Reduced Expression of Glutathione S-Transferase α4 Promotes Vascular Neointimal Hyperplasia in CKD

Abstract

Neointima formation is the leading cause of arteriovenous fistula (AVF) failure. We have shown that CKD accelerates this process by transforming the vascular smooth muscle cells (SMCs) lining the AVF from a contractile to the synthetic phenotype. However, the underlying mechanisms affecting this transformation are not clear. Previous studies have shown that the α-class glutathione transferase isozymes have an important role in regulating 4-hydroxynonenal (4-HNE)–mediated proliferative signaling of cells. Here, using both the loss- and gain-of-function approaches, we investigated the role of glutathione S-transferase α4 (GSTA4) in modulating cellular 4-HNE levels for the transformation and proliferation of SMCs. Compared with non-CKD controls, mice with CKD had downregulated expression of GSTA4 at the mRNA and protein levels, with concomitant increase in 4-HNE in arteries and veins. This effect was associated with upregulated phosphorylation of MAPK signaling pathway proteins in proliferating SMCs. Overexpressing GSTA4 blocked 4-HNE–induced SMC proliferation. Additionally, inhibitors of MAPK signaling inhibited the 4-HNE–induced responses. Compared with wild-type mice, mice lacking GSTA4 exhibited increased CKD-induced neointima formation in AVF. Transient expression of an activated form of GSTA4, achieved using a combined Tet-On/Cre induction system in mice, lowered levels of 4-HNE and reduced the proliferation of SMCs. Together, these results demonstrate the critical role of GSTA4 in blocking CKD-induced neointima formation and AVF failure.

The success of hemodialysis depends on a functioning arteriovenous fistula (AVF), but in the 2 years since its creation, nearly 50% fail, generally due to accumulation of vascular smooth muscle cells (SMCs) and the formation of a neointima.^1–4 Thus, AVF is an Achilles heel for patients on hemodialysis.⁵ It can amount to >$1 billion per year in surgical and radiologic interventions.⁶ We have shown that dedifferentiation and proliferation of the SMCs plays a major role in neointima formation, and serves as a trigger for the transition from a contractive to the synthetic status.^7,8

CKD is recognized as one of the most consistent predictors of cardiovascular disease. We have found that CKD causes an endothelial barrier dysfunction and extracellular matrix deposition around the peripheral vasculature.^6,9 There is increasing evidence to show that CKD also increases the production of reactive oxygen species (ROS).^10,11 Formation of ROS is a major cause of DNA damage that correlates well with several human diseases. Recent studies have shown that there is an increase in 4-hydroxynonenal (4-HNE) levels in kidney disease.¹² 4-HNE is a highly reactive but stable aldehyde, generated during oxidative degradation of fatty acids such as arachidonic and linoleic acids.¹³ It has been shown to stimulate cellular proliferation as well as to block cell terminal differentiation.^14,15 In fact, the reported association between levels of 4-HNE and the magnitude of tumor promotion response suggests that 4-HNE–induced oxidative stress may play an important role in the growth of cells.

Normally, cellular 4-HNE is regulated by glutathione S-transferase α4 (GSTA4), a member of the α class of antioxidative enzymes called the glutathione S-transferases (GSTs). The GSTs play a major role in cellular detoxification. By catalyzing the conjugation of 4-HNE with an important cellular thiol-glutathione and facilitating its exclusion out of the cells, GSTs are able to protect cells against oxidative damage. Thus, by neutralizing the reactive electrophilic sites and conjugating 4-HNE with glutathione, GSTA4 is a major regulator of cellular 4-HNE levels.^16,17 In its absence, levels of 4-HNE increase and promote disease, such as cancer and kidney disease.^18,19

Although it is well agreed that activated SMCs are a major factor in neointima formation, the role of 4-HNE in CKD-induced AVF failure is poorly understood. In this study, we created CKD and AVF mouse models in GSTA4 knockout (GSTA4 KO) and inducible transgenic mice, and investigated the potential role of GSTA4 in SMC activation and neointima formation in AVFs. The downstream signals that mediate these processes were also determined.

Results

CKD Decreases Expression of GSTA4 in AVF

CKD was induced with subtotal nephrectomy. The levels of BUN and serum creatinine were significantly higher in uremic mice than those in control mice (Figure 1, A and B). There was a significant induction of neointima formation and decreased ratio of lumen-to-neointima area in CKD compared with control mice (Figure 1, C and D). GSTA4 is an antioxidative stress protein that plays a role in maintaining cellular homeostasis. We measured levels of GSTA4 in jugular veins of control and CKD mice with or without AVF, and found that CKD decreased GSTA4 mRNA expression whereas AVF surgery had no effect on CKD-mediated downregulation of GSTA4 expression (Figure 1E). In arteries, CKD decreased the GSTA4 protein (Figure 1F), accompanied by an increase in 4-HNE level and proteins bound by 4-HNE (Figure 1, G and H). We also found that CKD decreased the GSTA4 mRNA in AVFs (Figure 1I). Moreover, immunofluorescence analysis indicated that there was a strong GSTA4 expression in endothelial cells and SMCs in control AVFs, whereas GSTA4 level was markedly decreased in AVFs from CKD mice (Figure 1J). More 4-HNE–positive signals were detected in AVFs from mice with CKD (Figure 1, K and L).

Figure 1.

CKD-induced neointima formation is associated with decreased GSTA4 expression in AVFs. (A and B) BUN and serum creatinine were detected in control (CTL) and CKD mice (n=6). (C) AVFs were created in control and CKD mice. The morphology of AVFs was analyzed by hematoxylin and eosin staining. Representative images from AVFs are presented. (D) The area of lumen and neointima were measured and the ratio of lumen-to-neointima was calculated (n=6). (E) Contralateral jugular veins were collected from control or CKD mice that had sham or AVF surgeries, and the mRNA levels of GSTA4 were determined by real-time RT-PCR (*P<0.05 versus control mice, n=6). (F) Arteries were collected from control or CKD mice that had sham or AVF surgeries, and the protein levels of GSTA4 were determined by Western blotting (*P<0.05 versus control mice, n=6). (G and H) The 4-HNE adduct levels in the artery were detected by ELISA (G) (*, P<0.05 versus control mice, n=6) and Western blotting (H). (I) RNAs were collected from AVFs created in control and CKD mice and the expression of GSTA4 was detected by real-time RT-PCR. (J) The expression of GSTA4 protein was determined by immunofluorescence staining in AVFs. GSTA4 was colocalized with α-SMA in neointima cells in AVFs. (K and L) 4-HNE levels were detected by immunostaining in AVFs from control and CKD mice (K), and the density of the positive signal was analyzed (L) (n=6).

Deficiency of GSTA4 Leads to Loss of Quiescent Status of SMCs

The above results indicate that CKD-induced SMC accumulation in the AVF could be associated with a decreased expression of GSTA4. We then studied the effect of GSTA4 expression on SMC phenotype transition and proliferation. The segments from common carotid arteries and jugular vein were seeded onto plates, and cells outgrown from the artery or vein showed similar morphology and proliferation rates (Supplemental Figure 1). These outgrowing cells were positive for SMC markers calponin and SMA-α (Figure 2A). Compared with the quiescent SMCs in the artery, expression of GSTA4 was dramatically ablated in the outgrowth SMCs. In contrast, proliferative markers PCNA and cyclin D1 were significantly increased in the outgrowth SMCs (Figure 2B). SMCs from GSTA4 KO mice grew faster in ex vivo cultures compared with cells from wild-type (WT) mice, as measured at days 3 and 7 (Figure 2, C–E).

Figure 2.

Loss of GSTA4 promoted SMC phenotype switch from quiescent to synthetic status. (A) Artery segments were cultured in DMEM complete medium for 7 days ex vivo; the outgrowth cells were characterized and stained positively with the SMC markers α-SMA and calponin (original magnification, ×600). (B) Common carotid arteries were dissected and half of the arteries were cultured and half were kept for later use. After 7 days, proteins from the artery and outgrowth SMCs were isolated and Western blotting was performed (n=3), depicting loss of GSTA4 expression and increasing expression of PCNA and Cyclin D1 in the outgrowth SMCs. (C) No GSTA4 protein was detected in arteries from GSTA4 KO mice. (D) Artery segments from WT and GSTA4 KO mice were seeded onto 24-well plates and photographs were taken at indicated time points. Representative pictures are presented. (E) The cell numbers in (D) were counted and summarized (*P<0.05 versus WT, n=5). (F and G) Mouse venous SMCs from WT and GSTA4 KO mice were transfected with AdGSTA4 or GFP adenovirus. (F) Ki67 expression was detected by immunostaining (upper panel), and quantitation analysis was performed of Ki67-positive cells from three experiments (lower panel). (G) Inhibition of the proliferation markers PCNA and Cyclin D1 in GSTA4 expressing SMCs was determined by Western blotting. Representative data from three experiments are shown. *P<0.05 versus WT; ^#P<0.05 versus GSTA4 KO.

Further, GSTA4 KO in venous SMCs resulted in increased Ki67-positive SMCs, and this progrowth response was blocked by overexpressing GSTA4 (Figure 2F). Finally, GSTA4 KO-induced expression of proliferation markers was found to be inhibited in GSTA4-expressing SMCs (Figure 2G). Consistently, GSTA4 KO in artery SMCs also increased the proliferating cell number (Ki67⁺) and the expression of proliferation markers (PCNA and cyclin D1), whereas overexpression of GSTA4 blocked these responses (Supplemental Figure 2, A and B). Together, these results indicate that loss of GSTA4 expression is associated with gain of the synthetic phenotype in SMCs.

GSTA4 KO Accelerates Neointima Formation

AVFs were performed in WT and GSTA4 KO mice with or without CKD. GSTA4 KO alone induced neointima formation; there was more neointima formation and accumulation of SMA-α–positive cells in AVFs created in GSTA4 KO mice (Figure 3A). The lumen area and the ratio of lumen-to-neointima area were significantly decreased in AVFs from GSTA4 KO mice with CKD compared with that from WT mice with CKD (Figure 3, B and C). PCNA-positive cells were found in the neointima area. Statistical analysis revealed that although CKD increased the PCNA-positive cell numbers in the neointima area of AVFs, there were more proliferating cells (PCNA positive) in AVFs created in GSTA4 KO mice (Figure 3, D and E).

Figure 3.

Knocking out GSTA4 accelerated CKD-induced neointima formation. (A) AVFs were created in WT and GSTA4 KO mice, with and without CKD. The morphology (hematoxylin and eosin) and α-SMA immunostaining were performed in the 1-month-old AVFs. (B and C) The area of lumen and neointima were measured and the ratio of lumen-to-neointima was calculated (*P<0.05 versus WT mice; ^#P<0.05 versus WT with CKD mice, n=6). (D and E) The proliferation marker PCNA was detected by immunostaining in AVFs (D) (original magnification, ×400). (E) Cells depicting positive staining were counted and summarized (*P<0.05 versus WT mice; ^#P<0.05 versus WT with CKD mice, n=6).

4-HNE Mediated Proliferation of SMCs

4-HNE is the major substrate of GSTA4.²⁰ We found that GSTA4 KO mice have increased 4-HNE adduct levels in AVFs (Figure 4A). Although the level of 4-HNE adducts increased in the AVFs of uremic mice when compared with sham control mice, 4-HNE levels were further upregulated in GSTA4 KO mice (Figure 4A). In cultured cells, treatment with 4-HNE induced an increase in total cell number of SMCs and Ki67-positive cells in a dose-dependent manner (Figure 4, B and C). 4-HNE at doses of 1–5 µM also stimulated the expression of PCNA and cyclin D1 in SMCs (Figure 4D). These responses were blocked by overexpression of GSTA4, but not by the vector control in SMCs (Figure 4, E and F).

Figure 4.

Low dose of 4-HNE treatment stimulates SMC proliferation. (A) Increased 4-HNE adduct level in AVFs was detected by ELISA in GSTA4 KO mice, with or without CKD (*P<0.05 versus WT mice; ^#P<0.05 versus WT with CKD mice, n=6). (B and C) Treatment with 4-HNE at indicated dose increased SMC numbers (B) and Ki67-positive cells (C) (*P<0.05 versus no treatment, n=3). (D) 4-HNE induced a dose-dependent expression of PCNA and Cyclin D1 in mouse SMCs (n=3). (E and F) Overexpression of GSTA4 abolishes 4-HNE–induced cell proliferation. SMCs were infected with AdGSTA4 or GFP adenovirus before 4-HNE treatment, and the Ki67-positive cell number (E) and proliferation proteins (F) were detected by immunostaining and Western blotting, respectively. Data shown was from three repeat experiments (*P<0.05 versus no treatment; ^#P<0.05 versus 4-HNE treatment only).

It has been reported that 4-HNE induces cell death. To determine the effect of 4-HNE on apoptosis, mouse vein SMCs were treated with different doses of 4-HNE. Flow cytometry analysis showed that a high concentration of 4-HNE (20 µM) induces the annexin V exposure in SMCs (Supplemental Figure 3, A and B). Increased expression of Bax and activated caspase 3 were only observed in cells that were treated with 4-HNE at ≥20 µM for 24 hours (Supplemental Figure 3C). These data indicate that exposure to different doses of 4-HNE leads to different responses in SMCs.

4-HNE–Induced SMC Proliferation Is Regulated through the MAPK Signaling Pathway

MAPK signaling is one of the important factors in neointima formation in arteriovenous grafts or vascular injury.^21–23 It can be upregulated under various stimuli.²⁴ The MAPK pathway was investigated to explain the mechanism of 4-HNE–induced SMC proliferation. Treatment with 4-HNE stimulated the phosphorylation of ERK1/2, p38, and JNK, which were specifically blocked by inhibitors U0126, SB202580, and SP600125, respectively (Figure 5A). Because 4-HNE induces MAPK activation, we next tested whether MAPK mediates 4-HNE–induced SMC proliferation. We found that pretreatment with ERK and p38 inhibitors reduced 4-HNE–induced PCNA expression in SMCs, whereas the JNK inhibitor had no effect on 4-HNE–induced SMC proliferation (Figure 5B). p27^kip1 blocks cell cycle progression and is located in the nucleus.^25,26 In quiescent SMCs, treatment with 4-HNE led to a cytoplasmic translocation of p27^kip1. However, treatment with an MEK inhibitor kept p27^kip1 in the nuclei even in the presence of 4-HNE (Figure 5C). Similar results were observed in Western blot analysis of the proteins isolated from the cytosol and nucleus (Figure 5D). These data indicate that 4-HNE–induced p27^kip1 cytoplasmic translocation and proliferation are regulated through the MAPK/p27^kip1 signaling pathway.

Figure 5.

MAPK signaling pathway mediates 4-HNE-induced SMC proliferation. (A) SMCs were pretreated with U0126 (5 µM), SB203580 (10 µM), or SP600125 (5 µM) for 30 minutes before exposure to 4-HNE. The phosphorylation of MAPKs was detected by Western blotting. (B) SMCs were treated as above and the PCNA expression after 4-HNE treatment (24 hours later) was determined by Western blotting (*P<0.05 versus no treatment; ^#P<0.05 versus 4-HNE treatment only, n=3). (C and D) SMCs were seeded onto coverslips and treated as above, and the p27^kip1 expression and localization were determined by immunofluorescence staining (C) (original magnification, ×600) and Western blotting (D). Representative data were shown from three repeated experiments. C, cytoplasm; N, nuclei.

Tissue-Specific Induction of GSTA4 via a Combined Tetracycline-On/Cre System

To test whether overexpression of GSTA4 can protect against CKD-induced AVF failure, we used both the tetracycline-on (Tet-On) system and the Cre-LoxP system (Supplemental Figure 4A). A conditional GSTA4 allele can be transactivated in a tissue-specific and doxycycline-dependent manner. We obtained four Tet-On-GSTA4 transgenic founders. Two of the founders transmitted the transgene in a Mendelian fashion. To test the performance of the Tet-On-GSTA4 alleles, we bred founder Tet-On-GSTA4 transgenic mice with rtTA-stop/SM22-Cre transgenic mice proven to be Cre-positive for SMCs.²⁷ The triple transgenic mice in both lines showed an upregulation of GSTA4 expression in multiple organs after administration of doxycycline for 10 days, and the organs containing more SMCs (artery, intestine, and lung) showed a higher level of induced GSTA4 expression (Supplemental Figure 4B). Expression of GSTA4 was gradually induced in veins and arteries from both lines after doxycycline administration (Figure 6, A and B). In veins, the peak in GSTA4 mRNA level was at 7 days, and the GSTA4 protein level in the arteries peaked at 2 weeks after doxycycline induction (Figure 6, A and B). Immunostaining analysis of arteries removed from triple transgenic GSTA4/rtTA-stop/SM22-Cre mice confirmed that the GSTA4 transgene was expressed only in the SMC of the triple transgenic mice treated with doxycycline (Figure 6C). Expression of GSTA4 in SMCs isolated from the triple transgenic mice was induced by doxycycline in a dose- and time-dependent manner (Figure 6, D and E). Induced overexpression of GSTA4 by doxycycline inhibited 4-HNE–induced PCNA and cyclin D1 expression (Figure 6G). However, withdrawing doxycycline from these triple transgenic mice decreased GSTA4 to baseline levels within 2 weeks (Figure 6F).

Figure 6.

Conditional inducible expression of GSTA4 inhibits SMC proliferation. (A and B) Time-dependent expressions of GSTA4 in the veins (RT-PCR) and arteries (Western blot) were detected after doxycycline treatment (*, P <0.05 versus no DOX treatment, n=6). (C) GSTA4 expression was detected after doxycycline induction by double immunostaining of GSTA4 and α-SMA in SMCs in the common carotid artery in WT and iGSTA4 transgenic mice (original magnification, ×400). (D and E) GSTA4 expression was induced in cultured SMCs. SMCs from GSTA4/rtTA/SM22-Cre mice (iGSTA4) were isolated and the expression of GSTA4 was induced by doxycycline in a (D) dose- and (E) time-dependent manner. (F) GSTA4 overexpression was reduced after stop adding doxycycline. (G) Doxycycline treatment blocks 4-HNE–induced expression of the proliferation markers. Representative data were shown from three repeated experiments.

Conditional GSTA4 Transgenic Mice Inhibit CKD-Induced Neointima Formation

Because the GSTA4 overexpression cassette was randomly inserted into the mouse genome, we used two GSTA4 overexpression mouse lines (line 1 and line 2) to determine the specific effect of GSTA4 on CKD-induced neointima formation in AVFs. AVFs were performed in WT and the two GSTA4 transgenic mice lines with or without CKD. The 4-HNE levels in the AVFs from mice with overexpression of GSTA4 were lower compared with that in controls (Figure 7A). The morphology showed that thicker walls and smaller lumens were found near the venous anastomosis area in AVFs in mice with CKD (Figure 7B). GSTA4 expression was increased in doxycycline-induced triple transgenic mice and costained with SMA-α in neointima cells in AVFs (data not shown). Overexpression of GSTA4 in SMCs ameliorated neointima formation and accumulation of SMA-α–positive cells in AVFs (Figure 7B). The lumen area and the lumen-to-neointima area ratio were increased significantly in mice overexpressing GSTA4 (Figure 7, C and D). Fewer PCNA-positive cells were found in the neointima in AVFs from GSTA4 transgenic mice with CKD (Figure 7, E and F), indicating that a higher GSTA4 level results in lower SMC growth potential.

Figure 7.

Overexpression of GSTA4 in SMCs suppresses neointima formation in AVF. CKD and AVFs were performed in WT or GSTA4 transgenic mouse lines. Doxycycline was applied 7 days before the AVF surgery. (A) The levels of 4-HNE adducts in AVFs were detected in GSTA4 overexpression mice (*P<0.05 versus WT without CKD mice; ^#P<0.05 versus WT with CKD mice, n=6). (B) The AVFs were collected after 1 month, and hematoxylin and eosin and α-SMA immunostaining were performed (n=6) (original magnification, ×400). (C and D) The area of lumen and neointima were measured and summarized (C), and the ratio of lumen-to-neointima area was calculated (D) (*P<0.05 versus WT without CKD mice; ^#P<0.05 versus WT with CKD mice, n=6). (E and F) Immunostaining of PCNA was detected and shown in brown color in these AVFs (E) (original magnification, ×400), and the PCNA-positive cells were counted and summarized (F) (*P<0.05 versus WT without CKD mice; ^#P<0.05 versus WT with CKD mice, n=6).

Discussion

AVF provides the best access for longevity and the lowest association with morbidity and mortality in patients on hemodialysis.²⁸ However, formation of neointima from proliferation of SMCs is a hallmark of AVF failure.^29,30 Among a host of multiple factors, CKD is one of the most important factors that accelerates AVF failure. Hence, understanding the mechanisms leading to SMCs accumulating in the forming neointima is critical for designing preventive therapeutic strategies. By using the loss- and gain-of-function approaches in transgenic mice, we demonstrate for the first time that GSTA4 is critical for the SMC phenotype transition, and can regulate the maturation of an AVF in CKD mice. The major finding from this study is that CKD decreases the expression of GSTA4. Loss of GSTA4 induced an accumulation of 4-HNE that formed 4-HNE adducts with proteins, and thereby interfered with normal protein function. MAPK was identified as a critical signaling pathway of 4-HNE, which triggered the p27^kip1 cytoplasmic translocation and release from the cell cycle arrest, resulting in SMC proliferation. Further, the gain in functions of GSTA4 helped to maintain the SMC quiescent status and inhibit their migration and proliferation.

Uremia is a state of increased oxidative stress characterized by circulating tissue proteins altered by oxidative activity.³¹ CKD is associated with accelerated atherosclerosis and cardiovascular disease, which is also largely mediated by oxidative stress and formation of ROS.³² ROS initiate a complex series of molecular events that may cause neointima formation. Earlier reports indicated that loss of the glutathione peroxidase 1 induced neointima formation through increased ROS production. This, in turn, led to vascular SMC proliferation and decreased endothelial regeneration in an arterial injury model.³³ Although the uremic condition is linked to AVF failure, the actual events affecting the AVF during dialysis are complicated.^34–37

4-HNE is a highly reactive, unsaturated hydroxyalkenal produced by lipid peroxidation in cells. A uremic toxin, spermine, increases 4-HNE and impairs glucose metabolism through reduction in pyruvate generation and transamination.³⁸ CKD-associated oxidative species (e.g., the advanced glycation end products) enhance lipid peroxidation and, eventually, 4-HNE in tissues.^39,40 There are two ways that 4-HNE exerts its effects on macromolecules: firstly, by direct binding with macromolecules to form 4-HNE adducts that interfere with the function of these molecules; and secondly, 4-HNE itself is an active oxidizing molecule. We found that CKD induced formation of 4-HNE adducts in the AVF (Figure 4A). Increased 4-HNE modifies intracellular proteins, causing cytoskeletal disorganization and VE-cadherin dissociation and stimulating SMC growth.^41,42 The CKD-induced neointima formation is in parallel with an increased 4-HNE levels in GSTA4 KO mice (Figures 4 and 7). This observation is supported by a previous report, demonstrating higher 4-HNE levels in failed AVFs and expanded polytetrafluoroethylene grafts in patients.⁴³ Increased 4-HNE levels in patients with CKD was also one of the factors that induced neointima formation in the vein itself.⁴⁴ Taken together, these facts indicate that 4-HNE could be a potential tool for alleviating the vascular complications of CKD.

The α class isozyme GSTA4 exhibits a high catalytic efficiency toward 4-HNE. The normal level of GSTA4 expression in tissues determines the concentration of 4-HNE. GSTA4 is a protein linked to cellular transformation; its expression level has been observed to be altered during podocyte differentiation or cancer cell transformation.^15,45 Under normal conditions, the body contains “protectors” including the redox-sensitive thiols, such as glutathione and phase 2 detoxifying proteins (e.g., GSTA4), which function as putative sensors of oxidative stress in SMCs. On the other hand, under uremic conditions, expression of GSTA4 is inhibited. Decreased GSTA4 expression is linked with dysfunction of tubule cells and SMC activation. We found that GSTA4 levels have an inverse relationship with loss of the SMC quiescent status: abundant GSTA4 protein expression was observed in normal vasculature (where the SMCs and ECs are quiescent), however, when the artery or vein was ex vivo cultured to activate the SMCs, the GSTA4 expression was dramatically decreased in the outgrowth SMCs (Figure 2). Thus, overexpression of GSTA4 can inhibit SMC proliferation and ameliorate CKD-induced neointima formation in AVFs created in GSTA4 transgenic mice (Figure 7). Consistent with our findings, overexpression of human GSTA4 in carotid artery has been reported to prevent neointima formation after carotid allograft in rabbits.⁴⁶ These results confirm that GSTA4 expression suppresses SMC activation.

4-HNE has been reported to phosphorylate EGFR and thereby increase retinal epithelial cell growth.⁴¹ We found that that 4-HNE increased MAPK activity and thus mediated the translocation of p27^kip1 out of the nucleus and into the cytoplasm, and after its degradation, cell cycle progression in SMCs was promoted.⁴⁷ Moreover, in studies conducted in GSTA4 KO mice, there was an increased 4-HNE leading to MAPK, SMC proliferation, and neointima formation in AVFs. These results indicate that CKD-mediated alteration of GSTA4 expression is associated with neointima formation.

On the basis of our findings in this study, one of the therapeutic strategies to attenuate CKD-induced neointima formation in AVFs could be the induction of GSTA4 by antioxidants and chemopreventive agents. Several antioxidants, such as butylated hydroxyanisole and butyrate, have been shown to induce GSTA4 in cell culture and animal models.⁴⁸ Dietary chemopreventive agents, including sulforaphane, benzyl isothiocyanate, and some flavones, have been shown to induce GSTA4.^48,49 Additionally, it is also worth mentioning the importance of antioxidant transcription factor Nrf2 in the regulation of phase 2 enzymes, including GSTA4.⁵⁰ Activation of Nrf2 in tissues can prevent the progression of CKD.⁵¹ However, the beneficial effects of antioxidant compounds to prevent the failure of AVF are yet to be evaluated. We believe that treatment with antioxidants before the placement of AVF could suppress SMC activation and neointima formation in AVFs.

This study has several limitations: Firstly, BP data is missing because BP in CKD mice may affect the biologic and histologic changes in neointima formation in AVF. Secondly, the cultured cells do not completely mimic the high flow and shear stress environment in vivo. Thirdly, we found that although GSTA4 overexpression improves the lumen-to-neointima area in CKD mice, the level of lumen-to-neointima area ratio is still lower than that in AVFs from WT control mice, indicating that other factors, such as the changes in sheer stress of dynamic flow, could not be overcome by GSTA4 overexpression.

In summary, GSTA4 is involved in the CKD-induced acceleration of SMC proliferation and neointima formation. Under uremic conditions, GSTA4 is inhibited and its substrate, 4-HNE, is upregulated, which leads to SMC proliferation. Further, MAPK is the mediator of 4-HNE. Upregulated expression and activation of MAPK lead to AVF failure. The proposed 4-HNE/MAPK signaling pathway in GSTA4 KO mice with CKD will advance our understanding on SMC activation and neointima formation, and could be exploited as a target for development of medicines that could help to control CKD-induced AVF failures.

Concise Methods

Reagents

Penicillin, streptomycin, DMEM, and FBS were obtained from Invitrogen Life Technologies (Carlsbad, CA). The protein assay kit was from Bio-Rad (Hercules, CA). The anti-mouse GSTA4 antibody was generated from rabbit.¹⁹ The antibodies against pERK1/2, pp38, pJNK, and cyclin D1, MEK inhibitor U0126 were purchased from Cell Signaling Technology (Beverly, MA). The antibodies against α-SMA, caspase 3, and p27^kip1 were purchased from Abcam (Cambridge, MA); the antibodies against PCNA, calponin, GAPDH, and the secondary antibodies horseradish peroxidase–linked anti-mouse IgG and anti-rabbit IgG, were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). The anti–Ki67-Alexa Fluor 565 antibody was from BD Bioscience (San Jose, CA). The MAPK p38 inhibitor (SB203580) and JNK inhibitor (SP600125) were obtained from Calbiochem (Gibbstown, NJ). The doxycycline hyclate and Bax antibody were purchased from Sigma-Aldrich (St. Louis, MO). The adenovirus mGSTA4 expression vector was constructed by inserting mGSTA4 cDNA into pTracker-CMV vector as reported previously.¹⁹

Flow Cytometry and Apoptosis

Cell apoptosis was assessed using the annexin V-FITC apoptosis detection kit (BestBio, Shanghai, China). Briefly, vein SMCs were collected after treatment with different doses of 4-HNE for 24 hours, and after washing twice in ice-cold PBS, the cells were resuspended with annexin V binding buffer. Then, the cell suspension was mixed with 5 μl annexin V-FITC for 15 minutes at 2–8°C, and counterstained with 10 µl propidium iodide for 5 minutes in the dark. Apoptotic cells (FITC⁺/propidium iodide⁻) was determined on flow cytometer and analyzed with CellQuest software (BD Biosciences).

Animals

All studies were approved by the Institutional Animal Care and Use Committee of Baylor College of Medicine (Houston, TX) and performed in accordance with National Institutes of Health guidelines. Mice were housed in a conventional animal facility with a 12-hour light/dark cycle. WT mice were from Jackson Laboratory (Bar Harbor, Maine) and GSTA4 KO mice were obtained as previously described.^19,52

Generation of Transgenic Mice

To construct the GSTA4 inducible expression vector, the cDNA encoding mGSTA4 was amplified by GCGGGGCCCATGGCAGCCAAACCTAAG CTC (ApaI restriction site is underlined) and GCGTGGCCACTACTTATCGTCGTCA TCCTTGTAATCGAACTTCAGGACAGTCCTG (MscI restriction site is underlined). The PCR products were cut with ApaI and MscI, and cloned into pLVX-Tet-On vector (catalog no. 632162; Clontech), where the BamH I site was changed to the ApaI site using the site-directed mutation kit. To test the inducible expression of GSTA4, HEK293 cells were transfected with pLVX-Tet-On/GSTA4 and rtTA plasmids, and the induced expression of GSTA4 was confirmed after doxycycline treatment (0.2 mg/ml) for 24 hours by Western blot.

To generate GSTA4 inducible expression mice, pLVX-Tet-On/GSTA4 was linearized with EcoR1 and MscI and the big fragments were gel-purified for comicroinjection into fertilized C57BL/6 CBA oocytes by the Transgenic Core Facility of Baylor College of Medicine. TetO-GSTA4 vector was created and injected into embryos at the same facility. Among four founders and 23 babies, we obtained two colonies that were confirmed by genotyping (data not shown). The genotype of the offspring was performed by genotyping using the forward and reverse primers (CGGCCAAGTACCCTT GGTTGAAAT and AATGGAGCCACGGCAATCATCATC). The PCR conditions were as follows: 4 minutes at 95°C, followed by 32 cycles of 95°C for 1 minute, 56°C for 1 minute, and 72°C for 1.5 minute, with a final extension step at 72°C for 10 minutes. The positive fragment is 260 bp.

GSTA4 Overexpression Mice

We used the TetOn/rtTA (reverse tetracycline transactivator) inducible system and Flox-Cre recombination techniques to create SMC-specific, conditional, inducible GSTA4 transgenic mice. To achieve this goal, three strains of mice were required (Supplemental Figure 4A):

1. SM22-Cre mice (Jackson Laboratory) that constitutively expressed Cre recombinase, driven by the tissue-specific promoter in SMCs;

2. rtTA-EGFP transgenic mice (Jackson Laboratory), in which the expression of floxed-rtTA was under the control of the ubiquitously expressed ROSA26 promoter, and a floxed stop cassette was present between the ROSA26 promoter and rtTA, which confined rtTA expression to the cells in which Cre recombinase was present, and an internal ribosome entry site followed by the EGFP gene was located downstream of rtTA, thereby allowing tracking of the rtTA-expressing cells by EGFP expression; and

3. the GSTA4 allele in the TetO-GSTA4 transgenic mice, driven by the tetracycline inducible promoter (TetO).

The genotyping was performed according to the protocol provided by the Jackson Laboratory.

Induction of GSTA4 Expression in Transgenic Mice

Transgenic founders were generated by standard techniques, and two independent founder lines were evaluated, each giving equivalent results. The resulting line is hereafter referred to as iGSTA4/SMC. Transgenic littermates were treated with doxycycline-containing water (0.5 mg/ml, with 5% sucrose added; Sigma Chemicals) and control mice were given 5% sucrose solutions. The expression of GSTA4 were determined by Western blotting.

CKD Model

CKD was induced by subtotal nephrectomy in anesthetized mice as previously described.^6,9 Briefly, mice were fed 20% protein chow and, after matching for body weight, subtotal nephrectomy was performed in anesthetized mice in a two-step surgery method (Rodent III Combo). First, the left kidney was decapsulated to avoid ureter and adrenal damage, and approximately three quarters of the left kidney was removed. During recovery, mice were given two doses of buprenorphine (0.1–2.5 mg/kg body wt) after surgery and 12 hours later. The diet was changed to 6% Protein Rodent Diet Chow (Harlan Teklad, Madison, WI) ad libitum to reduce mortality and limit hypertrophy of the injured kidney. Second, the right kidney was removed 1 week later, and after 1 week, the mice with CKD were pair-fed 40% protein chow with sham-operated control mice to induce uremia that includes metabolic acidosis. The BUN was measured by the Comparative Pathology Laboratory Center at Baylor College of Medicine. The serum creatinine level was detected by using the QuantiChrom Creatinine Assay Kit (BioAssay Systems, Hayward, CA). After 4 weeks, AVFs were created.

AVF Model

Mouse AVFs were created as previously described.⁶ Briefly, mice of 12 weeks of age were anesthetized, and the right internal jugular vein was isolated using a dissecting microscope (Leica MZ6). Its distal end was clamped and ligated, the common carotid artery was ligated below its bifurcation, and the proximal end was clamped. An end-to-end anastomosis was created using 12–0 nylon suture with an interrupted stitch. After unclamping, patency was confirmed visually. The mice were kept warm after surgery, and the analgesic (buprenorphine) was given two times, at 12 hours apart. At 4 weeks after surgery, the mice were anesthetized by intraperitoneal injection and euthanized by perfusing the left ventricle with PBS and 10% formalin for 10 minutes (to maintain the endothelium and morphology of the AVF). AVFs were collected, and slides from 0.5 to 1 mm from the venous anastomosis were collected for hematoxylin and eosin staining. All AVF figures in this article were taken from the venous anastomosis because the arterial anastomosis of AVFs has no significant neointima formation in this AVF mouse model.⁶ The neointima and media were defined as the regions between the lumen and the adventitia. The vessel wall thickness was determined by measuring the difference between the area of the lumen and the neointima, using the NIS-Elements BR 3.0 program (Nikon, Melville, NY). Five cross-section slides were obtained by selecting the first of every ten sections from each AVF. These slides were used to evaluate neointima formation.

Mouse SMC Isolation and Cell Culture

Mouse SMCs were isolated as previously described.^53–55 Briefly, the artery or vein were dissected free from adipose tissue. The endothelium was removed gently with a cotton swab and the adventitia was peeled off. The vessels were cut into small pieces (approximately 1 mm²), and seeded on the culture plate and cultured in DMEM supplemented with 20% heat inactivated FBS (Hyclone, Logan, UT), 100 μg/ml penicillin, and 100 μg/ml streptomycin (Invitrogen Life Technologies). The medium was refreshed after 7 days. The total number of outgrown cells from each piece was counted by a blinded observer. The isolated mouse SMCs were positively stained with α-SMA and calponin.

Immunohistochemistry

For histologic analysis, AVFs were perfused through the left ventricle with 10% phosphate-buffered formaldehyde and processed as previously described.⁵³ Sections were blocked with 10% goat serum (Vector Laboratories, Burlingame, CA) for 30 minutes and then incubated with primary antibodies (GSTA4, 1:1000; α-SMA, 1:500; PCNA, 1:300; p27^kip1, 1:300; Calponin, 1:300; and Ki67, 1:500). Sections were washed in 0.5% Tween 20 in PBS and incubated at room temperature with a biotinylated secondary antibody (Vector Laboratories). After washing in 0.5% Tween 20 in PBS, tissue sections were incubated with an Elite ABC reagent (Vector Laboratories) in a peroxidase substrate kit, per manufacturer’s instructions (Vector Laboratories). Sections were counterstained by hematoxylin and eosin. For double immunofluorescence staining of samples, fluorescent secondary antibodies were applied to sections; 4^′, 6-diamidino-2- phenylindole was used in counterstaining. For cell immunofluorescence staining, cells were fixed in 4% paraformaldehyde in PBS for 10 minutes at room temperature. Cells were permeabilized in PBS containing 0.1% Triton X-100 and blocked by incubating in 5% BSA for 30 minutes. Fixed cells were washed with PBS and incubated for 60 minutes at room temperature or overnight at 4°C with primary antibodies. After washing three times, the cells were stained with Alexa Fluor secondary antibodies. Pictures were recorded using a Nikon Eclipse 80i Fluorescence Microscope (Nikon).

Real-Time RT-PCR

Total RNA from AVFs was isolated using the RNeasy kit (Qiagen, Valencia, CA). Real-time RT-PCR was performed using the Opticon real-time RT-PCR machine (MJ Research, Waltham, MA). GAPDH was used as an internal standard. Primers for mouse GSTA4 and GAPDH were as follows: forward, 5′-CGGCCAAGTACCCTTGGTTGAAAT-3′; reverse, 5′-AATGGAGCCACGGCAATCATC ATC-3′ and forward, 5′-AGTGGGAGTTGCTGTTGAAATC-3′; reverse, 5′-TGCTGAG TATGTCGTGGAGTCTA-3′, respectively.

Western Blot Analysis

Tissues or cell extracts were prepared in RIPA buffer; protein concentrations in the extracts were assayed using the Bradford protein assay kit (Bio-Rad) and 30 μg protein was separated by SDS–PAGE. After transferring to nitrocellulose membranes, immunoblots were probed separately with various primary antibodies after blocking with 5% skimmed milk in tris-buffered saline. Fluorescence-labeled secondary antibodies were used for detection by the Odyssey Infrared Imaging System (LICOR Inc, Lincoln, NE).

Quantification of 4-HNE

4-HNE in mouse AVFs was determined using the OxiSelect HNE-His Adduct ELISA Kit (catalog no. STA 338; Cell Biolab, San Diego, CA) according to the manufacturer’s protocol. By using this kit, instead of free 4-HNE, the conjugated HNE-His proteins were detected. A series of 4-HNE-BSA standards were prepared for each determination. AVFs from WT and GSTA4 KO mice were rinsed twice with cold PBS and homogenized to a 20% w/v mixture. The homogenates were centrifuged at 13,000×g for 15 minutes and 0.1 ml supernatant was used for each determination, according to the manufacturer’s instructions. Each sample was diluted to 10 μg/ml in 1× PBS. After binding to a 96-well plate at 4°C overnight, the samples were incubated with anti–HNE-His antibody for 1 hour at room temperature. Reaction mixtures were incubated further with the secondary antibody horseradish peroxidase conjugate at room temperature for 1 hour. After halting the enzyme reaction by the addition of the stop solution, the absorbance of the supernatant was determined at 450 nm.

Statistical Analyses

All data are presented as the mean±SD. Comparison among groups was made using one-way ANOVA followed by pairwise comparisons with P value adjustment; P<0.05 was considered to be statistically significant.

Disclosures

None.