Abstract
Stomach adenocarcinoma (STAD) is the second leading cause of cancer death and a fuller understanding of its molecular basis is needed to develop new therapeutic targets. miRNA and mRNA data were downloaded from The Cancer Genome Atlas database, and the differentially expressed miRNAs and genes were identified. The target genes of differentially expressed miRNAs were screened by prediction tools. Furthermore, the biological function of these target genes was investigated. Several key miRNAs and their target genes were selected for validation using quantitative real‐time polymerase chain reaction (qRT‐PCR). The Gene Expression Omnibus (GEO) dataset was used to verify the expression of selected miRNAs and target genes. The diagnostic value of identified miRNAs and genes was accessed by receiver operating characteristic analysis. A total of 1248 differentially expressed genes were identified in STAD. Additionally, nine differentially expressed miRNAs were identified and 160 target genes of these nine miRNAs were identified via target gene detection. Interestingly, they were remarkably enriched in the calcium signaling pathway and bile secretion. qRT‐PCR confirmed the expression of several key miRNAs and their target genes. The expression levels of hsa‐miR‐145‐3p, hsa‐miR‐145‐5p, ADAM12,ACAN,HOXC11 and MMP11 in the GEO database were compatible with the bioinformatics results. hsa‐miR‐139‐5p, hsa‐miR‐145‐3p and MMP11 have a potential diagnostic value for STAD. Differential expression of the mature form of miRNAs (hsa‐miR‐139‐5p, hsa‐miR‐145‐3p, hsa‐miR‐145‐5p and hsa‐miR‐490‐3p) and genes including ADAM12,ACAN,HOXC11 and MMP11 and calcium and bile secretion signaling pathways may play important roles in the development of STAD.
Keywords: differentially expressed genes, differentially expressed miRNA, signal pathway, stomach adenocarcinoma
Abbreviations
- AUC
area under the curve
- DAVID
Database for Annotation, Visualization and Integrated Discovery
- DEG
differentially expressed gene
- FDR
false discovery rate
- GEO
Gene Expression Omnibus
- GO
gene ontology
- KEGG
Kyoto Encyclopedia of Genes and Genomes
- MTI
miR–target interaction
- qRT‐PCR
quantitative real‐time polymerase chain reaction
- ROC
receiver operating characteristic
- STAD
stomach adenocarcinoma
- TCGA
The Cancer Genome Atlas
Stomach carcinoma is a leading cause of cancer death 1. Stomach adenocarcinoma (STAD) is the most common form of malignant stomach carcinoma and generally affects older people (50–70 years of age) 2. According to the Lauren classification, there are two main types of STAD defined as the diffuse type and the intestinal type. Some risk factors are involved in STAD including smoking, high‐salt diet, chronic gastritis and Helicobacter pylori infection 3. Up to now, the principal treatment of STAD has been gastrectomy accompanied by chemotherapy and radiation therapy. Despite advances in the treatment of STAD, the 5‐year survival rate is 5–15% 4. Therefore, understanding the pathogenesis of STAD and searching for new therapeutic targets of STAD are urgent issues.
Recently, several studies have improved our understanding of the molecular mechanisms and signaling pathways underlying tumorigenesis in STAD. For example, some tyrosine kinase receptors, including ERBB2, EGFR, FGFR2 and MET, are activated, which leads to tumorigenesis in STAD 5. Moreover, the phosphoinositide‐3‐kinase–Akt signaling pathway is activated and results in aggressive proliferation of STAD tumors 6, 7, 8.
The Cancer Genome Atlas (TCGA) database is an application platform for genome analysis consisting of large‐sample genome sequencing data analysis for 33 types of cancers, including STAD 9. miRNAs function as post‐transcriptional regulators that can repress translation or promote degradation or cleavage of complementary target mRNA sequences 10, and moreover, miRNAs have emerged as key players in the pathogenesis of STAD 11. In this study, we downloaded the miRNA and mRNA data for STAD from TCGA database and identified several differentially expressed miRNAs and a number of differentially expressed genes (DEGs). Then, we obtained the target genes of these differentially expressed miRNAs and analyzed their biological function. We used the quantitative real‐time polymerase chain reaction (qRT‐PCR) method to validate some bioinformatics analysis results. The Gene Expression Omnibus (GEO) was used to verify the expression of selected miRNAs and target genes. Finally, the diagnostic value of the identified miRNAs and genes was accessed by receiver operating characteristic (ROC) analysis. These findings may enable us to understand the progression and development of STAD.
Materials and methods
Identification of differentially expressed miRNAs and genes
From TCGA database (http://cancergenome.nih.gov), we downloaded miRNA (IlluminaHiSeq_miRNASeq) data of 84 samples (42 case samples and 42 normal samples) and mRNA (IlluminaHiSeq_RNASeqV2) data of 64 samples including 32 cases and 32 normal samples. Differential expression between normal and case samples was assessed using the R‐bioconductor package deseq 2, and the P‐value was calculated. Multiple hypothesis testing was performed via the Benjamini–Hochberg procedure. Differentially expressed miRNAs were screened with the threshold of the false discovery rate (FDR) < 0.001, log2 fold change > 2 and mean base > 100. The DEGs were screened with the threshold of FDR < 0.001 and absolute value of log2 fold change > 2.
Target gene detection of differentially expressed miRNAs
Six miRNA‐target prediction tools including rna22 (https://cm.jefferson.edu/rna22v2.0/), miranda (http://www.microrna.org/), mirdb (http://mirdb.org/miRDB/), mirwalk (http://www.umm.uni-heidelberg.de/apps/zmf/mirwalk/index.html), pictar2 (http://pictar.mdc-berlin.de/) and targetscan (http://www.targetscan.org/) were utilized to predict target genes of differentially expressed miRNAs. Target genes predicted by more than four algorithms or verified by experiments provided by the miRWalk database were screened out. Finally, the regulatory network between differentially expressed miRNAs and target genes was established, which was visualized using cytoscape software 12.
Functional annotation of target genes
To further investigate the biological function, all DEGs and target genes of differentially expressed miRNAs were analyzed in the context of several databases such as Gene Ontology (GO) functional categories and the Kyoto Encyclopedia of Genes and Genomes (KEGG) biochemical pathway using the Database for Annotation, Visualization and Integrated Discovery (DAVID).
qRT‐PCR validation
Among the identified differentially expressed miRNAs and their target genes, we selected miRNAs and genes with expression significance for and association with STAD. Depending on this criterion, hsa‐miR‐139‐5p, hsa‐miR‐145‐3p, hsa‐miR‐145‐5p, hsa‐miR‐490‐3p and their target genes ADAM12, ACAN, HOXC11 and MMP11 were selected for validation. Three tumor tissues and three para‐carcinoma tissues from participating individuals were obtained immediately after surgery. The collected tissues were frozen in liquid nitrogen for further RNA extraction. All participating individuals provided informed consent with the approval of the China‐Japan Friendship Hospital.
Total RNA of the tissue samples was extracted using the TRIzol® Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocols. One microgram of RNA was applied to synthesize DNA by SuperScript® III Reverse Transcriptase (Invitrogen). Then real‐time PCR was performed in an ABI 7500 real‐time PCR system with SYBR® Green PCR Master Mix (Invitrogen). To confirm their reliability and validity, U6 and 18S rRNA were selected as the endogenous standards. All reactions were carried out in triplicate and relative gene expressions were analyzed by the 2−ΔΔCt method. The primer sequence is shown in Table 1.
Table 1.
The primer sequence in the qRT‐PCR
| Primer | Sequence (5′ to 3′) |
|---|---|
| ADAM12 | Forward: AAGACCTTGATACGACTGCTGTTT |
| Reverse: GACTGGGGCTGAGGGACATT | |
| ACAN | Forward: GTCACACCTGAGCAGCATCGT |
| Reverse: CTGGTAGTCTTGGGCATTGTTGT | |
| HOXC11 | Forward: GGCTGAGGAGGAGAACACAAATC |
| Reverse: GCCGCTTCTCTTTGTTGATATACAC | |
| MMP11 | Forward: CCCGCAACCGACAGAAGAG |
| Reverse: GGCGTCACATCGCTCCATAC | |
| 18S rRNA | Forward: GTAACCCGTTGAACCCCATT |
| Reverse: CCATCCAATCGGTAGTAGCG | |
| hsa‐miR‐139‐5p | Forward: TCTACAGTGCACGTGTCTCCAGT |
| hsa‐miR‐145‐3p | Forward: GGATTCCTGGAAATACTGTTCT |
| hsa‐miR‐145‐5p | Forward: GTCCAGTTTTCCCAGGAATC |
| hsa‐miR‐490‐3p | Forward: CAACCTGGAGGACTCCATGCT |
| U6 | Forward: CTCGCTTCGGCAGCACA |
| Reverse: AACGCTTCACGAATTTGCGT |
Validation of the expression of miRNAs and target genes by GEO
The GEO (http://www.ncbi.nlm.nih.gov/geo) database was used to validate the expression of selected miRNAs and targeted genes. We compared the expression levels of miRNAs and targeted genes between STAD cases and adjacent non‐tumor controls and the difference of expression levels were displayed as box‐plots.
ROC analyses
Using the proc package in the R language we, performed the ROC analyses to assess the diagnostic value of selected miRNAs and target genes. The area under the curve (AUC) under binomial exact confidence interval was calculated and the ROC curve was generated.
Results
Differentially expressed miRNAs and genes
In this study, we found that nine miRNAs (three up‐regulated and six down‐regulated) and 1248 genes (371 up‐regulated and 877 down‐regulated) were differentially expressed in STAD. Table 2 shows all differentially expressed miRNAs (precursor form) including hsa‐mir‐139, hsa‐mir‐196a‐1, hsa‐mir‐196b, hsa‐mir‐133a‐1, hsa‐mir‐1‐2, hsa‐mir‐145, hsa‐mir‐135b, hsa‐mir‐133b and hsa‐mir‐490. The top 20 DEGs are listed in Table 3. Additionally, heat maps of these differentially expressed precursor form of miRNAs and genes are shown in Figs 1 and 2, respectively.
Table 2.
The differentially expressed precursor form of miRNAs in STAD
| miRNA | Mean base | Log2 fold change | Standard error | Wald statistic | P | P adj | Up/down |
|---|---|---|---|---|---|---|---|
| hsa‐mir‐139 | 528.1534 | −2.55383 | 0.202603 | −12.6051 | 1.98 × 10−36 | 3.51 × 10−34 | Down |
| hsa‐mir‐196a‐1 | 392.8496 | 4.36323 | 0.345863 | 12.6155 | 1.73 × 10−36 | 3.51 × 10−34 | Up |
| hsa‐mir‐196b | 1049.324 | 4.091521 | 0.342584 | 11.94312 | 7.05 × 10−33 | 8.35 × 10−31 | Up |
| hsa‐mir‐133a‐1 | 900.0538 | −3.34948 | 0.30633 | −10.9342 | 7.91 × 10−28 | 7.02 × 10−26 | Down |
| hsa‐mir‐1‐2 | 1498.213 | −3.23485 | 0.331376 | −9.76188 | 1.64 × 10−22 | 8.32 × 10−21 | Down |
| hsa‐mir‐145 | 48448.02 | −2.37286 | 0.249126 | −9.52473 | 1.65 × 10−21 | 7.34 × 10−20 | Down |
| hsa‐mir‐135b | 127.1043 | 2.927057 | 0.315644 | 9.273278 | 1.81 × 10−20 | 6.41 × 10−19 | Up |
| hsa‐mir‐133b | 127.2602 | −2.76184 | 0.307681 | −8.97632 | 2.80 × 10−19 | 8.28 × 10−18 | Down |
| hsa‐mir‐490 | 255.5693 | −3.83958 | 0.488705 | −7.85665 | 3.95 × 10−15 | 7.37 × 10−14 | Down |
Table 3.
Top 20 DEGs in STAD
| mRNA | Mean base | Log2 fold change | Standard error | Wald statistic | P | FDR | Up/down |
|---|---|---|---|---|---|---|---|
| CST1|1469 | 1950.411 | 7.706956 | 0.456963 | 16.86562 | 8.06 × 10−64 | 1.56 × 10−59 | Up |
| COL10A1|1300 | 628.3591 | 6.468628 | 0.398018 | 16.25211 | 2.16 × 10−59 | 2.09 × 10−55 | Up |
| ESM1|11082 | 164.0381 | 4.772024 | 0.307322 | 15.52774 | 2.25 × 10−54 | 1.45 × 10−50 | Up |
| GABRD|2563 | 54.36653 | 3.639088 | 0.279383 | 13.02546 | 8.77 × 10−39 | 4.24 × 10−35 | Up |
| HOXC10|3226 | 356.3751 | 6.328307 | 0.500079 | 12.65462 | 1.05 × 10−36 | 4.08 × 10−33 | Up |
| COL11A1|1301 | 372.4826 | 5.984012 | 0.488973 | 12.23792 | 1.95 × 10−34 | 6.28 × 10−31 | Up |
| MMP11|4320 | 2090.436 | 3.807886 | 0.314897 | 12.09247 | 1.16 × 10−33 | 3.20 × 10−30 | Up |
| LYVE1|10894 | 921.3208 | −3.57139 | 0.304514 | −11.7282 | 9.14 × 10−32 | 2.21 × 10−28 | Down |
| HOTAIR|100124700 | 45.54065 | 5.787221 | 0.502089 | 11.52628 | 9.73 × 10−31 | 2.09 × 10−27 | Up |
| CTHRC1|115908 | 845.8077 | 3.275777 | 0.284703 | 11.50593 | 1.23 × 10−30 | 2.38 × 10−27 | Up |
| LRFN4|78999 | 1583.359 | 2.39677 | 0.211807 | 11.3158 | 1.10 × 10−29 | 1.93 × 10−26 | Up |
| C1QTNF6|114904 | 519.9666 | 2.003764 | 0.177663 | 11.27842 | 1.68 × 10−29 | 2.70 × 10−26 | Up |
| PIWIL1|9271 | 134.2764 | 6.952432 | 0.621324 | 11.18971 | 4.58 × 10−29 | 6.81 × 10−26 | Up |
| SH3GL2|6456 | 62.35987 | −4.47119 | 0.407905 | −10.9613 | 5.86 × 10−28 | 8.09 × 10−25 | Down |
| CILP2|148113 | 126.4808 | 3.88935 | 0.356923 | 10.89688 | 1.19 × 10−27 | 1.54 × 10−24 | Up |
| HOXC11|3227 | 157.2612 | 4.742368 | 0.449461 | 10.55122 | 5.01 × 10−26 | 6.06 × 10−23 | Up |
| STRA6|64220 | 295.6888 | 4.633958 | 0.439962 | 10.53262 | 6.11 × 10−26 | 6.95 × 10−23 | Up |
| ALPP|250 | 75.03801 | 6.927139 | 0.658164 | 10.52494 | 6.63 × 10−26 | 7.12 × 10−23 | Up |
| CELSR3|1951 | 616.3266 | 2.799618 | 0.267519 | 10.46512 | 1.25 × 10−25 | 1.27 × 10−22 | Up |
| MAPK15|225689 | 58.32309 | 3.731925 | 0.358736 | 10.40299 | 2.40 × 10−25 | 2.32 × 10−22 | Up |
Figure 1.

Heat map of differentially expressed precursor form of miRNAs in STAD.
Figure 2.

Heat map of top 100 differentially expressed genes in STAD.
Identification of miRNA–target interactions
In the present study, potential target genes of the differentially expressed precursor form of miRNAs were identified. We found 160 target genes with 270 miRNA–target pairs including 189 interaction pairs with miRNA up‐regulated and target genes down‐regulated and 81 interaction pairs with miRNA down‐regulated and target genes up‐regulated in STAD subjects. The established regulatory network of miRNA–targets is showed in Fig. 3. In addition, we further confirmed all of the miR–target interactions (MTIs) in TCGA data analysis using miRTarBAse. Our results showed that there was a total of 46 MTIs after the miRTarBAse analysis. However, we obtained a total of 187 MTIs by using the miRWalk database. Therefore, the MTIs in the miRWalk database were more than those in the miRTarBAse database. Taking the intersection of the miRTarBAse and miRWalk databases, a total of 22 common MTIs was identified. The original MTIs from the miRWalk and miRTarBAse databases are listed in Tables S1 and S2, respectively. A Venn diagram of MTIs in the groups of the miRTarBAse database vs the miRWalk database is shown in Fig. S1.
Figure 3.

Regulatory network of precursor form of miRNAs and target genes in STAD. Rhombus and oval represent miRNA and target gene, respectively. Red and green colors represent up‐regulation and down‐regulation, respectively. The full blue lines indicate the miRNA–mRNA validation pairs and the dashed lines indicate the miRNA–mRNA prediction pairs.
Target genes enrichment analysis
Based on the DAVID database, we analyzed the biological function and pathways of these 160 target genes. Additionally, we also analyzed the function of all DEGs by KEGG. The enrichment of GO functional categories and KEGG biochemical pathways showed that these target genes were significantly enriched in calcium‐transporting ATPase activity (FDR = 0.001048), calmodulin binding (FDR = 0.002055), calcium signaling pathway (FDR = 7.97 × 10−6), salivary secretion (FDR = 9.13 × 10−5), pancreatic secretion (FDR = 0.00209), neuroactive ligand–receptor interaction (FDR = 0.004133), cell adhesion molecules (FDR = 0.003932), bile secretion (FDR = 0.003801) and vascular smooth muscle contraction (FDR = 0.018674). A GO analysis of these enriched target genes is shown in Table 4, a KEGG pathway analysis of these target genes is listed in Table 5 and the pathway maps in KEGG of calcium signaling pathway and bile secretion are shown in Figs 4 and 5, which are related to STAD. Interestingly, all DEGs were found to be enriched in the signal pathway of gastric acid secretion (Fig. 6), which also plays a role in STAD.
Table 4.
GO function analysis of target genes
| Item | Item details | Count | P | FDR | Genes |
|---|---|---|---|---|---|
| Molecular function | |||||
| GO:0046872 | Metal ion binding | 37 | 3.36 × 10−9 | 9.76 × 10−7 | ADCY2, MAT1A, MMP11, ALOX12, ATP2B3, TRIM72, XPNPEP2, MMP8, TRIM71, ATP2B4, ZNF469, EME1, KCNMA1, HMGCLL1, ADAMTS12, ADAM12, STK32A, NPTX1, ENPP3, FOXP2, NRXN3, PRUNE2, NOS1, MCM10, ALPPL2, ATP2B2, ZNF695, PGR, USP2, AR, NR4A3, ADAMTS2, ZNF385B, MSRB3, MFI2, MEX3A, RELN |
| GO:0005388 | Calcium‐transporting ATPase activity | 3 | 7.23 × 10−6 | 0.001048 | ATP2B3, ATP2B4, ATP2B2 |
| GO:0043565 | Sequence‐specific DNA binding (MF) | 11 | 3.46 × 10−5 | 0.002009 | HLF, HOXA9, SIX3, HOXB9, FOXP2, HOXC11, POU4F1, PGR, TOP2A, AR, NR4A3 |
| GO:0005516 | Calmodulin binding | 6 | 5.67 × 10−5 | 0.002055 | ATP2B3, ATP2B4, CALD1, NOS1, ATP2B2, SLC8A2 |
| GO:0017022 | Myosin binding | 3 | 4.71 × 10−5 | 0.002275 | SLC6A4, CALD1, SNAP25 |
| GO:0005216 | Ion channel activity | 7 | 3.15 × 10−5 | 0.002282 | GRIK3, KCNMA1, KCNQ5, GRIA4, GABRG1, CHRNA4, KCNA2 |
| GO:0005515 | Protein binding | 38 | 5.65 × 10−5 | 0.002341 | CLSPN, DTNA, ACAN, ALOX12, HMGA2, SLC6A4, CELSR3, HOXA9, ATP2B4, HOXB9, EME1, KCNMA1, NTNG1, ADAM12, SORCS1, MYOCD, NEGR1, APOA1, MC2R, FRMPD4, CDC6, PLN, CASR, NOS1, MCM10, MAL, ZNF365, ATP2B2, PGR, TOP2A, USP2, AR, NEFM, MFI2, DLG2, KRT7, CDK6, SNAP25 |
| GO:0017075 | Syntaxin‐1 binding | 3 | 2.43 × 10−5 | 0.002347 | SLC6A4, CPLX2, SNAP25 |
| GO:0004872 | Receptor activity | 19 | 7.64 × 10−5 | 0.002463 | CELSR3, HTR2C, HAVCR1, GRIK3, GPR158, MC2R, GRIA4, NMBR, NRXN3, CASR, EPHA7, TNFRSF11B, PGR, CHRNA4, AR, NR4A3, STAB 2, IGSF11, NLGN1 |
| GO:0004222 | Metalloendopeptidase activity | 5 | 0.000108 | 0.00313 | MMP11, MMP8, ADAMTS12, ADAM12, ADAMTS2 |
| GO:0019899 | Enzyme binding | 6 | 0.000216 | 0.005705 | APOA1, PGR, TOP2A, PRIMA1, AR, AKAP6 |
| GO:0005249 | Voltage‐gated potassium channel activity | 4 | 0.000312 | 0.006971 | KCNMA1, KCNQ5, SNAP25, KCNA2 |
| GO:0005372 | Water transmembrane transporter activity | 2 | 0.000295 | 0.00712 | AQP2, AQP4 |
| GO:0005244 | Voltage‐gated ion channel activity | 5 | 0.000589 | 0.011389 | CACNA1H, KCNMA1, KCNQ5, KCNA1, KCNA2 |
| GO:0030165 | PDZ domain binding | 4 | 0.000562 | 0.011646 | ATP2B4, AQP2, ATP2B2, DLG2 |
| Biological process | |||||
| GO:0007268 | Synaptic transmission | 16 | 2.12 × 10−11 | 1.60 × 10−8 | ADCY2, DTNA, HTR2C, GRIK3, TAC1, KCNMA1, KCNQ5, GRIA4, NPTX1, GABRG1, CHRNA4, DLG2, KCNA1, SLC5A7, SNAP25, KCNA2 |
| GO:0055085 | Transmembrane transport | 18 | 5.43 × 10−10 | 2.04 × 10−7 | ADCY2, ATP2B3, CACNA1H, ATP2B4, KCNMA1, KCNQ5, SLC6A15, SLC9A4, APOA1, SLCO1A2, AQP2, ATP2B2, AQP4, SLC8A2, KCNA1, SLC5A7, GPR155, KCNA2 |
| GO:0006811 | Ion transport | 15 | 2.91 × 10−8 | 7.29 × 10−6 | CACNA1H, GRIK3, KCNMA1, KCNQ5, SLC6A15, SLC9A4, GRIA4, GABRG1, SLCO1A2, CHRNA4, MFI2, SLC8A2, KCNA1, SLC5A7, KCNA2 |
| GO:0007275 | Multicellular organismal development | 19 | 5.17 × 10−8 | 9.73 × 10−6 | HLF, MMP11, HMGA2, CELSR3, HOXA9, SIX3, TRIM71, HOXB9, NTNG1, ARC, HOXC11, FIGF, NDRG4, EPHA7, POU4F1, GPM6B, ST6GAL2, RELN, BMP3 |
| GO:0007155 | Cell adhesion | 13 | 1.45 × 10−6 | 0.000218 | OPCML, ACAN, CELSR3, ADAM12, NEGR1, CADM3, NRXN3, AOC3, STAB 2, IGSF11, CNTN2, RELN, NLGN1 |
| GO:0030168 | Platelet activation | 8 | 1.12 × 10−5 | 0.001409 | ATP2B3, ATP2B4, KCNMA1, APOA1, FIGF, NOS1, ATP2B2, SLC8A2 |
| GO:0007520 | Myoblast fusion | 3 | 1.41 × 10−5 | 0.001517 | CACNA1H, ADAM12, NOS1 |
| GO:0060748 | Tertiary branching involved in mammary gland duct morphogenesis | 2 | 5.94 × 10−5 | 0.005596 | PGR, AR |
| GO:0030574 | Collagen catabolic process | 3 | 9.46 × 10−5 | 0.007122 | MMP11, MMP8, ADAMTS2 |
| GO:0006810 | Transport | 11 | 9.25 × 10−5 | 0.007743 | ATP2B3, CACNA1H, TRIM72, ATP2B4, GRIA4, NPTX1, SLC35F1, ATP2B2, AQP4, AR, ABCA9 |
| GO:0007420 | Brain development | 6 | 0.000161 | 0.011038 | CKB, SLC6A4, SIX3, EPHA7, ATP2B2, RELN |
| GO:0001503 | Ossification | 4 | 0.000198 | 0.011493 | ACAN, MMP8, CASR, BMP3 |
| GO:0051346 | Negative regulation of hydrolase activity | 2 | 0.000197 | 0.012361 | APOA1, NOS1 |
| GO:0030879 | Mammary gland development | 3 | 0.000265 | 0.01329 | HOXA9, HOXB9, PGR |
| GO:0042391 | Regulation of membrane potential | 3 | 0.000265 | 0.01329 | GRIK3, KCNMA1, CHRNA4 |
| Cellular component | |||||
| GO:0005886 | Plasma membrane | 57 | 1.47 × 10−18 | 2.16 × 10−16 | ADCY2, OPCML, DTNA, ATP2B3, FAM129A, SLC6A4, NBEA, CELSR3, HTR2C, XPNPEP2, GBP5, GRIK3, ATP2B4, PPP1R12B, TAC1, KCNMA1, KCNQ5, NTNG1, ACSL6, SLC6A15, SLC9A4, GPR158, ARC, ADAM12, NEGR1, CADM3, APOA1, MC2R, GRIA4, NMBR, CALD1, PMEPA1, CASR, EPHA7, ALPPL2, GABRG1, SLCO1A2, AQP2, ATP2B2, AOC3, PRIMA1, AQP4, CHRNA4, TUB, STAB 2, MFI2, IGSF11, GJB7, DLG2, SLC8A2, CNTN2, KCNA1, CAP2, SLC5A7, SNAP25, NLGN1, KCNA2 |
| GO:0030425 | Dendrite | 12 | 4.11 × 10−11 | 3.02 × 10−9 | ADCY2, GRIK3, NEGR1, GRIA4, CPLX2, EPHA7, ATP2B2, CHRNA4, AR, DLG2, RELN, NLGN1 |
| GO:0016021 | Integral to membrane | 50 | 1.70 × 10−10 | 8.34 × 10−9 | ADCY2, ATP2B3, CACNA1H, CELSR3, HTR2C, ELFN2, HAVCR1, GRIK3, KCNMA1, KCNQ5, ACSL6, SLC6A15, SLC9A4, GPR158, ADAM12, SORCS1, CADM3, GRIA4, PMEPA1, NRXN3, PLN, CASR, SLC35F1, GABRG1, SLCO1A2, AQP2, WSCD2, ATP2B2, TMEM74, AOC3, PRIMA1, ATRNL1, AQP4, CHRNA4, RIC3, GPM6B, ST8SIA3, RDH16, ST6GAL2, HS6ST3, IGSF11, GJB7, SLC8A2, KCNA1, ABCA9, SLC5A7, TMEM236, GPR155, KCNA2, TMEM196 |
| GO:0043025 | Neuronal cell body | 12 | 3.15 × 10−10 | 1.16 × 10−8 | TAC1, NEGR1, GRIA4, CALD1, CPLX2, EPHA7, ATP2B2, CHRNA4, DLG2, SLC8A2, CNTN2, SNAP25 |
| GO:0045202 | Synapse | 12 | 7.76 × 10−9 | 2.28 × 10−7 | DTNA, GRIK3, ARC, GRIA4, CPLX2, NOS1, GABRG1, PRIMA1, CHRNA4, DLG2, SNAP25, NLGN1 |
| GO:0044224 | Juxtaparanode region of axon | 4 | 2.66 × 10−8 | 6.51 × 10−7 | DLG2, CNTN2, KCNA1, KCNA2 |
| GO:0045211 | Postsynaptic membrane | 8 | 1.06 × 10−6 | 2.22 × 10−5 | GRIK3, ARC, GRIA4, EPHA7, GABRG1, CHRNA4, DLG2, NLGN1 |
| GO:0008076 | Voltage‐gated potassium channel complex | 6 | 3.53 × 10−6 | 5.77 × 10−5 | KCNMA1, KCNQ5, CNTN2, KCNA1, SNAP25, KCNA2 |
| GO:0005887 | Integral to plasma membrane | 17 | 3.34 × 10−6 | 6.14 × 10−5 | OPCML, SLC6A4, GRIK3, ATP2B4, SLC6A15, MC2R, NMBR, ENPP3, NRXN3, CASR, EPHA7, MAL, AQP4, STAB 2, MFI2, CNTN2, NLGN1 |
| GO:0016020 | Membrane | 38 | 6.88 × 10−6 | 0.000101 | ADCY2, CACNA1H, XPNPEP2, ELFN2, HAVCR1, KCNMA1, KCNQ5, SLC6A15, SORCS1, ENPP3, FIGF, NRXN3, PLN, SLC35F1, ALPPL2, SLCO1A2, AQP2, WSCD2, MAL, ATP2B2, TMEM74, ATRNL1, AQP4, CHRNA4, RIC3, GPM6B, ST8SIA3, RDH16, AKAP6, ST6GAL2, HS6ST3, SLC8A2, ABCA9, SLC5A7, TMEM236, GPR155, KCNA2, TMEM196 |
| GO:0030054 | Cell junction | 11 | 1.05 × 10−5 | 0.00014 | DTNA, GRIK3, ARC, GRIA4, GABRG1, PRIMA1, CHRNA4, GJB7, DLG2, SNAP25, NLGN1 |
| GO:0031225 | Anchored to membrane | 6 | 1.17 × 10−5 | 0.000144 | OPCML, XPNPEP2, NEGR1, ALPPL2, MFI2, CNTN2 |
| GO:0043197 | Dendritic spine | 5 | 1.50 × 10−5 | 0.000169 | ARC, FRMPD4, CALD1, NOS1, SLC8A2 |
| GO:0005578 | Proteinaceous extracellular matrix | 7 | 4.58 × 10−5 | 0.000481 | ACAN, MMP11, MMP8, ADAMTS12, TNFRSF11B, ADAMTS2, RELN |
| GO:0005737 | Cytoplasm | 43 | 4.99 × 10−5 | 0.000489 | ADCY2, DTNA, CKB, KIAA1199, ALOX12, FAM129A, NBEA, HTR2C, HOXA9, TRIM71, PPP1R12B, BAAT, ARC, NMBR, CALD1, CDC6, FOXP2, HOXC11, NDRG4, SYNPO2, CPLX2, PRUNE2, NOS1, MCM10, AQP2, ZNF365, ATP2B2, PGR, TOP2A, AQP4, USP2, AR, TUB, PAK7, AKAP6, STAB 2, DLG2, MEX3A, KRT7, CDK6, SNAP25, RELN, KLHL4 |
Table 5.
The KEGG pathway analysis of target genes
| Item | Item details | Count | P | FDR | Genes |
|---|---|---|---|---|---|
| Kegg:04020 | Calcium signaling pathway | 9 | 1.03 × 10−7 | 7.97 × 10−6 | SLC8A2, ADCY2, ATP2B4, CACNA1H, HTR2C, ATP2B2, PLN, NOS1, ATP2B3 |
| Kegg:04970 | Salivary secretion | 6 | 2.37 × 10−6 | 9.13 × 10−5 | ADCY2, KCNMA1, ATP2B4, ATP2B2, NOS1, ATP2B3 |
| Kegg:04972 | Pancreatic secretion | 5 | 8.14 × 10−5 | 0.00209 | ADCY2, KCNMA1, ATP2B4, ATP2B2, ATP2B3 |
| Kegg:04080 | Neuroactive ligand–receptor interaction | 7 | 0.000215 | 0.004133 | NMBR, MC2R, HTR2C, GABRG1, GRIK3, GRIA4, CHRNA4 |
| Kegg:04514 | Cell adhesion molecules | 5 | 0.000255 | 0.003932 | NRXN3, CNTN2, NLGN1, CADM3, NEGR1 |
| Kegg:04976 | Bile secretion | 4 | 0.000296 | 0.003801 | ADCY2, AQP4, SLCO1A2, BAAT |
| Kegg:04270 | Vascular smooth muscle contraction | 4 | 0.001698 | 0.018674 | ADCY2, KCNMA1, CALD1, PPP1R12B |
Figure 4.

Target genes that were significantly enriched in calcium signaling pathway. The red rectangles represent the target genes that are enriched in calcium signaling pathway. The figure was obtained by the Kanehisa Laboratories.
Figure 5.

Target genes that were significantly enriched in bile secretion. The red rectangles were represented the target genes that are enriched in bile secretion. The figure was obtained by the Kanehisa Laboratories.
Figure 6.

Target genes that were significantly enriched in gastric acid secretion. The red rectangles represent the target genes that are enriched in gastric acid secretion. The figure was obtained by the Kanehisa Laboratories.
qRT‐PCR verification of selected miRNA and genes
To confirm the validity and reliability of bioinformatics results, we selected and assessed the expression levels of four key mature forms of miRNAs (hsa‐miR‐139‐5p, hsa‐miR‐145‐3p, hsa‐miR‐145‐5p and hsa‐miR‐490‐3p) and their target genes including ADAM12, ACAN, HOXC11 and MMP11 (Fig. 7). The results showed that hsa‐miR‐145‐3p, hsa‐miR‐145‐5p and hsa‐miR‐490‐3p showed down‐regulation, and their target genes (ADAM12, ACAN, HOXC11 and MMP11) showed up‐regulation, consistent with the bioinformatics results. However, the expression of hsa‐miR‐139‐5p was inconsistent with the bioinformatics result.
Figure 7.

Validation of differentially expressed mature forms of miRNAs and mRNAs in the STAD tissues by qRT‐PCR. **P < 0.01.
Validation the expression of miRNAs and target genes
In this study, two down‐regulated miRNAs (hsa‐miR‐145‐3p and hsa‐miR‐145‐5p) and four up‐regulated target genes (ADAM12, ACAN, HOXC11 and MMP11) in STAD were selected to perform the expression validation (Fig. 8). Different expression levels of them between STAD and non‐tumor tissues were analyzed and depicted through box‐plots. These box‐plots were displayed visually by median and interquartile range. The expression levels of hsa‐miR‐145‐3p and hsa‐miR‐145‐5p were significantly down‐regulated in the case group compared with the normal group and the expression of ADAM12, ACAN, HOXC11 and MMP11 was significantly up‐regulated in the case group compared with the normal group. Compared with the normal group, the expression levels for the case group were consistent with our bioinformatics analysis.
Figure 8.

Validation of the expression levels of selected miRNAs and in STAD based on GEO database. The x‐axis shows the case and normal groups and the y‐axis shows expression read counts. Case group and normal group indicate STAD tissues and adjacent non‐tumor tissues.
ROC curve analysis
We performed ROC curve analyses and calculated the AUC to assess the discriminatory ability of two selected miRNAs (hsa‐miR‐139‐5p and hsa‐miR‐145‐3p) and one target gene (MMP11) from the GEO dataset (Fig. 9). The AUC for them was more than 0.7. MMP11 had the largest AUC. For STAD diagnosis, the 1 – specificity (proportion of false positives) and sensitivity (proportion of true positives) of hsa‐miR‐139‐5p were 87.5% and 71.7%, respectively; the 1 – specificity (proportion of false positives) and sensitivity (proportion of true positives) of hsa‐miR‐145‐3p were 100% and 56.7%, respectively; the 1 – specificity (proportion of false positives) and sensitivity (proportion of true positives) of MMP11 were 100% and 83.3%, respectively.
Figure 9.

ROC curves of selected miRNAs and target genes between STAD patients and healthy controls. The ROC curves were used to show the diagnostic ability of these selected miRNAs and target genes with 1 – specificity (the proportion of false positives) and sensitivity (the proportion of true positives). The x‐axis shows 1 – specificity and the y‐axis shows sensitivity.
Discussion
STAD remains the second leading cause of cancer death and makes up approximately 10% of newly diagnosed cancers 13. Therefore, an understanding of the molecular mechanism of STAD is needed. In the current study, we obtained nine differentially expressed miRNAs and 1248 DEGs for STAD. Additionally, target gene detection revealed 160 target genes of these differentially expressed miRNAs. After biological function analysis, we found that these target genes were most significantly enriched in the calcium signaling pathway and bile secretion.
Calcium signals can regulate the majority of physiological processes ranging from cell proliferation to cell apoptosis 14. It is reported that any disorders of Ca2+ channels and/or receptors will lead to various diseases, such as cancer 15. In this study, we found that the target genes (SLC8A2, ADCY2, ATP2B4, CACNA1H, HTR2C, ATP2B2, PLN, NOS1 and ATP2B3) of differentially expressed miRNAs were associated with the calcium signaling pathway, which suggested a role for calcium signaling in STAD.
It is pointed out that there is a positive relationship between bile acid concentration and gastric carcinoma development, which suggests a carcinogenic role of bile acid in gastritis 16. Furthermore, Suzuki et al. 17 also found that patients with a high level of bile acid developed gastric carcinoma more frequently than those patients with a low bile acid level. In this study, we found that target genes (ADCY2, AQP4, SLCO1A2 and BAAT) were related to bile secretion, which suggested a relationship between bile secretion and STAD.
All in all, these identified target genes played roles in the biological processes of calcium signaling and bile secretion in STAD. Additionally, we also investigated the function of all DEGs by KEGG pathway analysis and found that these DEGs were remarkably involved in signaling pathways of gastric acid secretion.
The principal secretory function of the stomach is secreting gastric acid 18. Gastric acid functions in a number of ways including modulating the gut microbiome, assisting in protein digestion and facilitating absorption of iron and calcium 19. It is reported that H. pylori is related to gastric carcinoma 20. Interestingly, it is found that in patients with relatives with gastric carcinoma, H. pylori infection is related to decreasing gastric acid secretion 21. In this study, we found all DEGs were significantly enriched in the signaling pathway of gastric acid secretion, which further demonstrated the role of gastric acid secretion in the development of STAD.
Among identified miRNAs, mature the form of hsa‐miR‐139‐5p, hsa‐miR‐145‐3p, hsa‐miR‐145‐5p and hsa‐miR‐490‐3p was validated by qRT‐PCR and the results were consistent with the bioinformatics results except for the expression of hsa‐miR‐139‐5p. The small sample size we used for qRT‐PCR may account for this inconsistency. It is pointed out that hsa‐miR‐139‐5p shows decreased expression associated with STAD 22, 23. Previous reports found that hsa‐miR‐145 was a potential tumor suppressor and hsa‐miR‐145‐3p and hsa‐miR‐145‐5p were down‐regulated in stomach carcinoma 24, 25, 26. Kuo et al. 22 demonstrated that hsa‐miR‐490‐3p was down‐regulated in STAD gastric carcinoma tissues. In this study, our results were in agreement with previous reports, which further demonstrated the role of these differentially expressed miRNAs in the process of STAD. Significantly, both hsa‐miR‐139‐5p and hsa‐miR‐145‐3p had a potential diagnostic value for STAD.
Additionally, we also validated the target genes (ADAM12, ACAN, HOXC11 and MMP11) of these four miRNAs mentioned above, and their expression patterns were consistent with the bioinformatics results. ADAM12 is a complicated and multi‐domain protein that functions in cell proliferation and movement 27. Furthermore, it is strongly expressed in various cancers including stomach carcinoma 28, 29. That mutation of ACAN occurs in stomach carcinoma has been shown by comprehensive whole‐genome and transcriptome sequencing analysis 30. HOXC11 is considered to be a novel potential oncogene with altered expression in stomach carcinoma pathogenesis by association analysis with candidate gene strategy 31. MMP11 is known a marker of tumor invasion and metastasis 32. Moreover, previous reports detected the expression level of MMP11 by microarray analysis and found that it was elevated in stomach carcinoma patients and quantitative polymerase chain reaction analysis also confirmed its up‐regulated expression 32, 33. Herein, up‐regulated expression of ADAM12, ACAN, HOXC11 and MMP11 may be involved in the pathology of STAD. Interestingly, MMP11 was significantly associated with STAD diagnoses.
Besides the above validated differentially expressed miRNAs, we also found two miRNAs (hsa‐miR‐196b and hsa‐miR‐135b) were also differentially expressed in STAD. Moreover, hsa‐miR‐196 and hsa‐miR‐135 covered the most downstream target genes in the regulatory network between differentially expressed miRNAs and target genes. It has been demonstrated that the expression level of hsa‐miR‐196b is significantly higher in stomach carcinoma 34, 35. Additionally, overexpression of hsa‐miR‐196b is linked to stomach carcinoma and may be considered as a stomach carcinoma marker 36, 37. It was demonstrated that hsa‐miR‐135b is up‐regulated in stomach carcinoma tissues 38, 39. Based on the results obtained in several studies, hsa‐miR‐135b is reported as a potential biomarker of the intestinal‐type of STAD 40, 41, 42, 43. In our study, hsa‐miR‐196b and hsa‐miR‐135b were also up‐regulated, which was in line with previous reports. Further qRT‐PCR validation experiments for hsa‐miR‐196b and hsa‐miR‐135b are needed.
There are limitations to our study. Firstly, target site information for miRNA–mRNA pairs is needed for validation of the miRNA–mRNA interaction. Secondly, RNA‐seq and miRNA‐seq are further needed to screen larger numbers of candidate miRNA and mRNA. Thirdly, a luciferase assay for direct verification of the identified miRNA–target interactions is needed in further studies.
Conclusions
All in all, we found four key differentially expressed miRNAs including hsa‐miR‐139‐5p, hsa‐miR‐145‐3p, hsa‐miR‐145‐5p and hsa‐miR‐490‐3p, four DEGs (ADAM12, ACAN, HOXC11 and MMP11) and three related signaling pathways (calcium signaling pathway, bile secretion and gastric acid secretion) in STAD, which provide a novel field for understanding the pathological mechanism of STAD. In addition, hsa‐miR‐139‐5p, hsa‐miR‐145‐3p and MMP11 have a potential diagnostic value for STAD.
Author contributions
The study was designed by LZ and HT; the grant receiver was LZ; the experiments were conducted by YS; the manuscript was written by JL and FL.
Supporting information
Fig. S1. Venn diagram of MTIs in the groups of miRTarBAse database vs miRWalk database.
Table S1. The original miR–target interactions from the miRWalk database.
Table S2. The original miR–target interactions from the miRTarBAse database.
Acknowledgements
This research did not receive any specific grant from funding agencies in the public, commercial, or not‐for‐profit sectors.
Contributor Information
Huangying Tan, Email: tanhuangying@263.net.
Lei Zhou, Email: zhouleide12@163.com.
References
- 1. Kabel AM (2014) Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D (2011): Global cancer statistics. Cancer J Clinic 61, 69–90. [DOI] [PubMed] [Google Scholar]
- 2. Kim BC, Jeong HO, Park D, Kim CH, Lee EK, Kim DH, Im E, Kim ND, Lee S and Yu BP (2014) Profiling age‐related epigenetic markers of stomach adenocarcinoma in young and old subjects. Cancer Inform 14, 47–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Lian G, Wei C, Wang D, Cui M, Wang Z, Liu X, Li W, Wang L, Wang Q and Zhang DY (2014) Protein profiling of Helicobacter pylori‐associated gastric cancer. Am J Pathol 184, 1343–1354. [DOI] [PubMed] [Google Scholar]
- 4. Meireles SI, Cristo EB, Carvalho AF, Hirata R Jr, Pelosof A, Gomes LI, Martins WK, Begnami MD, Zitron C, Montagnini AL et al (2004) Molecular classifiers for gastric cancer and nonmalignant diseases of the gastric mucosa. Cancer Res 64, 1255–1265. [DOI] [PubMed] [Google Scholar]
- 5. Bang YJ, Van Cutsem E, Feyereislova A, Chung HC, Shen L, Sawaki A, Lordick F, Ohtsu A, Omuro Y, Satoh T et al (2010) Trastuzumab in combination with chemotherapy versus chemotherapy alone for treatment of HER2‐positive advanced gastric or gastro‐oesophageal junction cancer (ToGA): a phase 3, open‐label, randomised controlled trial. Lancet 376, 687–697. [DOI] [PubMed] [Google Scholar]
- 6. Sawabu T, Seno H, Kawashima T, Fukuda A, Uenoyama Y, Kawada M, Kanda N, Sekikawa A, Fukui H, Yanagita M et al (2007) Growth arrest‐specific gene 6 and Axl signaling enhances gastric cancer cell survival via Akt pathway. Mol Carcinog 46, 155–164. [DOI] [PubMed] [Google Scholar]
- 7. Murakami D, Tsujitani S, Osaki T, Saito H, Katano K, Tatebe S and Ikeguchi M (2007) Expression of phosphorylated Akt (pAkt) in gastric carcinoma predicts prognosis and efficacy of chemotherapy. Gastric Cancer 10, 45–51. [DOI] [PubMed] [Google Scholar]
- 8. Kwon MJ and Nam TJ (2007) A polysaccharide of the marine alga Capsosiphon fulvescens induces apoptosis in AGS gastric cancer cells via an IGF‐IR‐mediated PI3K/Akt pathway. Cell Biol Int 31 (8), 768–775. [DOI] [PubMed] [Google Scholar]
- 9. Lee H, Palm J, Grimes SM and Ji HP (2015) The Cancer Genome Atlas Clinical Explorer: a web and mobile interface for identifying clinical‐genomic driver associations. Genome Med 7, 112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Bartel DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281–297. [DOI] [PubMed] [Google Scholar]
- 11. Thiel A and Ristimaki A (2012) Gastric cancer: basic aspects. Helicobacter 17 (Suppl 1), 26–29. [DOI] [PubMed] [Google Scholar]
- 12. Smoot ME, Ono K, Ruscheinski J, Wang PL and Ideker T (2011) Cytoscape 2.8: new features for data integration and network visualization. Bioinformatics 27, 431–432. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Cunningham SC, Kamangar F, Kim MP, Hammoud S, Haque R, Iacobuzio‐Donahue CA, Maitra A, Ashfaq R, Hustinx S, Heitmiller RE et al (2006) Claudin‐4, mitogen‐activated protein kinase kinase 4, and stratifin are markers of gastric adenocarcinoma precursor lesions. Cancer Epidemiol Biomarkers Prev 15, 281–287. [DOI] [PubMed] [Google Scholar]
- 14. Carafoli E (2003) The calcium‐signalling saga: tap water and protein crystals. Nat Rev Mol Cell Biol 4, 326–332. [DOI] [PubMed] [Google Scholar]
- 15. Elsholz F, Harteneck C, Muller W and Friedland K (2014) Calcium – a central regulator of keratinocyte differentiation in health and disease. Eur J Dermatol 24, 650–661. [DOI] [PubMed] [Google Scholar]
- 16. Tatsugami M, Ito M, Tanaka S, Yoshihara M, Matsui H, Haruma K and Chayama K (2012) Bile acid promotes intestinal metaplasia and gastric carcinogenesis. Cancer Epidemiol Biomarkers Prev 21, 2101–2107. [DOI] [PubMed] [Google Scholar]
- 17. Suzuki H, Hibi T and Marshall BJ (2007) Helicobacter pylori: present status and future prospects in Japan. J Gastroenterol 42, 1–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Waldum HL, Kleveland PM and Fossmark R (2015) Upper gastrointestinal physiology and diseases. Scand J Gastroenterol 50, 649–656. [DOI] [PubMed] [Google Scholar]
- 19. Schubert ML (2016) Gastric acid secretion. Curr Opin Gastroenterol 32, 452–460. [DOI] [PubMed] [Google Scholar]
- 20. Bouvard V, Baan R, Straif K, Grosse Y, Secretan B, El Ghissassi F, Benbrahim‐Tallaa L, Guha N, Freeman C, Galichet L et al (2009) A review of human carcinogens–Part B: biological agents. Lancet Oncol 10, 321–322. [DOI] [PubMed] [Google Scholar]
- 21. Vilkin A, Levi Z, Morgenstern S, Shmuely H, Gal E, Hadad B, Hardi B and Niv Y (2008) Higher gastric mucin secretion and lower gastric acid output in first‐degree relatives of gastric cancer patients. J Clin Gastroenterol 42, 36–41. [DOI] [PubMed] [Google Scholar]
- 22. Kuo WT, Su MW, Lee YL, Chen CH, Wu CW, Fang WL, Huang KH and Lin WC (2015) Bioinformatic interrogation of 5p‐arm and 3p‐arm specific miRNA expression using TCGA datasets. J Clin Med 4, 1798–1814. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Guo J, Miao Y, Xiao B, Huan R, Jiang Z, Meng D and Wang Y (2009) Differential expression of microRNA species in human gastric cancer versus non‐tumorous tissues. J Gastroenterol Hepatol 24, 652–657. [DOI] [PubMed] [Google Scholar]
- 24. Saito Y, Suzuki H and Hibi T (2009) The role of microRNAs in gastrointestinal cancers. J Gastroenterol 44 (Suppl 19), 18–22. [DOI] [PubMed] [Google Scholar]
- 25. Kent OA and Mendell JT (2006) A small piece in the cancer puzzle: microRNAs as tumor suppressors and oncogenes. Oncogene 25, 6188–6196. [DOI] [PubMed] [Google Scholar]
- 26. Chen Z, Liu X, Hu Z, Wang Y, Liu M, Liu X, Li H, Ji R, Guo Q and Zhou Y (2015) Identification and characterization of tumor suppressor and oncogenic miRNAs in gastric cancer. Oncol Lett 10, 329–336. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Shao S, Li Z, Gao W, Yu G, Liu D and Pan F (2014) ADAM‐12 as a diagnostic marker for the proliferation, migration and invasion in patients with small cell lung cancer. PLoS ONE 9, e85936. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Iba K, Albrechtsen R, Gilpin BJ, Loechel F and Wewer UM (1999) Cysteine‐rich domain of human ADAM 12 (meltrin alpha) supports tumor cell adhesion. Am J Pathol 154, 1489–1501. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Carl‐McGrath S, Lendeckel U, Ebert M, Roessner A and Rocken C (2005) The disintegrin‐metalloproteinases ADAM9, ADAM12, and ADAM15 are upregulated in gastric cancer. Int J Oncol 26, 17–24. [PubMed] [Google Scholar]
- 30. Zhang J, Huang JY, Chen YN, Yuan F, Zhang H, Yan FH, Wang MJ, Wang G, Su M, Lu G et al (2015) Whole genome and transcriptome sequencing of matched primary and peritoneal metastatic gastric carcinoma. Sci Rep 5, 13750. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Du M, Wang W, Jin H, Wang Q, Ge Y, Lu J, Ma G, Chu H, Tong N, Zhu H et al (2015) The association analysis of lncRNA HOTAIR genetic variants and gastric cancer risk in a Chinese population. Oncotarget 6, 31255–31262. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Shin NR, Jeong EH, Choi CI, Moon HJ, Kwon CH, Chu IS, Kim GH, Jeon TY, Kim DH, Lee JH et al (2012) Overexpression of Snail is associated with lymph node metastasis and poor prognosis in patients with gastric cancer. BMC Cancer 12, 521. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Xu J, E C, Yao Y, Ren S, Wang G and Jin H (2016) Matrix metalloproteinase expression and molecular interaction network analysis in gastric cancer. Oncol Lett 12, 2403–2408. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Liao YL, Hu LY, Tsai KW, Wu CW, Chan WC, Li SC, Lai CH, Ho MR, Fang WL, Huang KH et al (2012) Transcriptional regulation of miR‐196b by ETS2 in gastric cancer cells. Carcinogenesis 33, 760–769. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Yang Q, Zhang RW, Sui PC, He HT and Ding L (2015) Dysregulation of non‐coding RNAs in gastric cancer. World J Gastroenterol 21, 10956–10981. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Popovic R, Riesbeck LE, Velu CS, Chaubey A, Zhang J, Achille NJ, Erfurth FE, Eaton K, Lu J, Grimes HL et al (2009) Regulation of mir‐196b by MLL and its overexpression by MLL fusions contributes to immortalization. Blood 113, 3314–3322. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Tsai KW, Hu LY, Wu CW, Li SC, Lai CH, Kao HW, Fang WL and Lin WC (2010) Epigenetic regulation of miR‐196b expression in gastric cancer. Genes Chromosom Cancer 49, 969–980. [DOI] [PubMed] [Google Scholar]
- 38. Wang M, Gu H, Wang S, Qian H, Zhu W, Zhang L, Zhao C, Tao Y and Xu W (2012) Circulating miR‐17‐5p and miR‐20a: molecular markers for gastric cancer. Mol Med Rep 5, 1514–1520. [DOI] [PubMed] [Google Scholar]
- 39. Shrestha S, Hsu SD, Huang WY, Huang HY, Chen W, Weng SL and Huang HD (2014) A systematic review of microRNA expression profiling studies in human gastric cancer. Cancer Med 3, 878–888. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Ribeiro‐dos‐Santos A, Khayat AS, Silva A, Alencar DO, Lobato J, Luz L, Pinheiro DG, Varuzza L, Assumpcao M, Assumpcao P et al (2010) Ultra‐deep sequencing reveals the microRNA expression pattern of the human stomach. PLoS ONE 5, e13205. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Moreira FC, Assumpcao M, Hamoy IG, Darnet S, Burbano R, Khayat A, Goncalves AN, Alencar DO, Cruz A, Magalhaes L et al (2014) MiRNA expression profile for the human gastric antrum region using ultra‐deep sequencing. PLoS ONE 9, e92300. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Gomes LL, Moreira FC, Hamoy IG, Santos S, Assumpcao P, Santana AL and Ribeiro‐Dos‐Santos A (2014) Identification of miRNAs expression profile in gastric cancer using self‐organizing maps (SOM). Bioinformation 10, 246–250. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Darnet S, Moreira FC, Hamoy IG, Burbano R, Khayat A, Cruz A, Magalhaes L, Silva A, Santos S, Demachki S et al (2015) High‐throughput sequencing of miRNAs reveals a tissue signature in gastric cancer and suggests novel potential biomarkers. Bioinform Biol Insights 9 (Suppl 1), 1–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Fig. S1. Venn diagram of MTIs in the groups of miRTarBAse database vs miRWalk database.
Table S1. The original miR–target interactions from the miRWalk database.
Table S2. The original miR–target interactions from the miRTarBAse database.
