Interestingly, we detected a higher frequency of wild-type epitope sequences in Nef137–146RL10 (Fig. 7A) and Nef8–16RL9 (Fig. 7B) in the virus population isolated from animal r09089 after ALT-803 treatment. In addition, we found an increase in frequency of a Vif123–131RL9 epitope variant with only one amino acid change after ALT-803 treatment (Fig. 7C) rather than the two-amino-acid variant epitope that was present prior to treatment. In stark contrast to these observations in animal r09089, we did not observe similar increases in wild-type epitope sequences in animal r08016. While these studies suggest that ALT-803 disrupts the virus population, it is clear that further studies are needed to determine whether ALT-803 induces replication of archival latent viruses or activates CD8 T cells to select for new virus variants.

The observed transient efficacy also may be a consequence of anti-ALT-803 antibodies developing against the human IgG1 Fc molecule present in ALT-803 (17). Anti-ALT-803 enzyme-linked immunosorbent assays (ELISAs) were performed on plasma and serum samples collected during all three cycles of ALT-803 treatment. We found that two animals (r08054 and r11021) developed a detectable antibody response to ALT-803 that was significantly above that of the negative control (Fig. 10), but there was no clear correlation between antibody production and increases in plasma viral loads. In fact, the animal with the highest titer of anti-ALT-803 antibodies (r11021) exhibited the lowest plasma viremia. Further cohorts with more animals will be needed to determine if there is any significant role of antibodies on blocking the function of ALT-803.

FIG 10.

FIG 10

Anti-ALT-803 antibody production in ALT-803-treated rhesus macaques during all three treatment cycles. Plasma and serum samples collected at the indicated time points for each animal were subjected to an anti-ALT-803 ELISA in which ALT-803 was used as the capture reagent, and horseradish peroxidase-conjugated ALT-803 was used as the detection reagent. Samples were normalized to a standard curve performed using a human IL-15 monoclonal antibody, and the relative concentration (in ng/ml) of each sample is shown on the y axis.

It is of note that these animals may have been primed to have particularly effective CD8+ T cell responses to SIV. Three of the four animals expressed the MHC allele Mamu-B*08 that is associated with elite control (30), and the fourth animal was positive for Mamu-A*01. In addition, all 4 animals had been previously vaccinated (24). This study therefore harbors promise for ALT-803 as an adjuvant for targeted immunotherapeutic vaccine vectors designed to elicit CD8+ T cell responses. It will be necessary to perform further studies, using animals with a variety of MHC genetics with different vaccination histories, to determine if favorable CD8+ T cell responses are needed to promote ALT-803-mediated viral control. It is entirely possible that our observations were unique to the animal cohort that was available to us. Dissecting the mechanism to explain the observed virus suppression in this context will be key for using this agent in the future.

Our study is unique because we found that treating chronically SIV+ animals with an IL-15 superagonist led to control of virus replication in the absence of ART. Previous studies in which IL-15 was administered during acute or chronic SIV infection did not exhibit similar suppression of virus replication (11–13, 47, 48). One possible explanation for these differences is the biodistribution and longer half-life of ALT-803 compared to those of recombinant IL-15 (17, 19). For example, animals treated with ALT-803 or IL-15/IL-15Rα complexes had more potent CD8+ T cell and NK cell responses to tumor antigens and significantly reduced tumor size compared to those of recombinant IL-15-treated animals (20, 49, 50). Thus, it is possible that ALT-803 is simply a better immune activator than IL-15. Alternatively, it is possible that prior vaccination aimed at eliciting virus-specific CD8+ T cells is needed for ALT-803 to be maximally effective. Past studies that included an IL-15-expressing vector in the vaccine regimen found that the addition of IL-15 improved virus control. As all four animals in this study had received prior vaccination (24), it is possible that vaccine-elicited memory T cells contributed to the efficacy of ALT-803. We think this is unlikely, however, as two of the animals (r08016 and r08054) were vaccinated with minigenes containing nef sequences that incorporated a mutant RL10 epitope that was not recognized by CD8+ T cells and, thus, T cells in that animal were not primed with an antigen matching the challenge strain. Future studies will need to decipher whether vaccination is required for ALT-803-mediated suppression of viremia.

In conclusion, we show that the immunomodulatory IL-15 superagonist ALT-803 can modulate the host immune response to reduce viral loads to undetectable levels in the absence of antiretroviral treatment in this cohort of SIV+ animals. Given that the reduction in viral loads was transient (Fig. 3), the use of ALT-803 by the regimen that we used will likely be insufficient for clinical use. Modification of our approach by changing the dosing protocol may better sustain virologic control. Further investigation into the use of ALT-803 as an adjuvant to SIV vaccination also is needed to determine whether prior vaccination is a requirement for ALT-803-mediated control of plasma SIV viremia. Nevertheless, our findings indicate for the first time that ALT-803 can be a powerful tool to use alone or in combination with other therapies to promote immune-mediated control of HIV/SIV replication.

MATERIALS AND METHODS

Research animals.

All animals used in this study were housed at the Wisconsin National Primate Research Center (WNPRC). They were cared for by IACUC protocol g005507, approved by the University of Wisconsin Graduate School Institutional Animal Care and Use Committee. All ALT-803 administrations, biopsy specimens, and blood draws were performed under anesthesia, and every effort was made to minimize suffering. Indian rhesus macaques (Macaca mulatta) were positively genotyped for the MHC class I alleles Mamu-A*01 and Mamu-B*08 using methods described previously (51). The animals included in this study were infected as part of a previous study with repeated intrarectal inoculations of 200 IU of the 50% tissue culture infective dose (TCID50) of SIVmac239 (24). Table 1 summarizes the genetic and viral infection information for the animals used in this study.

Cell lines and reagents.

Peripheral blood mononuclear cells (PBMC) isolated from whole-blood samples and the 721.221 B-lymphocytic cell line (originally from the ATCC) were cultured in RPMI 1640 containing 10% fetal bovine serum (FBS), 4 mM l-glutamine (catalog no. 25030-081; Thermo Fisher), and 1% antibiotic/antimycotic reagent (catalog no. 15240-062; referred to as R10; Thermo Fisher). ALT-803 (Altor BioScience) was produced and purified as previously described (17).

ALT-803 delivery.

Safe dosing and administration of ALT-803 to macaques has been described previously (20). In all four SIV-infected macaques used in this study, 0.1 mg/kg of ALT-803 was administered subcutaneously in phosphate-buffered saline (PBS) once per week for four consecutive weeks. After this, ALT-803 administration was paused for 1 week and then resumed for another four consecutive weeks in three of the animals. Weekly blood draws were performed, and the health of the animals was monitored closely during this time period. Treatment of ALT-803 was halted for 29 weeks in these three animals, and then they were treated subcutaneously with 0.1 mg/kg ALT-803 each week for four consecutive weeks.

In vitro characterization of NK cell proliferation and function.

Using PBMC isolated from whole-blood samples, NK cell proliferation and function were measured as previously described (34, 52). Briefly, freshly isolated PBMC were stained with the indicated NK cell surface and intracellular markers (Table 2) to determine how NK cell populations were changing phenotypically through the course of ALT-803 treatment. An NK function assay was designed as previously described (34) to measure NK cell cytokine release and degranulation in the presence of non-self target cells. PBMC were treated for 30 min with tumor necrosis factor α protease inhibitor (TAPI-1; catalog no. B4686-1; Apexbio Technology LLC) to inhibit basal TNF-α production. Cells then were washed to remove inhibitor and placed in the presence or absence of 721.221 target cells. Samples then received anti-CD107a-BV605 (Table 3), monensin (catalog no. 420701; BioLegend), and brefeldin A (catalog no. 420601; BioLegend). Cells were stimulated for 8 h at 37°C and 5% CO2, stained with the indicated surface markers (Table 3), and finally fixed with 2% paraformaldehyde. The next day, cells were permeabilized with saponin and stained with intracellular markers as indicated in Table 3 and as previously described (34). Flow cytometry was performed on a BD LSR II (Becton Dickinson, Franklin Lakes, NJ), and the data were analyzed using FlowJo software for Macintosh (version 9.9.3).

TABLE 2.

Antibodies used for NK proliferation panel

Antibody Clone Fluorochromea Catalog no. Company
Live/dead Near infrared L10119 Fisher Scientific
CD45 D058-1283 BV786 563861 BD Biosciences
CD3 SP34-2 Alexa Fluor 700 557917 BD Biosciences
CD20 2H7 Alexa Fluor 700 560631 BD Biosciences
CD14 M5E2 Alexa Fluor 700 557923 BD Biosciences
CD8 SK1 BV510 563919 BD Biosciences
CD16 3G8 BV711 563127 BD Biosciences
CD56 B169 FITC 562794 BD Biosciences
NKG2A/C Z199 PE-Cy7 B10246 Beckman Coulter
KIR3DLO1 NKVFS1 PE 130-092-688 Miltenyi
NKp46 BAB281 PE-Cy5 A66902 Beckman Coulter
ki-67 B56 Alexa Fluor 647 561126 BD Biosciences
a

FITC, fluorescein isothiocyanate.

TABLE 3.

Antibodies used for NK functional assay

Antibody Clone Fluorochromea Catalog no. Company
Live/Dead Near infrared L10119 Fisher Scientific
CD45 D058-1283 BV786 563861 BD Biosciences
CD3 SP34-2 PE CF594 562406 BD Biosciences
CD20 2H7 PE CF594 562295 BD Biosciences
CD8 RPA-T8 BV711 563677 BD Biosciences
CD16 3G8 PacBlue 558122 BD Biosciences
CD56 B169 PerCP Cy5.5 560842 BD Biosciences
KIR3DLO1 NKVFS1 PE 130-092-688 Miltenyi
NKG2A/C Z199 PE Cy7 B10246 Beckman Coulter
CD107a H4A3 BV605 328633 BioLegend
IFN-γ 4S.B3 FITC 554551 BD Biosciences
TNF-α Mab11 Alexa Fluor 700 557996 BD Biosciences
Granzyme B GB11 BV510 563388 BD Biosciences
a

PacBlue, Pacific Blue. PerCP, peridinin chlorophyll protein.

In vitro characterization of longitudinal T cell populations and CD8+ T cell function.

Using PBMC freshly isolated from whole-blood samples, the quantity and phenotype of T cell populations present were assessed before, during, and after ALT-803 treatment. Briefly, PBMC were stained with antibodies to the surface markers indicated in Table 4. Afterwards, cells were washed twice with a buffer consisting of 10% FBS in 1× PBS (fluorescence-activated cell sorter buffer) and fixed with 2% paraformaldehyde for a minimum of 20 min. Flow cytometry was performed on a BD LSR II (Becton Dickinson, Franklin Lakes, NJ), and the data were analyzed using FlowJo software for Macintosh (version 9.9.3).

TABLE 4.

Antibodies used in T memory phenotype staining panel

Antibody Clone Fluorochromea Catalog no. Company
Live/Dead Near infrared L10119 Fisher Scientific
CD45 D058-1283 BV786 563861 BD Biosciences
CD3 SP34-2 PE CF594 562406 BD Biosciences
CD20 2H7 Alexa Fluor 700 560631 BD Biosciences
CD8 SK1 BV510 563919 BD Biosciences
CD4 SK3 BV711 563028 BD Biosciences
CD28 28.2 APC 559770 BD Biosciences
CD95 DX2 PE Cy5 559773 BD Biosciences
CCR7 150503 FITC FAB197F R&D Systems
PD1 EH12.2H7 BV605 329924 BioLegend
CD39 A1 BV421 328214 BioLegend
CD25 M-A251 PE 555432 BD Biosciences
NKG2A/C Z199 PE-Cy7 B10246 Beckman Coulter
a

APC, allophycocyanin.

To assess CD8+ T cell and NK cell IL-2R-β (CD122) and -γC (CD132) expression longitudinally, previously frozen PBMC were thawed and stained with the indicated antibodies (Table 5). Flow cytometry was performed as described above. Flow cytometry was performed on a BD LSR II (Becton Dickinson, Franklin Lakes, NJ), and the data were analyzed using FlowJo software for Macintosh (version 9.9.3).

TABLE 5.

Antibodies used to assess IL-15 receptor expression in CD8+ T cells and NK cells in CD122/CD132 staining panel

Antibody Clone Fluorochrome Catalog no. Company
Live/Dead Near infrared L10119 Fisher Scientific
CD8 SK1 BV510 563919 BD Biosciences
CD3 SP34-2 Alexa Fluor 700 557917 BD Biosciences
CD28 28.2 APC 559770 BD Biosciences
CD95 DX2 PE Cy5 559773 BD Biosciences
CD132 AG184 PE 555900 BD Biosciences
CD122 MIK-β3 BV421 562887 BD Biosciences
CD45 D058-1283 BV786 563861 BD Biosciences
NKG2A/C Z199 PE-Cy7 B10246 Beckman Coulter
CCR7 150503 FITC FAB197F R&D Systems
CD20 2H7 Alexa Fluor 700 560631 BD Biosciences

Intracellular cytokine staining (ICS) was performed to characterize the function of SIV-specific CD8+ T cells as previously described (53, 54). Previously frozen PBMC were rested overnight in culture medium (R10). The next day, cells were preincubated for 1.5 h with 10 μM the indicated peptides. Anti-CD28 (catalog no. 556620; BD Biosciences), anti-CD49d (catalog no. 555502; BD Biosciences), 2 μM monensin, 5 μg/ml brefeldin A, and anti-CD107a-phycoerythrin (PE) (catalog no. 555801; BD Biosciences) were added, and cells were incubated for a maximum of 16 h. Cells then were stained with antibodies to the indicated surface markers (Table 6). The cells were permeabilized with 0.1% saponin and stained with the indicated intracellular markers (Table 6). Flow cytometry was performed as described above.

TABLE 6.

Antibodies used CD8+ T cell intracellular cytokine staining panel

Antibody Clone Fluorochrome Catalog no. Company
Live/Dead Near infrared L10119 Fisher Scientific
CD3 SP34-2 PE CF594 562406 BD Biosciences
CD8 SK1 BV510 563919 BD Biosciences
CD4 OKT4 PE Cy7 317414 BioLegend
CD107a H4A3 PE 555801 BD Biosciences
IFN-γ 4S.B3 FITC 554551 BD Biosciences
TNF-α Mab11 PerCP Cy5.5 502926 BioLegend

Statistical analyses.

Pearson's correlation coefficients were calculated as previously described (55) to determine the linear relationship between the log value of the total CD8+ T cell, CD4+ T cell, or NK cell numbers and the log value of plasma viral loads. Because of minimal fluctuations in values prior to ALT-803 delivery, the pretreatment viral loads and total cell counts were averaged for days −28 to day −7 to obtain one pretreatment value. For the second cycle of ALT-803 delivery, the posttreatment T cell/NK cell counts and viral loads were not averaged, because these values fluctuated after ALT-803 delivery. Finally, for the third cycle of ALT-803 treatment, the pre-third cycle viral loads and cell counts (days 224 to 252) were averaged to obtain one pre-ALT-803 value due to minimal fluctuations in these values. Pearson's correlation coefficients then were calculated using one pretreatment value, and all other values at other time points during cycle 3 of ALT-803 treatment were assessed individually.

For comparative analysis of activation and exhaustion markers present on immune cells before and after ALT-803 treatment initiation, Student's unpaired t tests were performed. For most analyses, the pretreatment values for a given cellular activation marker were averaged for each individual animal, and then the fold change relative to pretreatment averages were determined for every time point. The fold changes in expression at each time point for all animals then were displayed on each graph.

Plasma viral loads and virus sequencing.

Plasma viral loads were quantified as previously described (46, 56–58). Briefly, viral RNA was isolated from plasma, reverse transcribed, and amplified with the SuperScript III Platinum one-step quantitative RT-PCR system (Thermo Fisher Scientific). Viral RNA was quantified by quantitative PCR (qPCR) analysis on a LightCycler480 (Roche) and compared to an internal standard curve on each run.

Generation and deep sequencing of SIV amplicons.

Sequencing of plasma SIV from the indicated time points (Table 7) was performed using an adaptation of a protocol originally described in reference 59. Briefly, RNA was isolated from plasma samples using a Maxwell 16 viral total nucleic acid purification kit (Promega) according to the company's protocols. Reverse transcription was performed using a SuperScript IV first-strand cDNA synthesis kit (Thermo Fisher Scientific) to generate cDNA templates used for PCR. The cDNA samples were divided in two, and the cDNA templates (Table 7) were used to perform PCRs in duplicate for each time point using a Q5 high-fidelity PCR kit (NEB). The indicated primers (Table 8) were used for each sample at a final concentration of 0.4 μM in the reaction. PCR products were purified using Agencourt AMPure XP beads (Beckman Coulter) at a 1:2 PCR product/bead ratio.

TABLE 7.

Relevant information for sequencing analysis of virus harvested from plasma

Animal and time point Virus copy equivalents/ml plasma cDNA templates used for each PCR amplification No. of sequencing reads subsampled for analysis
r08016
    Pretreat (day −21) 4.03E+03 146.3 5.00E+03
    Pretreat (day −7) 4.43E+03 133.1 5.00E+03
    End of cycle 1 (day 35) 9.47E+02 31.3 5.00E+03
    End of cycle 2 (day 56) 5.68E+02 18.7 5.00E+03
r09089
    Pretreat (day −21) 3.98E+03 127.1 5.00E+03
    Pretreat (day −7) 4.43E+03 146.3 5.00E+03
    End of cycle 1 (day 35) 7.12E+02 23.5 5.00E+03
    End of cycle 2 (day 56) 8.42E+02 27.8 5.00E+03

TABLE 8.

Primers used for amplification of SIV genome in sequencing analysis pipeline

Primer name Region of amplification SIVmac239 genome Primer sequence
5,885 F 5885–6177 GGACAGATGTAACACCAAACTATGCAG
6,177 R 5885–6177 ACCGCCTCTCTGTTTATCTCCTCT
9,269 F 9269–9555 AGGCTCTCTGCGACCCTACA
9,555 R 9269–9555 CAGCTGGGTTTCTCCATGGAGT
9,623 F 9623–9820 GGTAGGGGTATCAGTGAGGCCA
9,820 R 9623–9820 GGTCCTGAGGTGTAATCCTGCCA

Purified products were prepared for sequencing analysis using a minor adaptation of the Illumina TruSeq chromatin immunoprecipitation library preparation kit (Illumina, San Diego, CA). Briefly, the protocol for the kit was followed according to the manufacturer's instructions, beginning with the End Repair step. After library preparation, samples were quantified using a Qubit double-stranded DNA high-sensitivity kit (Thermo Fisher Scientific). Samples then were pooled, denatured, and sequenced on an Illumina MiSeq.

Fastq reads were analyzed using a series of custom scripts generated in Python as follows. First, up to 5,000 reads spanning each amplicon were extracted from the data set. Extracted reads then were mapped to the SIVmac239 reference (GenBank accession number M33262) using Novoalign. The output .vcf and .bam files then were imported into Geneious (Biomatters, Ltd.). Here, reads spanning the epitope were extracted and translated, and identical sequences were counted. The frequencies of unique epitope variants then were quantified in Microsoft Excel.

ACKNOWLEDGMENTS

H.C.W., J.O.E., and E.K.J. are employees and shareholders of Altor BioScience Corporation.

A.L.E., J.O.E., E.K.J., T.F., J.S.M, A.T.H., T.W.S., H.C.W., E.R., and S.L.O. contributed to the conception and design of the experiments; A.L.E., A.J.B., K.R.Z., G.B., A.W., and J.O.E. performed the experiments; A.L.E., J.O.E., H.C.W., and S.L.O. analyzed and interpreted the data; A.L.E and S.L.O. wrote the manuscript.

We thank staff at the Wisconsin National Primate Research Center (WNPRC) for veterinary care of the animals involved in the study.

The research was conducted in part at a facility constructed with support from Research Facilities Improvement Program grant numbers RR15459-01 and RR020141-01. We also thank members of the Wisconsin National Primate Research Center, a facility supported by grants P51RR000167 and P51OD011106.

This study was funded in part by NIH R01 AI108415.

REFERENCES

  • 1.Freel SA, Saunders KO, Tomaras GD. 2011. CD8(+)T-cell-mediated control of HIV-1 and SIV infection. Immunol Res 49:135–146. doi: 10.1007/s12026-010-8177-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Deng K, Pertea M, Rongvaux A, Wang L, Durand CM, Ghiaur G, Lai J, McHugh HL, Hao H, Zhang H, Margolick JB, Gurer C, Murphy AJ, Valenzuela DM, Yancopoulos GD, Deeks SG, Strowig T, Kumar P, Siliciano JD, Salzberg SL, Flavell RA, Shan L, Siliciano RF. 2015. Broad CTL response is required to clear latent HIV-1 due to dominance of escape mutations. Nature 517:381–385. doi: 10.1038/nature14053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Walker BD, Yu XG. 2013. Unravelling the mechanisms of durable control of HIV-1. Nat Rev Immunol 13:487–498. doi: 10.1038/nri3478. [DOI] [PubMed] [Google Scholar]
  • 4.International HIV Controllers Study, Pereyra F, Jia X, McLaren PJ, Telenti A, de Bakker PI, Walker BD, Ripke S, Brumme CJ, Pulit SL, Carrington M, Kadie CM, Carlson JM, Heckerman D, Graham RR, Plenge RM, Deeks SG, Gianniny L, Crawford G, Sullivan J, Gonzalez E, Davies L, Camargo A, Moore JM, Beattie N, Gupta S, Crenshaw A, Burtt NP, Guiducci C, Gupta N, Gao X, Qi Y, Yuki Y, Piechocka-Trocha A, Cutrell E, Rosenberg R, Moss KL, Lemay P, O'Leary J, Schaefer T, Verma P, Toth I, Block B, Baker B, Rothchild A, Lian J, Proudfoot J, Alvino DM, Vine S, Addo MM, Allen TM, Altfeld M, Henn MR, Le Gall S, Streeck H, Haas DW, Kuritzkes DR, Robbins GK, Shafer RW, Gulick RM, Shikuma CM, Haubrich R, Riddler S, Sax PE, Daar ES, Ribaudo HJ, et al. 2010. The major genetic determinants of HIV-1 control affect HLA class I peptide presentation. Science 330:1551–1557. doi: 10.1126/science.1195271. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Cartwright EK, Spicer L, Smith SA, Lee D, Fast R, Paganini S, Lawson BO, Nega M, Easley K, Schmitz JE, Bosinger SE, Paiardini M, Chahroudi A, Vanderford TH, Estes JD, Lifson JD, Derdeyn CA, Silvestri G. 2016. CD8(+) Lymphocytes Are Required for Maintaining Viral Suppression in SIV-Infected Macaques Treated with Short-Term Antiretroviral Therapy. Immunity 45:656–668. doi: 10.1016/j.immuni.2016.08.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Borducchi EN, Cabral C, Stephenson KE, Liu J, Abbink P, Ng'ang'a D, Nkolola JP, Brinkman AL, Peter L, Lee BC, Jimenez J, Jetton D, Mondesir J, Mojta S, Chandrashekar A, Molloy K, Alter G, Gerold JM, Hill AL, Lewis MG, Pau MG, Schuitemaker H, Hesselgesser J, Geleziunas R, Kim JH, Robb ML, Michael NL, Barouch DH. 2016. Ad26/MVA therapeutic vaccination with TLR7 stimulation in SIV-infected rhesus monkeys. Nature 540:284–287. doi: 10.1038/nature20583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Byrareddy SN, Arthos J, Cicala C, Villinger F, Ortiz KT, Little D, Sidell N, Kane MA, Yu J, Jones JW, Santangelo PJ, Zurla C, McKinnon LR, Arnold KB, Woody CE, Walter L, Roos C, Noll A, Van Ryk D, Jelicic K, Cimbro R, Gumber S, Reid MD, Adsay V, Amancha PK, Mayne AE, Parslow TG, Fauci AS, Ansari AA. 2016. Sustained virologic control in SIV+ macaques after antiretroviral and α4β7 antibody therapy. Science 354:197–202. doi: 10.1126/science.aag1276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Kennedy MK, Glaccum M, Brown SN, Butz EA, Viney JL, Embers M, Matsuki N, Charrier K, Sedger L, Willis CR, Brasel K, Morrissey PJ, Stocking K, Schuh JC, Joyce S, Peschon JJ. 2000. Reversible defects in natural killer and memory CD8 T cell lineages in interleukin 15-deficient mice. J Exp Med 191:771–780. doi: 10.1084/jem.191.5.771. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Lodolce J, Burkett P, Koka R, Boone D, Chien M, Chan F, Madonia M, Chai S, Ma A. 2002. Interleukin-15 and the regulation of lymphoid homeostasis. Mol Immunol 39:537–544. doi: 10.1016/S0161-5890(02)00211-0. [DOI] [PubMed] [Google Scholar]
  • 10.Jones RB, Mueller S, O'Connor R, Rimpel K, Sloan DD, Karel D, Wong HC, Jeng EK, Thomas AS, Whitney JB, Lim SY, Kovacs C, Benko E, Karandish S, Huang SH, Buzon MJ, Lichterfeld M, Irrinki A, Murry JP, Tsai A, Yu H, Geleziunas R, Trocha A, Ostrowski MA, Irvine DJ, Walker BD. 2016. A subset of latency-reversing agents expose HIV-infected resting CD4+ T-cells to recognition by cytotoxic T-lymphocytes. PLoS Pathog 12:e1005545. doi: 10.1371/journal.ppat.1005545. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Mueller YM, Petrovas C, Bojczuk PM, Dimitriou ID, Beer B, Silvera P, Villinger F, Cairns JS, Gracely EJ, Lewis MG, Katsikis PD. 2005. Interleukin-15 increases effector memory CD8+ T cells and NK cells in simian immunodeficiency virus-infected macaques. J Virol 79:4877–4885. doi: 10.1128/JVI.79.8.4877-4885.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Mueller YM, Do DH, Altork SR, Artlett CM, Gracely EJ, Katsetos CD, Legido A, Villinger F, Altman JD, Brown CR, Lewis MG, Katsikis PD. 2008. IL-15 treatment during acute simian immunodeficiency virus (SIV) infection increases viral set point and accelerates disease progression despite the induction of stronger SIV-specific CD8+ T cell responses. J Immunol 180:350–360. doi: 10.4049/jimmunol.180.1.350. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Lugli E, Mueller YM, Lewis MG, Villinger F, Katsikis PD, Roederer M. 2011. IL-15 delays suppression and fails to promote immune reconstitution in virally suppressed chronically SIV-infected macaques. Blood 118:2520–2529. doi: 10.1182/blood-2011-05-351155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Picker LJ, Reed-Inderbitzin EF, Hagen SI, Edgar JB, Hansen SG, Legasse A, Planer S, Piatak M, Lifson JD, Maino VC, Axthelm MK, Villinger F. 2006. IL-15 induces CD4 effector memory T cell production and tissue emigration in nonhuman primates. J Clin Investig 116:1514–1524. doi: 10.1172/JCI27564. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Valentin A, von Gegerfelt A, Rosati M, Miteloudis G, Alicea C, Bergamaschi C, Jalah R, Patel V, Khan AS, Draghia-Akli R, Pavlakis GN, Felber BK. 2010. Repeated DNA therapeutic vaccination of chronically SIV-infected macaques provides additional virological benefit. Vaccine 28:1962–1974. doi: 10.1016/j.vaccine.2009.10.099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Boyer JD, Robinson TM, Kutzler MA, Vansant G, Hokey DA, Kumar S, Parkinson R, Wu L, Sidhu MK, Pavlakis GN, Felber BK, Brown C, Silvera P, Lewis MG, Monforte J, Waldmann TA, Eldridge J, Weiner DB. 2007. Protection against simian/human immunodeficiency virus (SHIV) 89.6P in macaques after coimmunization with SHIV antigen and IL-15 plasmid. Proc Natl Acad Sci U S A 104:18648–18653. doi: 10.1073/pnas.0709198104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Han KP, Zhu X, Liu B, Jeng E, Kong L, Yovandich JL, Vyas VV, Marcus WD, Chavaillaz PA, Romero CA, Rhode PR, Wong HC. 2011. IL-15:IL-15 receptor alpha superagonist complex: high-level co-expression in recombinant mammalian cells, purification and characterization. Cytokine 56:804–810. doi: 10.1016/j.cyto.2011.09.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Xu W, Jones M, Liu B, Zhu X, Johnson CB, Edwards AC, Kong L, Jeng EK, Han K, Marcus WD, Rubinstein MP, Rhode PR, Wong HC. 2013. Efficacy and mechanism-of-action of a novel superagonist interleukin-15: interleukin-15 receptor αSu/Fc fusion complex in syngeneic murine models of multiple myeloma. Cancer Res 73:3075–3086. doi: 10.1158/0008-5472.CAN-12-2357. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Zhu X, Marcus WD, Xu W, Lee HI, Han K, Egan JO, Yovandich JL, Rhode PR, Wong HC. 2009. Novel human interleukin-15 agonists. J Immunol 183:3598–3607. doi: 10.4049/jimmunol.0901244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Rhode PR, Egan JO, Xu W, Hong H, Webb GM, Chen X, Liu B, Zhu X, Wen J, You L, Kong L, Edwards AC, Han K, Shi S, Alter S, Sacha JB, Jeng EK, Cai W, Wong HC. 2016. Comparison of the superagonist complex, ALT-803, to IL15 as cancer immunotherapeutics in animal models. Cancer Immunol Res 4:49–60. doi: 10.1158/2326-6066.CIR-15-0093-T. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Rosario M, Liu B, Kong L, Collins LI, Schneider SE, Chen X, Han K, Jeng EK, Rhode PR, Leong JW, Schappe T, Jewell BA, Keppel CR, Shah K, Hess B, Romee R, Piwnica-Worms DR, Cashen AF, Bartlett NL, Wong HC, Fehniger TA. 2016. The IL-15-based ALT-803 complex enhances FcγRIIIa-triggered NK cell responses and in vivo clearance of B cell lymphomas. Clin Cancer Res 22:596–608. doi: 10.1158/1078-0432.CCR-15-1419. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Gomes-Giacoia E, Miyake M, Goodison S, Sriharan A, Zhang G, You L, Egan JO, Rhode PR, Parker AS, Chai KX, Wong HC, Rosser CJ. 2014. Intravesical ALT-803 and BCG treatment reduces tumor burden in a carcinogen induced bladder cancer rat model; a role for cytokine production and NK cell expansion. PLoS One 9:e96705. doi: 10.1371/journal.pone.0096705. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Mathios D, Park CK, Marcus WD, Alter S, Rhode PR, Jeng EK, Wong HC, Pardoll DM, Lim M. 2016. Therapeutic administration of IL-15 superagonist complex ALT-803 leads to long-term survival and durable antitumor immune response in a murine glioblastoma model. Int J Cancer 138:187–194. doi: 10.1002/ijc.29686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Martins MA, Tully DC, Cruz MA, Power KA, Veloso de Santana MG, Bean DJ, Ogilvie CB, Gadgil R, Lima NS, Magnani DM, Ejima K, Allison DB, Piatak M, Altman JD, Parks CL, Rakasz EG, Capuano S, Galler R, Bonaldo MC, Lifson JD, Allen TM, Watkins DI. 2015. Vaccine-induced simian immunodeficiency virus-specific CD8+ T-cell responses focused on a single Nef epitope select for escape variants shortly after infection. J Virol 89:10802–10820. doi: 10.1128/JVI.01440-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Lugli E, Goldman CK, Perera LP, Smedley J, Pung R, Yovandich JL, Creekmore SP, Waldmann TA, Roederer M. 2010. Transient and persistent effects of IL-15 on lymphocyte homeostasis in nonhuman primates. Blood 116:3238–3248. doi: 10.1182/blood-2010-03-275438. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Bostik P, Takahashi Y, Mayne AE, Ansari AA. 2010. Innate immune natural killer cells and their role in HIV and SIV infection. HIV Ther 4:483–504. doi: 10.2217/hiv.10.28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Gauduin MC, Glickman RL, Means R, Johnson RP. 1998. Inhibition of simian immunodeficiency virus (SIV) replication by CD8(+) T lymphocytes from macaques immunized with live attenuated SIV. J Virol 72:6315–6324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Schmitz JE, Kuroda MJ, Santra S, Sasseville VG, Simon MA, Lifton MA, Racz P, Tenner-Racz K, Dalesandro M, Scallon BJ, Ghrayeb J, Forman MA, Montefiori DC, Rieber EP, Letvin NL, Reimann KA. 1999. Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science 283:857–860. doi: 10.1126/science.283.5403.857. [DOI] [PubMed] [Google Scholar]
  • 29.Loffredo JT, Bean AT, Beal DR, León EJ, May GE, Piaskowski SM, Furlott JR, Reed J, Musani SK, Rakasz EG, Friedrich TC, Wilson NA, Allison DB, Watkins DI. 2008. Patterns of CD8+ immunodominance may influence the ability of Mamu-B*08-positive macaques to naturally control simian immunodeficiency virus SIVmac239 replication. J Virol 82:1723–1738. doi: 10.1128/JVI.02084-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Loffredo JT, Maxwell J, Qi Y, Glidden CE, Borchardt GJ, Soma T, Bean AT, Beal DR, Wilson NA, Rehrauer WM, Lifson JD, Carrington M, Watkins DI. 2007. Mamu-B*08-positive macaques control simian immunodeficiency virus replication. J Virol 81:8827–8832. doi: 10.1128/JVI.00895-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Loffredo JT, Friedrich TC, León EJ, Stephany JJ, Rodrigues DS, Spencer SP, Bean AT, Beal DR, Burwitz BJ, Rudersdorf RA, Wallace LT, Piaskowski SM, May GE, Sidney J, Gostick E, Wilson NA, Price DA, Kallas EG, Piontkivska H, Hughes AL, Sette A, Watkins DI. 2007. CD8+ T cells from SIV elite controller macaques recognize Mamu-B*08-bound epitopes and select for widespread viral variation. PLoS One 2:e1152. doi: 10.1371/journal.pone.0001152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Allen TM, Sidney J, del Guercio MF, Glickman RL, Lensmeyer GL, Wiebe DA, DeMars R, Pauza CD, Johnson RP, Sette A, Watkins DI. 1998. Characterization of the peptide binding motif of a rhesus MHC class I molecule (Mamu-A*01) that binds an immunodominant CTL epitope from simian immunodeficiency virus. J Immunol 160:6062–6071. [PubMed] [Google Scholar]
  • 33.Allen TM, Mothé BR, Sidney J, Jing P, Dzuris JL, Liebl ME, Vogel TU, O'Connor DH, Wang X, Wussow MC, Thomson JA, Altman JD, Watkins DI, Sette A. 2001. CD8(+) lymphocytes from simian immunodeficiency virus-infected rhesus macaques recognize 14 different epitopes bound by the major histocompatibility complex class I molecule mamu-A*01: implications for vaccine design and testing. J Virol 75:738–749. doi: 10.1128/JVI.75.2.738-749.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Weisgrau KL, Ries M, Pomplun N, Evans DT, Rakasz EG. 2016. OMIP-035: functional analysis of natural killer cell subsets in macaques. Cytometry A 89:799–802. doi: 10.1002/cyto.a.22932. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Bono MR, Fernández D, Flores-Santibáñez F, Rosemblatt M, Sauma D. 2015. CD73 and CD39 ectonucleotidases in T cell differentiation: beyond immunosuppression. FEBS Lett 589:3454–3460. doi: 10.1016/j.febslet.2015.07.027. [DOI] [PubMed] [Google Scholar]
  • 36.Nigam P, Velu V, Kannanganat S, Chennareddi L, Kwa S, Siddiqui M, Amara RR. 2010. Expansion of FOXP3+ CD8 T cells with suppressive potential in colorectal mucosa following a pathogenic simian immunodeficiency virus infection correlates with diminished antiviral T cell response and viral control. J Immunol 184:1690–1701. doi: 10.4049/jimmunol.0902955. [DOI] [PubMed] [Google Scholar]
  • 37.Nikolova M, Carriere M, Jenabian MA, Limou S, Younas M, Kök A, Huë S, Seddiki N, Hulin A, Delaneau O, Schuitemaker H, Herbeck JT, Mullins JI, Muhtarova M, Bensussan A, Zagury JF, Lelievre JD, Lévy Y. 2011. CD39/adenosine pathway is involved in AIDS progression. PLoS Pathog 7:e1002110. doi: 10.1371/journal.ppat.1002110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Bai A, Moss A, Rothweiler S, Longhi MS, Wu Y, Junger WG, Robson SC. 2015. NADH oxidase-dependent CD39 expression by CD8(+) T cells modulates interferon gamma responses via generation of adenosine. Nat Commun 6:8819. doi: 10.1038/ncomms9819. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Gupta PK, Godec J, Wolski D, Adland E, Yates K, Pauken KE, Cosgrove C, Ledderose C, Junger WG, Robson SC, Wherry EJ, Alter G, Goulder PJ, Klenerman P, Sharpe AH, Lauer GM, Haining WN. 2015. CD39 Expression identifies terminally exhausted CD8+ T cells. PLoS Pathog 11:e1005177. doi: 10.1371/journal.ppat.1005177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Hong JJ, Amancha PK, Rogers K, Ansari AA, Villinger F. 2013. Re-evaluation of PD-1 expression by T cells as a marker for immune exhaustion during SIV infection. PLoS One 8:e60186. doi: 10.1371/journal.pone.0060186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Veiga-Parga T, Sehrawat S, Rouse BT. 2013. Role of regulatory T cells during virus infection. Immunol Rev 255:182–196. doi: 10.1111/imr.12085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Boer MC, van Meijgaarden KE, Bastid J, Ottenhoff TH, Joosten SA. 2013. CD39 is involved in mediating suppression by Mycobacterium bovis BCG-activated human CD8(+) CD39(+) regulatory T cells. Eur J Immunol 43:1925–1932. doi: 10.1002/eji.201243286. [DOI] [PubMed] [Google Scholar]
  • 43.Nishimura H, Honjo T. 2001. PD-1: an inhibitory immunoreceptor involved in peripheral tolerance. Trends Immunol 22:265–268. doi: 10.1016/S1471-4906(01)01888-9. [DOI] [PubMed] [Google Scholar]
  • 44.Miller JS, Cooley S, Holtan S, Arora M, Ustun C, Jeng E, Wong HC, Verneris MR, Wagner JE, Weisdorf DJ, Blazar BR, Fehniger TA, Romee R. 2015. “First-in-human” phase I dose escalation trial of IL-15N72D/IL-15Rα-Fc superagonist complex (ALT-803) demonstrates immune activation with anti-tumor activity in patients with relapsed hematological malignancy. Blood 126:1957. doi: 10.1182/blood-2015-02-625574. [DOI] [Google Scholar]
  • 45.Mudd PA, Ericsen AJ, Burwitz BJ, Wilson NA, O'Connor DH, Hughes AL, Watkins DI. 2012. Escape from CD8(+) T cell responses in Mamu-B*00801(+) macaques differentiates progressors from elite controllers. J Immunol 188:3364–3370. doi: 10.4049/jimmunol.1102470. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Valentine LE, Loffredo JT, Bean AT, León EJ, MacNair CE, Beal DR, Piaskowski SM, Klimentidis YC, Lank SM, Wiseman RW, Weinfurter JT, May GE, Rakasz EG, Wilson NA, Friedrich TC, O'Connor DH, Allison DB, Watkins DI. 2009. Infection with “escaped” virus variants impairs control of simian immunodeficiency virus SIVmac239 replication in Mamu-B*08-positive macaques. J Virol 83:11514–11527. doi: 10.1128/JVI.01298-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Bergamaschi C, Kulkarni V, Rosati M, Alicea C, Jalah R, Chen S, Bear J, Sardesai NY, Valentin A, Felber BK, Pavlakis GN. 2015. Intramuscular delivery of heterodimeric IL-15 DNA in macaques produces systemic levels of bioactive cytokine inducing proliferation of NK and T cells. Gene Ther 22:76–86. doi: 10.1038/gt.2014.84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Halwani R, Boyer JD, Yassine-Diab B, Haddad EK, Robinson TM, Kumar S, Parkinson R, Wu L, Sidhu MK, Phillipson-Weiner R, Pavlakis GN, Felber BK, Lewis MG, Shen A, Siliciano RF, Weiner DB, Sekaly RP. 2008. Therapeutic vaccination with simian immunodeficiency virus (SIV)-DNA + IL-12 or IL-15 induces distinct CD8 memory subsets in SIV-infected macaques. J Immunol 180:7969–7979. doi: 10.4049/jimmunol.180.12.7969. [DOI] [PubMed] [Google Scholar]
  • 49.Stoklasek TA, Schluns KS, Lefrançois L. 2006. Combined IL-15/IL-15Ralpha immunotherapy maximizes IL-15 activity in vivo. J Immunol 177:6072–6080. doi: 10.4049/jimmunol.177.9.6072. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Rubinstein MP, Kovar M, Purton JF, Cho JH, Boyman O, Surh CD, Sprent J. 2006. Converting IL-15 to a superagonist by binding to soluble IL-15Rα. Proc Natl Acad Sci U S A 103:9166–9171. doi: 10.1073/pnas.0600240103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Kaizu M, Borchardt GJ, Glidden CE, Fisk DL, Loffredo JT, Watkins DI, Rehrauer WM. 2007. Molecular typing of major histocompatibility complex class I alleles in the Indian rhesus macaque which restrict SIV CD8+ T cell epitopes. Immunogenetics 59:693–703. doi: 10.1007/s00251-007-0233-7. [DOI] [PubMed] [Google Scholar]
  • 52.Pomplun N, Weisgrau KL, Evans DT, Rakasz EG. 2015. OMIP-028: activation panel for rhesus macaque NK cell subsets. Cytometry A 87:890–893. doi: 10.1002/cyto.a.22727. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Kutscher S, Dembek CJ, Deckert S, Russo C, Körber N, Bogner JR, Geisler F, Umgelter A, Neuenhahn M, Albrecht J, Cosma A, Protzer U, Bauer T. 2013. Overnight resting of PBMC changes functional signatures of antigen specific T-cell responses: impact for immune monitoring within clinical trials. PLoS One 8:e76215. doi: 10.1371/journal.pone.0076215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Kaveh DA, Whelan AO, Hogarth PJ. 2012. The duration of antigen-stimulation significantly alters the diversity of multifunctional CD4 T cells measured by intracellular cytokine staining. PLoS One 7:e38926. doi: 10.1371/journal.pone.0038926. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Pearl R. 1940. Introduction to medical biometry and statistics. W. B. Saunders Co., Philadelphia, PA. [Google Scholar]
  • 56.O'Connor SL, Lhost JJ, Becker EA, Detmer AM, Johnson RC, Macnair CE, Wiseman RW, Karl JA, Greene JM, Burwitz BJ, Bimber BN, Lank SM, Tuscher JJ, Mee ET, Rose NJ, Desrosiers RC, Hughes AL, Friedrich TC, Carrington M, O'Connor DH. 2010. MHC heterozygote advantage in simian immunodeficiency virus-infected Mauritian cynomolgus macaques. Sci Transl Med 2:22ra18. doi: 10.1126/scitranslmed.3000524. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Cline AN, Bess JW, Piatak M, Lifson JD. 2005. Highly sensitive SIV plasma viral load assay: practical considerations, realistic performance expectations, and application to reverse engineering of vaccines for AIDS. J Med Primatol 34:303–312. doi: 10.1111/j.1600-0684.2005.00128.x. [DOI] [PubMed] [Google Scholar]
  • 58.Harris M, Burns CM, Becker EA, Braasch AT, Gostick E, Johnson RC, Broman KW, Price DA, Friedrich TC, O'Connor SL. 2013. Acute-phase CD8 T cell responses that select for escape variants are needed to control live attenuated simian immunodeficiency virus. J Virol 87:9353–9364. doi: 10.1128/JVI.00909-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Quick J, Grubaugh ND, Pullan ST, Claro IM, Smith AD, Gangavarapu K, Oliveira G, Robles-Sikisaka R, Rogers TF, Beutler NA, Burton DR, Lewis-Ximenez LL, de Jesus JG, Giovanetti M, Hill SC, Black A, Bedford T, Carroll MW, Nunes M, Alcantara LC, Sabino EC, Baylis SA, Faria NR, Loose M, Simpson JT, Pybus OG, Andersen KG, Loman NJ. 2017. Multiplex PCR method for MinION and Illumina sequencing of Zika and other virus genomes directly from clinical samples. Nat Protoc 12:1261–1276. doi: 10.1038/nprot.2017.066. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES