Abstract
Wheat flours are used to produce bread, pasta, breakfast cereals, and biscuits; the various properties of these end-products are attributed to the gluten content, produced as seed storage proteins in the wheat endosperm. Thus, genes encoding gluten protein are major targets of wheat breeders aiming to improve the various properties of wheat flour. Here, we describe a novel compensating wheat–Thinopyrum elongatum Robertsonian translocation (T1AS.1EL) line involving the short arm of wheat chromosome 1A (1AS) and the long arm of Th. elongatum chromosome 1E (1EL); we developed this line through centric breakage-fusion. Compared to the common wheat cultivars Chinese Spring and Norin 61, we detected two additional 1EL-derived high-molecular-weight glutenin subunits (HMW-GSs) in the T1AS.1EL plants. Based on the results of an SDS-sedimentation volume to estimate the gluten strength of T1AS.1EL-derived flour, we predict that T1AS.1EL-derived flour is better suited to bread-making than Chinese Spring- and Norin 61-derived flour and that this is because of its greater gluten diversity. Also, we were able to assign 33 of 121 wheat PCR-based Landmark Unique Gene markers to chromosome 1E of Th. elongatum. These markers can now be used for further chromosome engineering of the Th. elongatum segment of T1AS.1EL.
Keywords: Triticum aestivum, Thinopyrum elongatum, Robertsonian translocation, bread-making quality, wheat PLUG markers
Introduction
There is little genetic diversity in many major crop species. Such narrow genetic diversity is attributed to domestication, with a subsequent bottlenecking of originally large and diverse populations (Reif et al. 2005, Tanksley and McCouch 1997). Common wheat (Triticum aestivum L., 2n = 6x = 42, AABBDD) is an allohexaploid that evolved through natural hybridization and allopolyploid speciation. The number of independent hybridization events between the progenitors of common wheat is unclear, but it is considered limited (Dvořák et al. 1998, Talbert et al. 1998) and presumably results in a loss of diversity.
Wheat flour produces visco-elastic dough when mixed with water. The elasticity of the dough influences the processing quality of wheat flour end-products, such as bread, noodles, and cookies. Wheat flours derived from different wheat varieties often have distinct properties, and this can be attributed to their diversity of gluten. Gluten is composed of seed storage proteins (SSPs), glutenins and gliadins, which are stored in the wheat endosperm. High-molecular-weight glutenin subunits (HMW-GSs) are the major determinants of gluten elasticity; thus, HMW-GSs are important for the bread-making process (Tatham et al. 1985). Although HMW-GSs account for only about 10% of the total SSPs in mature seeds, multiple correlation coefficients have indicated that almost 80% of the variation in the Alveograph w value (a combined measure of dough strength and extensibility) can be accounted for by variations in flour HMW-GS composition and protein content (Payne et al. 1988). Thus, expanding gluten diversity is likely to facilitate a greater variety of wheat flour end-products.
HMW-GSs in wheat are encoded by the Glu-A1, Glu-B1, and Glu-D1 genes (at complex loci on the long arms of the homoeologous group-1 chromosomes 1A, 1B, and 1D respectively) (Galili and Feldman 1985, Lawrence and Shepherd 1980, Payne et al. 1980, 1981, 1982). The structural features of HMW-GSs differ between common wheat and its wild relatives. The diploid wheatgrass Thinopyrum elongatum (Host) D. R. Dewey [=Agropyron elongatum (Host) P. Beauv.] (2n = 2x = 14, EE genome) is a wild relative of wheat with many agronomic characters superior to those in domesticate wheat, including biotic and abiotic stress resistance (Dvořák et al. 1988, Friebe et al. 1994, Jauhar and Peterson 2000, Ma et al. 1999, Roundy 1985) and superior flour quality (Feng et al. 2004). Work from our group has demonstrated that, among seven disomic addition lines (DALs) of wheat, each containing a homoeologous group-1 chromosome of various wild relatives, the presence of the chromosome 1E from Th. elongatum results in the strongest dough (Garg et al. 2009b). Thus, this DAL (which contains the Th. elongatum chromosome 1E) might produce wheat flour that is better suited to downstream applications, particularly bread-making.
Dvořák et al. (1986) reported that the SSP genes of the E-genome are similar to wheat SSP genes and are located on the same chromosomes (mainly homoeologous group-1 chromosomes) as those in Triticum species. Homoeologous group-1 chromosomes also contain major clusters of agronomically important genes (McIntosh et al. 2003), including glutenins and gliadins. Therefore, homoeologous group-1 chromosomes of modern wheat cultivars contain a large number of superior genes that have been collected during evolution, in breeding programs, or both, whereas the chromosomes of wheat wild relatives carry genes associated with various agronomically undesirable traits, which should be reduced in breeding programs.
Here, we first identified HMW-GSs of the Th. elongatum chromosome 1E within a wheat genetic background. Next, we produced a compensating wheat–Th. elongatum Robertsonian (centric) translocation (T1AS.1EL) line carrying the HMW-GSs of the long arm of the Th. elongatum chromosome 1E (1EL). In small-scale tests, we evaluated the quality of T1AS.1EL-derived wheat flour. Also, to confirm the presence of 1EL in the wheat genetic background, we used the wheat PCR-based Landmark Unique Gene (PLUG) markers reported by Ishikawa et al. (2007) to develop Th. elongatum chromosome 1E-specific PCR-based markers.
Materials and Methods
Plant materials
We used the common wheat cultivar Chinese Spring (CS, 2n = 42 = 21″, genome AABBDD); Japanese commercial common wheat cultivar Norin 61 (N61, 2n = 42 = 21″, AABBDD); diploid wheatgrass Th. elongatum (2n = 14 = 7″, EE); a nullisomic-1A tetrasomic-1D line of CS (N1AT1D, 2n = 42 = 19″ + 1iv, AABBDD-1A1A + 1D1D) (Sears 1966); the chromosome 1E disomic addition line of Th. elongatum in the CS genetic background (CSDAL1E, 2n = 44 = 22″, AABBDD + 1E1E) (Dvořák and Knott 1974); and a disomic substitution line of chromosome 1E for chromosome 1D of CS [CSDSL1E(1D), 2n = 42 = 21″, AABBDD-1D1D + 1E1E] (Garg et al. 2009a). CSDAL1E was maintained at Kyoto University and Tottori University as part of the National BioResource Project-Wheat (NBRP ID: TACBOW0038).
HMW-GS composition analysis
At first, the HMW-GS composition of the tested wheat varieties was determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), according to Tanaka et al. (2003). The separation of molecules within a gel is determined by the relative size of the pores formed within the gel. The pore size of a gel is determined by two factors, the total amount of acrylamide present (designated as %T) and the amount of N N′ bisacrylamide, cross-linker (%C). As the total amount of acrylamide increases, the pore size decreases. With cross-linking, 5%C gives the smallest pore size. Any increase or decrease in %C increases the pore size. The decrease of %C is generally known to differentiate among similar band patterns based on the molecular structures. Thus, following the method of Smith and Payne (1984), we increased the total acrylamide content (%T) of the polyacrylamide gel from 10% to 18% and decreased the N N′ bisacrylamide cross-linker (%C) content from 3.3% to 0.46%.
Chromosome analysis
Mitotic chromosomes were prepared from root tip cells by using the acetocarmine squash method and used for genomic in situ hybridization (GISH). Chromosomes were probed with Th. elongatum genomic DNA labeled with fluorescein-12-dUTP (Roche Diagnostics, Mannheim, Germany) by using the nick translation method, according to Ishii et al. (2010).
Evaluation of grain quality
To evaluate the grain quality of T1AS.1EL plants, 5 g of seeds from each plant were ground in a UDY cyclone sample mill (UDY Corp., Fort Collins, CO, USA) fitted with 1-mm screens. The protein content of the ground seeds was then measured by near-infrared spectroscopy (Kett, model KJT-270, NIR composition analyzer). The SDS sedimentation volume (SDS-SV), which is highly correlated with the bread loaf volume, is a reflection of gluten quantity and quality (Axford et al. 1979); we measured SDS-SV in 1 g of flour, according to the method of Takata et al. (1999). For an index of gluten quality, specific sedimentation values (SSVs) were calculated by dividing the SDS-SV by the percentage of protein content, because the protein content of wheat is reported to be highly correlated with the SDS-SV (Moonen et al. 1982). Previously, we also studied the relationship between the protein content and the SDS-SV (Tanaka and Tsujimoto 2012). The coefficient of correlation (R = 0.9989; P < 0.01) showed a significant positive correlation between the protein content and SDS-SV. Thus, the SSV can be a substantially constant value within the same wheat variety.
Selection of the 1EL-specific PLUG markers
To detect chromosome 1E, we used 121 wheat PLUG markers located on various bins of chromosomes 1A, 1B, and 1D, and include the 64 multilocal markers described by Ishikawa et al. (2007). The total number of marker locations was 219 (74 on chromosome 1A, 68 on 1B, and 77 on 1D) (Supplemental Table 1).
PCR amplification of the wheat PLUG markers was performed using TaKaRa Ex Taq® DNA polymerase (0.5 U, Takara Bio Inc., Japan) in 25 μl of reaction buffer containing 1.5 mM MgCl2 (Takara Bio Inc., Japan), 50–100 ng of genomic DNA, 200 μM of each dNTP, and 10 pmol of each primer. The PCR conditions were 95°C for 5 min; followed by 32 cycles of 95°C for 30 s, 58°C for 30 s, and 72°C for 2 min; with a final extension time of 7 min at 72°C. PCRs were performed using a C1000TM Thermal Cycler (Bio-Rad). An 8-μl aliquot of the PCR mixture was separated by agarose gel (1% [w/v]) electrophoresis. For PCR-restriction fragment length polymorphism (PCR-RFLP) analysis, an 8-μl aliquot of the product was digested overnight with 1 U of DpnII, HaeIII, or RsaI at 37°C or TaqI at 65°C. Digested fragments were separated by agarose gel (4% [w/v]) electrophoresis. Agarose gels were stained with ethidium bromide and visualized under UV light.
Results
Production and identification of a wheat–Th. elongatum Robertsonian translocation line
Centric fission of univalents in meiosis, followed by subsequent fusions, frequently produce centric translocations that have the breakpoint at the centromere. Such chromosome aberrations are referred to as Robertsonian translocations. Robertsonian translocations that involve the long arm and short arm (e.g., T1AS.1BL and T1BS.1AL) genetically compensate the function of the group-1 chromosome, whereas Robertsonian translocations that involve T1AS.1BS and T1AL.1BL are genetically abnormal.
Fig. 1 shows the crossing scheme used to produce the T1AS.1EL line. To induce a Robertsonian translocation consisting of 1EL and the short arm of wheat chromosome 1A (1AS), we first crossed CSDSL1E(1D) with N1AT1D. The resulting F1 plants were monosomic for wheat chromosome 1A, as well as for the Th. elongatum chromosome 1E (2n = 42 = 20″ + 2′, AABBDD-1A + 1E). We then crossed this plant with N61, where we would expect the appearance of the compensate Robertsonian translocation chromosome T1AS.1EL in the progeny. In the resulting hybrids, we used protein composition analysis to detect the HMW-GSs encoded on the long arm and the absence of gliadins encoded on the short arm from Th. elongatum chromosome 1E (Garg et al. 2009a). We obtained self-pollinated seeds from candidate T1AS.1EL plants and twice backcrossed these with N61.
Fig. 1.
Crossing scheme for producing the T1AS.1EL line. The wheat varieties used or generated here are as follows: CSDSL1E(1D), a disomic substitution line of Th. elongatum chromosome 1E for wheat chromosome 1D of Chinese Spring (Garg et al. 2009a); N1AT1D, a nullisomic-1A tetrasomic-1D line of Chinese Spring (Sears 1966); N61, Norin 61; and T1AS.1EL, Robertsonian translocation plants with the chromosome consisting of the long arm of Th. elongatum chromosome 1E and the short arm of wheat chromosome 1A. T1AS.1EL plants were selected by using protein composition and chromosome analyses.
Identification of HMW-GSs from Th. elongatum and confirmation of Robertsonian translocation
In an initial SDS-PAGE analysis, following the method of Tanaka et al. (2003), we detected one addition of an HMW-GS band (above the 1By8 subunit) from CSDAL1E that is found in neither CS nor N61 (Fig. 2A). However, because one HMW-GS locus generally include two tightly linked genes (expressing x- and y-types) on the long arm of group-1 chromosome, we performed further analyses to better discriminate HMW-GSs. Following the method of Smith and Payne (1984), we successfully resolved two additional HMW-GS bands not found in either CS or N61, one slow-moving x-type band below the 1Bx7 subunit and one fast-moving y-type within the ω-gliadin fraction (Fig. 2B). Hereafter, we refer to these bands as 1Ex and 1Ey from Glu-E1 locus, respectively. The remaining HMW-GS bands of the CSDAL1E plants were the same as those of the CS genetic background.
Fig. 2.
SDS-PAGE reveals improved protein profiles of HMW-GSs from Thinopyrum elongatum. The plants tested were: CS, Chinese Spring; N61, Norin 61; and CSDAL1E, a homoeologous group-1 disomic addition line of Th. elongatum in CS background. The open arrowheads indicate HMW-GSs from CS or N61. The subunit numbers of HMW-GSs are also indicated adjacent the open arrowheads. The closed arrowheads indicate HMW-GS from Th. elongatum. The x- and y-type subunit of Th. elongatum are referred to as 1Ex and 1Ey, respectively. The gels used for SDS-PAGE consisted of 10% acrylamide and 3.3% N N′ bisacrylamide (a) or 18% acrylamide and 0.46% N N′ bisacrylamide (b).
By SDS-PAGE of F2, BC1F1, and BC2F1 extracts, we demonstrated that the 1Ex and 1Ey HMW-GSs are completely linked (Fig. 3). How the F2, BC1F1 and BC2F1 extracts segregated for the presence and absence of the 1EL-derived HMW-GSs is shown in Table 1. Among the tested F2 plants, 22 of 40 (55%) carried the 1EL-derived HMW-GSs (Table 1, Fig. 4), which better fits a 1:1 than 3:1 ratio for the presence or absence of the 1EL-derived HMW-GSs. Furthermore, almost all tested F2 plants (37 of 40, 93%) carried the 1Ax2* subunit from the long arm of wheat chromosome 1A (1AL) (Fig. 4). These data suggest that, during fertilization, the chromosome T1AS.1EL is more difficult to transmit from pollen to the egg cell than is wheat chromosome 1A.
Fig. 3.
SDS-PAGE profile of seed storage proteins from BC2F1 plants. The lanes of the polyacrylamide gels were loaded with: M, Precision Plus Protein™ Standards (Bio-Rad Laboratories, Inc., USA) or extracts of CS (Chinese Spring), N61 (Norin 61), or CSDAL1E (a homoeologous group-1 disomic addition line of Th. elongatum in CS background). The two subunits from the long arm of Th. elongatum chromosome 1E are referred to as 1Ex and 1Ey. The gels used for SDS-PAGE consisted of 18% acrylamide and 0.46% N N′ bisacrylamide.
Table 1.
The segregation ratios of HMW-GSs from the 1EL in each generation
| Generation | HMW-GSs from the 1EL | Expected ratio Presence:Absence |
χ2 | P | ||
|---|---|---|---|---|---|---|
| Number of presence | Number of absence | Total | ||||
| F2 | 22 | 18 | 40 | 3:1 | 3.52 | 0.06 |
| 1:1 | 0.20 | 0.65 | ||||
| BC1F1 | 15 | 21 | 36 | 1:1 | 0.50 | 0.48 |
| BC2F1 | 39 | 33 | 72 | 1:1 | 0.25 | 0.62 |
Fig. 4.
SDS-PAGE profile of seed storage proteins in F2 plants. The lanes of the polyacrylamide gels were loaded with: extracts of CS (Chinese Spring), N61 (Norin 61), or CSDAL1E (a homoeologous group-1 disomic addition line of Th. elongatum in CS background). The open arrowheads indicate HMW-GS 2* from N61. The closed arrowheads indicate HMW-GS 1Ex from Th. elongatum. The gels used for SDS-PAGE consisted of 10% acrylamide and 3.3% N N′ bisacrylamide.
Among the tested BC1F1 plants, 15 of 36 (42%) carried the 1EL-derived HMW-GSs. Among the tested BC2F1 plants 39 of 72 (54%) carried the 1EL-derived HMW-GSs. Each of these segregation ratios fit a 1:1 ratio, suggesting that the HMW-GS encoding 1EL genes translocate to 1AS and are stably transmitted to the next generation during backcrossing to the recurrent parent, N61.
To confirm the translocation of 1EL to 1AS, those BC1F1 and BC2F1 plants from which we detected the 1EL-derived HMW-GSs were selected for genomic in situ hybridization (GISH) analysis: all of these selected plants carried the chromosome 1EL and had undergone the wheat–Th. elongatum Robertsonian translocation (Fig. 5).
Fig. 5.
Cytological analysis of the Robertsonian translocation plants. Genomic in situ hybridization performed using genomic DNA of Thinopyrum elongatum (green), indicated the presence of the Th. elongatum chromosome in the Robertsonian translocation plants. One wheat–Th. elongatum Robertsonian translocated chromosome is shown within the rectangle. DNA was counterstained with DAPI (blue). Scale bar = 10 μm.
Evaluation of flour quality of wheat with HMW-GSs from the 1EL
Next, we evaluated the flour quality of the BC1F1 plants and their parents, because BC1F1 carrying the chromosome T1AS.1EL is the earliest generation close to the genetic background of N61 (Fig. 6). If we develop and use a near-isogenic line and/or a recombinant inbred line in the future, we can evaluate the flour quality in detail. In this study, we detected a high SSV by 1Ex and 1Ey HMW-GSs even in this early generation as follows. The mean SSV of CSDAL1E plants (carrying the 1EL-derived HMW-GSs) was significantly higher than that of CS (which lacks those HMW-GSs). These findings are consistent with previous work done by our group (Garg et al. 2009a). The CS/N61 plants are equivalent to T1AS.1EL but without 1EL. When comparing the SSVs of wheat flour from the T1AS.1EL (BC1F1) and CS/N61 plants, we detected a higher SSV for the T1AS.1EL (BC1F1) plants. In next growth season of wheat, we also confirmed a high SSV (mL/%) = 1.24 ± 0.0083 [protein content (%) = 8.04 ± 0.15] for the T1AS.1EL (BC1F2) plants, whose HMW-GSs composition were 1Ex + 1Ey, 7 + 8 and 2.2 + 12 from Glu-E1, Glu-B1 and Glu-D1 loci, respectively.
Fig. 6.
The specific sedimentation values of plants with or without the HMW-GSs from Th. elongatum. The plants tested were: CS, Chinese Spring; N61, Norin 61; CSDAL1E, a homoeologous group-1 disomic addition line of Th. elongatum in CS background; TAS1.1EL, Robertsonian translocation plants (BC1F1) with the long arm of Th. elongatum chromosome 1E (1EL) in the CS and N61 background; and CS/N61, BC1F1 plants lacking 1EL in the CS and N61 background. Whiskers show standard deviation. Asterisks indicate a significant difference (p < 0.05). PC indicates the mean value of the protein content and SDS-SV is the mean value of the SDS sedimentation volume. SSV is the mean value of the specific sedimentation value, and SD is the standard deviation (whiskers).
Selection and assignment of wheat PLUG markers to the chromosome 1E of Th. elongatum
In the PCR products of eight (3.7%) of the 219 marker locations, we detected band(s) specific for CSDAL1E. In the PCR products of two that was not identified the marker locations, we also detected band(s) specific for CSDAL1E. By PCR-RFLP analysis, we identified 49 (22.4%) additional marker locations displaying polymorphism between the common wheat cultivars (CS and N61) and CSDAL1E: 14, 7, 17 and 12 by DpnII, HaeIII, RsaI, and TaqI digestion, respectively, including one by either HaeIII or TaqI digestion. Thus, we identified 33 (of 121) PLUG markers (at 57 of 219 marker locations, and at two that was not identified the marker locations) that can be used as specific markers for Th. elongatum chromosome 1E (Table 2, Supplemental Table 1). Seventeen of the 74 marker locations (23.0%) are derived from wheat chromosome 1A, 21 of 68 (30.9%) from wheat chromosome 1B, and 19 of 77 (24.7%) from wheat chromosome 1D (Fig. 7, Supplemental Table 1). Furthermore, we assigned each of the 33 PLUG markers to either the short arm of Th. elongatum chromosome 1E (1ES) or 1EL by using the T1AS.1EL disomic plant, which was obtained from the F2 generation (Fig. 1, Table 2, Supplemental Table 1). When a specific PCR product or unique restriction pattern of a PLUG marker was detected in the T1AS.1EL disomic plant, the PLUG marker was assigned to 1EL, whereas, when a specific PCR product or unique restriction pattern was absent from the T1AS.1EL disomic plant, the PLUG marker was assigned to 1ES (Fig. 8). This resulted in 20 of 33 PLUG markers being assigned to 1EL. Nineteen of 20 PLUG markers were also localized to the long arm of wheat group-1 chromosomes.
Table 2.
Assignment of the wheat homoeologous group-1 PLUG markers to Th. elongatum chromosome 1E
| Marker namea | PCR Primer | Detectiona | Approximate size (bp) of Th. elongatum chromosome 1E-specific band(s) | Chromosome arm assigned | |
|---|---|---|---|---|---|
|
| |||||
| Forward | Reverse | ||||
| TNAC1009 | CGAACGTGACCATCTACATCA | CATCTGACTTGGTCTTGGCATA | H | 350, 500, 900 | 1ES |
| TNAC1010 | GATGCAACTGCAGGAATGAAG | TCTCTTCTGAAGCGGTCATGT | T | 500 | 1ES |
| TNAC1035 | TGCACTGGGATCTAACCTAAA | TCCAGTGATCATTTGAAGATTCC | T | 750 | 1EL |
| TNAC1041 | TCACCACCTCTTTCAGTTGCT | GCATCAAGGATGAGGAGTCTG | H or T | 230, 250 or 600, 700 | 1EL |
| TNAC1048 | ACTGAGGTAGAATCGCCACTG | GCCGCTATCGTCTGGTACAT | H | 230, 500 | 1EL |
| TNAC1063 | AGCCATTCACAGCTCTTCTTG | AATATGCTTCCTGGAGTCACG | T | 600 | 1ES |
| TNAC1076 | GGGAGACGATCCTCTTATGATCT | TGCGTGCTTCCTAACTTACCA | T | 800 | 1EL |
| TNAC1085 | CCAGGCCACATGATAACATTC | TCATGGTATTCTGCTCCTCCA | ND | 900 | 1EL |
| TNAC1088 | GGAATCCTTCCTTGTTGAAGA | AACCTCCGAGTGAAACACAAA | H | 500 | 1EL |
| TNAC4240 | ATGCCAGTGACAGTGTGTGC | CCACATTGATGGATTCCTTTG | D | 450, 500 | 1ES |
| TNAC4242 | GGACTGGCAGGAACAAGAAG | CAGGTGGGGCACTTCCTC | R | 180, 300 | 1ES |
| TNAC4272 | ACCAAGGCATTCAAGAAGGA | GGTGTTCCCTGGTGTTGACT | R | 500 | 1ES |
| TNAC4275 | CTTCGGCCGCTTCTTCTT | ACGATCACCAGGTTGGTCTC | D | 50 | 1ES |
| TNAC4289 | TGATGGGCAAGTATGGTGAA | AACATAACGGGCAAATGGAA | R | 250, 300 | 1ES |
| TNAC4291 | CTCACGTTCAAGACTCACATGAT | GCAGAGCTTCATTATACTGTCCA | D | 330, 400 | 1ES |
| TNAC4292 | TGAGGTGCTTGCTTTCAAGA | AAGTGCCATCAGCTTTTGCT | R | 480 | 1ES |
| TNAC4293 | GTCCGGCTGTTCAAGATGAT | AGCCAGTTCAGCTTCCTCAT | D | 600, 700, 800 | 1ES |
| TNAC4349 | GGCAAATGTTATGGCTGCAT | ACAGGGAACTGAATGGCAAC | R | 450 | 1EL |
| TNAC4374 | CCATTCACCATGGTCTTTCC | TTCAGCAGCTCATCGACTTC | R | 250 | 1EL |
| TNAC4375 | GGCAGTGTTGGTGACTGAAG | TGCATCCCTGTTGGGTTTAT | R | 350, 400 | 1EL |
| TNAC4394 | CGAACAGCAATTACTGGAGAGA | GTGAGCCCACTTCTGAGGAA | R | 380 | 1ES |
| TNAC4401 | AACGTTATCATGGGCCTGAG | AGCTCCTTCCCAACGACTTT | ND or D | 800 or 700, 800 | 1EL |
| TNAC4440 | CTGTGCCTCTCCGACAGC | ACTTCCGAATGCATCACAAA | ND | 700, 900 | 1EL |
| TNAC4441 | TCACGAGTGTGGGTTACCTG | AGCCAATTTCTCTGCCACAC | D | 480 | 1EL |
| TNAC4469 | CTGAAGTTGAGGTTGGCAAAA | GCGCTATCTTCACCACGTCT | R | 230 | 1EL |
| TNAC4474 | TTCCCAAAAAGACTGGTTATCAA | TGTCAACAACCTTGGCAAAT | D | 450 | 1EL |
| TNAC4495 | TGAAGGAGTTCTTGGTTGAGC | AGAATGCAGCGAAGAGGAGA | R | 480 | 1EL |
| TNAC4520 | AGCTGAAGGCTGTTTTCCAC | TCACATCGAGCAGCTTGAAA | ND or R | 800, 900 or 380 | 1EL |
| TNAC4562 | GCTGTGGTGCGTCCACTT | CAACGGCATGAAGAATCAAA | ND | 1200 | 1EL |
| TNAC4585 | TCACGCAATACTCCTTTGCTT | GCCATAGCTAGCGTGTGAGAC | R | 100, 150 | 1EL |
| TNAC4589 | TCGCCTGATGACAGTGCTAT | CACAAGGTGACCAACCAACA | D or R | 230 or 250, 500 | 1EL |
| TNAC4596 | GAGGACACTCTGGGCATCAT | CAACATTGTCCCGCAGTATG | ND or D | 700 or 200 | 1EL |
| TNAC4598 | GAGGCAGGAGCAGGAGTG | CCTCATGGTTGACGACCTTT | ND | 900 | 1ES |
ND, D, H, R, and T indicate non-digest, DpnII, HaeIII, RsaI and TaqI digestion, respectively.
Fig. 7.
The number and location of the wheat homoeologous group-1 PLUG markers assigned to Th. elongatum chromosome 1E. The fraction length (FL) value is indicated on the left of each chromosome. The FL identifies the position of the breakpoint from the centromere relative to the length of the complete arm. How FL values are calculated is described in detail by Endo and Gill (1996). The number of markers assigned to the Th. elongatum chromosome 1E/the total number of markers used in this study is indicated on the right side of each chromosome.
Fig. 8.
Representative examples of the PCR analyses used to assign the wheat homoeologous group-1 PLUG markers to the Th. elongatum chromosome 1E. The plants tested were: CS, Chinese Spring; N61, Norin 61; CSDAL1E, a homoeologous group-1 disomic addition line of Th. elongatum in CS background; and TAS1.1EL, the TAS1.1EL disomic plant in the CS and N61 background. The open and closed arrowheads indicate the presence or absence of the PCR product on chromosome 1E, respectively.
Discussion
Here, we report the development of a novel T1AS.1EL line by centric translocation, verified by HMW-GS, chromosome analysis, and molecular marker assays. We also evaluated the flour quality of the T1AS.1EL line. Among spontaneous translocation types, centric fusion (also referred to as Robertsonian translocation) is most common. In double monosomic plants, the desired compensating wheat–alien Robertsonian translocations are known to occur at fairly high frequencies, ranging from 4% to almost 20%, depending on the chromosomes involved (Davies et al. 1985, Lukaszewski 1993, 1994, 1997, Lukaszewski and Gustafson 1983, Marais and Marais 1994). In wheat improvement, the T1BL.1RS and T1AL.1RS Robertsonian translocations are most often used (Mettin et al. 1973, Zeller 1973). In these cases, genes conferring disease resistance are frequently clustered in the genome; therefore, Robertsonian translocations often confer multiple desirable resistance traits. In the case of SSPs, glutenins and gliadins also exist as multigene families on the homoeologous group-1 and -6 chromosomes, respectively. Thus, Robertsonian translocation is likely an effective strategy for introducing the clustered SSP genes from wheat wild relatives into common wheat.
Previously, we reported that the presence of the fraction length (FL) = 0.61–1.00 region of 1AL, which contains the Glu-A1c gene, significantly decreased the SSV of wheat flour (Tanaka and Tsujimoto 2012). In T1AS.1EL plants, the absence of 1AL is compensated for by the 1EL component. Therefore, we successfully introduced 1EL into the Japanese commercial cultivar N61. Our data suggest that the translocated 1EL is stably transmitted to progeny. We also confirmed that the T1AS.1EL line retains the high SSV associated with the 1EL-derived HMW-GSs, despite a high standard deviation in the T1AS.1EL (BC1F1) data, which we attribute to the segregation of other seed storage proteins in the BC1F1 generation as follows. The T1AS.1EL (BC1F1) and CS/N61 plants carried 2*/1Ex + 1Ey and 2* from Glu-A1/Glu-E1 and Glu-A1 loci, respectively. The other HMW-GS compositions in both of BC1F1 plants were 7 + 8 and 2 + 12/2.2 + 12 from Glu-B1 and Glu-D1/Glu-D1 loci, respectively. Therefore, the presence of 1Ex + 1Ey in wheat flour might be responsible for the higher SSV for the T1AS.1EL (BC1F1) plants. Furthermore, the protein contents tended to increase in plants carrying the chromosome 1E (Fig. 6). Since wheat flour with a high protein content produces strong dough, it is a trait required for bread-making. Generally, the protein content and yield are negatively correlated. In this study, although we did not investigate the yield, if the presence of the T1AS.1EL chromosome does not effect on the yield, this chromosome might have a useful gene associated with the high protein content derived from 1E chromosome. The gene may not exist in common wheat, and could lead to the expansion of the genetic diversity in common wheat using the wild relative. Thus, we propose that the T1AS.1EL line developed here will facilitate breeding of wheat varieties with a positive effect on flour quality, although we need to analyze more detailed wheat flour quality, such as bread-making tests of this line.
Also, we describe a set of molecular markers that can be used to expedite the screening of large numbers of wheat progeny carrying the chromosome T1AS.1EL. Previously, our group investigated the applicability of 1165 barley expressed sequence tag (EST) primer sets to amplify markers capable of revealing polymorphisms between wheat and ten alien species, covering a wide range of variation in Triticeae (Hagras et al. 2005). In the case of Th. elongatum, only 78 (6.7%) of these markers showed polymorphisms with wheat. Also, based on the co-amplification frequency, we demonstrated that Th. elongatum is more closely related to wheat than to barley; therefore, the transferability of the barley EST primer sets for Th. elongatum was low. Thus, in this study, we used wheat PLUG markers (Ishikawa et al. 2007), which are better suited to Th. elongatum than the barley EST primer sets. Indeed, we found that the wheat PLUG markers had better transferability to Th. elongatum than the barley EST primer sets (27.3% vs. 6.7%).
We also found almost identical syntenic relationships between the chromosome 1E and wheat group-1 chromosomes: 19 of the 20 PLUG markers assigned to 1EL were also localized to the long arm of wheat group-1 chromosomes. Based on these findings, together with previous data from our group showing that the Glu-A1, Glu-B1 and Glu-D1 loci are located on FL = 0.61–1.00, 0.69–0.85, and 0.64–1.00 of the long arm of chromosome 1A, 1B and 1D, respectively, we propose that the 1Ex and 1Ey subunit encoding genes are likely located on the distal region of 1EL (Tanaka and Tsujimoto 2012).
We assigned two PLUG markers (TNAC1035 and TNAC4469) to FL = 0.61–1.00 of 1AL. TNAC1035 is also located on FL = 0.47–0.61 and 0.64–1.00 of the long arm of wheat chromosomes 1B (1BL) and 1D, respectively. The FL = 0.47–0.61 region of 1BL is closer to the centromere than to the Glu-B1 locus (Supplemental Table 1, Tanaka and Tsujimoto 2012). TNAC4469 is also located on the FL = 0.85–1.00 region of 1BL, which is more terminal than is the Glu-B1 locus (Supplemental Table 1, Tanaka and Tsujimoto 2012). Therefore, on 1EL, TNAC1035 and TNAC4469 might also be located on regions proximal and distal of the 1Ex and 1Ey subunit encoding genes, respectively; therefore, TNAC1035 and TNAC4469 might be useful for introducing the 1Ex and 1Ey subunit encoding genes into commercial common wheat cultivars.
In summary, here we describe a novel wheat line that is likely to be useful for breeding programs aimed at improving flour quality. Although we have not yet identified genes carried by 1EL that negatively affect wheat agronomic traits, if such harmful genes are later identified, these will need to be removed by shortening the Th. elongatum segment of the T1AS.1EL chromosome by ph1b-induced homoeologous recombination. The PLUG markers that we have assigned to 1EL will be useful for detecting the chromosome regions not only removed the harmful genes, but introduced valuable genes, such as the high protein content genes by future chromosome engineering of these wheat lines.
Supplementary Information
Acknowledgments
This work was supported by JSPS KAKENHI Grant Number JP25450007.
Literature Cited
- Axford, D.W.E., McDermott, E.E. and Redman, D.G. (1979) Note on the sodium dodecyl sulfate test of breadmaking quality: comparison with Pelshenke and Zeleny tests. Cereal Chem. 56: 582–584. [Google Scholar]
- Davies, P.A., Pallotta, M.A. and Driscoll, C.J. (1985) Centric fusion between nonhomologous rye chromosomes in wheat. Can. J. Genet. Cytol. 27: 627–632. [Google Scholar]
- Dvořák, J. and Knott, D.R. (1974) Disomic and ditelosomic additions of diploid Agropyron elongatum chromosomes to Triticum aestivum. Can. J. Genet. Cytol. 16: 399–417. [Google Scholar]
- Dvořák, J., Kasarda, D.D., Dietler, M.D., Lew, E.-J.L., Anderson, O.D., Litts, J.C. and Shewry, P.R. (1986) Chromosomal location of seed storage protein genes in the genome of Elytrigia elongata. Can. J. Genet. Cytol. 28: 818–830. [Google Scholar]
- Dvořák, J., Edge, M. and Ross, K. (1988) On the evolution of the adaptation of Lophopyrum elongatum to growth in saline environments. Proc. Natl. Acad. Sci. USA 85: 3805–3809. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dvořák, J., Luo, M.C., Yang, Z.L. and Zhang, H.B. (1998) The structure of the Aegilops tauschii genepool and the evolution of hexaploid wheat. Theor. Appl. Genet. 97: 657–670. [Google Scholar]
- Endo, T.R. and Gill, B.S. (1996) The deletion stocks of common wheat. J. Hered. 87: 295–307. [Google Scholar]
- Feng, D., Xia, G., Zhao, S. and Chen, F. (2004) Two quality-associated HMW glutenin subunits in a somatic hybrid line between Triticum aestivum and Agropyron elongatum. Theor. Appl. Genet. 110: 136–144. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Friebe, B., Jiang, J., Knott, D.R. and Gill, B.S. (1994) Compensation indices of radiation-induced wheat-Agropyron elongatum translocations conferring resistance to leaf rust and stem rust. Crop Sci. 34: 400–404. [Google Scholar]
- Galili, G. and Feldman, M. (1985) Genetic control of endosperm proteins in wheat. 3. Allocation to chromosomes and differential expression of high molecular weight glutenin and gliadin genes in intervarietal substitution lines of common wheat. Theor. Appl. Genet. 69: 583–589. [DOI] [PubMed] [Google Scholar]
- Garg, M., Tanaka, H., Ishikawa, N., Takata, K., Yanaka, M. and Tsujimoto, H. (2009a) Agropyron elongatum HMW-glutenins have a potential to improve wheat end-product quality through targeted chromosome introgression. J. Cereal Sci. 50: 358–363. [Google Scholar]
- Garg, M., Tanaka, H. and Tsujimoto, H. (2009b) Exploration of Triticeae seed storage proteins for improvement of wheat end-product quality. Breed. Sci. 59: 519–528. [Google Scholar]
- Hagras, A.A.-A., Kishii, M., Sato, K., Tanaka, H. and Tsujimoto, H. (2005) Extended application of barley EST markers for the analysis of alien chromosomes added to wheat genetic background. Breed. Sci. 55: 335–341. [Google Scholar]
- Ishii, T., Ueda, T., Tanaka, H. and Tsujimoto, H. (2010) Chromosome elimination by wide hybridization between Triticeae or oat plant and pearl millet: pearl millet chromosome dynamics in hybrid embryo cells. Chromosome Res. 18: 821–831. [DOI] [PubMed] [Google Scholar]
- Ishikawa, G., Yonemaru, J., Saito, M. and Nakamura, T. (2007) PCR-based landmark unique gene (PLUG) markers effectively assign homoeologous wheat genes to A, B and D genomes. BMC Genomics 8: 135. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jauhar, P.P. and Peterson, T.S. (2000) Toward transferring scab resistance from a diploid wild grass, Thinopyrum elongatum, into durum wheat. In: Proceedings of the 2000 National Fusarium Head Blight Forum, Kentucky, pp. 201–204. [Google Scholar]
- Lawrence, G.J. and Shepherd, K.W. (1980) Variation in glutenin protein subunits of wheat. Aust. J. Biol. Sci. 33: 221–233. [Google Scholar]
- Lukaszewski, A.J. and Gustafson, J.P. (1983) Translocations and modifications of chromosomes in triticale × wheat hybrids. Theor. Appl. Genet. 64: 239–248. [DOI] [PubMed] [Google Scholar]
- Lukaszewski, A.J. (1993) Reconstruction in wheat of complete chromosomes 1B and 1R from the 1RS.1BL translocation of ‘Kavkaz’ origin. Genome 36: 821–824. [DOI] [PubMed] [Google Scholar]
- Lukaszewski, A.J. (1994) Manipulation of the genome by chromosome breakage. In: Gill, B.S. and Raupp W.J. (eds.) Proc. US-Japan Symp., classical and molecular cytogenetic analysis, Manhattan, pp. 136–139. [Google Scholar]
- Lukaszewski, A.J. (1997) Further manipulation by centric misdivision of the 1RS.1BL translocation in wheat. Euphytica 94: 257–261. [Google Scholar]
- Ma, J.X., Zhou, R.H., Dong, Y.S. and Jia, J.Z. (1999) Gene location for resistance to wheat strip rust derived from Lophopyrum elongatum (Host) A. Love. Chin. Science Bull. 44: 65–69. [Google Scholar]
- Marais, G.F. and Marais, A.S. (1994) The derivation of compensating translocations involving homoeologous group 3 chromosomes of wheat and rye. Euphytica 79: 75–80. [Google Scholar]
- McIntosh, R.A., Yamazaki, Y., Devos, K.M., Dubcovsky, J., Rogers, W.J. and Appels, R. (2003) Catalogue of gene symbols for wheat. In: Pogna, N.E., Romano M., Pogna E. and Galterio G. (eds.) Proc. 10th Int. Wheat Genet. Symp., Instituto Sperimentale per la Cerealicotura, Rome, pp. 1–34. [Google Scholar]
- Mettin, D., Blüthner, W.D. and Schlegel, G. (1973) Additional evidence on spontaneous 1B/1R wheat-rye substitutions and translocations. In: Sears, E.R. and Sears L.M.S. (eds.) Proc. 4th Int. Wheat Genet. Symp., Columbia, pp. 179–184. [Google Scholar]
- Moonen, J.H.E., Scheepstra, A. and Graveland, A. (1982) Use of the SDS-sedimentation test and SDS-polyacrylamide gel electrophoresis for screening breeder’s samples of wheat for bread-making quality. Euphytica 31: 677–690. [Google Scholar]
- Payne, P.I., Law, C.N. and Mudd, E.E. (1980) Control by homoeologous group 1 chromosomes of the high-molecular-weight subunits of glutenin, a major protein of wheat endosperm. Theor. Appl. Genet. 58: 113–120. [DOI] [PubMed] [Google Scholar]
- Payne, P.I., Holt, L.M. and Law, C.N. (1981) Structural and genetical studies on the high-molecular-weight subunits of wheat glutenin. Part 1: Allelic variation in subunits amongst varieties of wheat (Triticum aestivum). Theor. Appl. Genet. 60: 229–236. [DOI] [PubMed] [Google Scholar]
- Payne, P.I., Holt, L.M., Worland, A.J. and Law, C.N. (1982) Structural and genetical studies on the high-molecular-weight subunits of wheat glutenin. Part 3. Telocentric mapping of the subunit genes on the long arms of the homoeologous group 1 chromosomes. Theor. Appl. Genet. 63: 129–138. [DOI] [PubMed] [Google Scholar]
- Payne, P.I., Holt, L.M., Krattiger, A.F. and Carrillo, J.M. (1988) Relationships between seed quality characteristics and HMW glutenin subunit composition determined using wheats grown in Spain. J. Cereal Sci. 7: 229–235. [Google Scholar]
- Reif, J.C., Zhang, P., Dreisigacker, S., Warburton, M.L., van Ginkel, M., Hoisington, D., Bohn, M. and Melchinger, A.E. (2005) Wheat genetic diversity trends during domestication and breeding. Theor. Appl. Genet. 110: 859–864. [DOI] [PubMed] [Google Scholar]
- Roundy, B.A. (1985) Emergence and establishment of basin wildrye and tall wheatgrass in relation to moisture and salinity. J. Range Manage. 38: 126–131. [Google Scholar]
- Sears, E.R. (1966) Nullisomic-tetrasomic combinations in hexaploid wheat. In: Rilly, R. and Lewis K.R. (eds.) Chromosome manipulations and plant genetics. Oliver and Boyd, Edinburgh, pp. 29–45. [Google Scholar]
- Smith, D.B. and Payne, P.I. (1984) A procedure for the routine determination of electrophoretic band patterns of barley and malt endosperm proteins. J. Natl. Inst. Agric. Bot. 16: 487–498. [Google Scholar]
- Takata, K., Yamauchi, H., Iriki, N. and Kuwabara, T. (1999) Prediction of bread-making quality by prolonged swelling SDS-sedimentation test. Breed. Sci. 49: 221–223. [Google Scholar]
- Talbert, L.E., Smith, L.Y. and Blake, N.K. (1998) More than one origin of hexaploid wheat is indicated by sequence comparison of low-copy DNA. Genome 41: 402–407. [Google Scholar]
- Tanaka, H., Tomita, M., Tsujimoto, H. and Yasumuro, Y. (2003) Limited but specific variations of seed storage proteins in Japanese common wheat (Triticum aestivum L.). Euphytica 132: 167–174. [Google Scholar]
- Tanaka, H. and Tsujimoto, H. (2012) Positive or negative effects on dough strength in large-scale group-1 chromosome deletion lines of common wheat (Triticum aestivum L.). Euphytica 186: 57–65. [Google Scholar]
- Tanksley, S.D. and McCouch, S.R. (1997) Seed banks and molecular maps: unlocking genetic potential from the wild. Science 277: 1063–1066. [DOI] [PubMed] [Google Scholar]
- Tatham, A.S., Miflin, B.J. and Shewry, P.R. (1985) The beta-turn conformation in wheat gluten proteins: relationship to gluten elasticity. Cereal Chem. 62: 405–412. [Google Scholar]
- Zeller, F.J. (1973) 1B/1R wheat-rye chromosome substitutions and translocations. In: Sears, E.R. and Sears L.M.S. (eds.) Proc. 4th Int. Wheat Genet. Symp., Columbia, pp. 209–222. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.








