Structural dissection of an interaction between transcription initiation and termination factors implicated in promoter-terminator cross-talk

Abstract

Functional cross-talk between the promoter and terminator of a gene has long been noted. Promoters and terminators are juxtaposed to form gene loops in several organisms, and gene looping is thought to be involved in transcriptional regulation. The general transcription factor IIB (TFIIB) and the C-terminal domain phosphatase Ssu72, essential factors of the transcription preinitiation complex and the mRNA processing and polyadenylation complex, respectively, are important for gene loop formation. TFIIB and Ssu72 interact both genetically and physically, but the molecular basis of this interaction is not known. Here we present a crystal structure of the core domain of TFIIB in two new conformations that differ in the relative distance and orientation of the two cyclin-like domains. The observed extraordinary conformational plasticity may underlie the binding of TFIIB to multiple transcription factors and promoter DNAs that occurs in distinct stages of transcription, including initiation, reinitiation, and gene looping. We mapped the binding interface of the TFIIB-Ssu72 complex using a series of systematic, structure-guided in vitro binding and site-specific photocross-linking assays. Our results indicate that Ssu72 competes with acidic activators for TFIIB binding and that Ssu72 disrupts an intramolecular TFIIB complex known to impede transcription initiation. We also show that the TFIIB-binding site on Ssu72 overlaps with the binding site of symplekin, a component of the mRNA processing and polyadenylation complex. We propose a hand-off model in which Ssu72 mediates a conformational transition in TFIIB, accounting for the role of Ssu72 in transcription reinitiation, gene looping, and promoter-terminator cross-talk.

Introduction

TFIIB is an essential general transcription factor and a necessary component of the RNA polymerase II (pol II)³ preinitiation complex (PIC) along with TFIIA, TFIID, TFIIE, TFIIF, and TFIIH. TFIIB is a multidomain protein that is composed of an N-terminal zinc ribbon domain for pol II binding (1–4), a finger/reader domain for transcription start site selection and de novo transcription initiation (1, 4–6), and two C-terminal cyclin-like domains that form a ternary complex with the TATA box DNA and TATA box–binding protein (TBP) (7, 8) (Fig. 1A). TFIIB makes sequence-specific interactions with the TFIIB recognition elements (BREs) found both upstream (BREu) and downstream (BREd) of the TATA box (8–10), a structural feature that helps impose promoter directionality (11). After a ∼6–12-nucleotide nascent transcript is synthesized, TFIIB is ejected from PIC, and pol II escapes from the promoter (12–14).

Figure 1.

Structure of human TFIIB_c in two new conformational states. A, schematic domain organization of human TFIIB, with individual domains and regions labeled. B, structure of the two conformations of human TFIIB_c found in the asymmetric unit of the crystal. Domains are color-coded according to A.

TFIIB and TBP are the targets of the acidic activation domain of herpes simplex virus VP16 (VP16AD), which stimulates transcription by interacting with multiple transcription co-activator complexes, histone-modifying complexes, and chromatin remodeling complexes (15). One mechanism of transcriptional activation suggests that VP16AD displaces the intramolecular interaction between the N-terminal region of TFIIB (TFIIB_n) and the cyclin-like domain-containing core region (TFIIB_c), converting TFIIB to an active conformation for PIC assembly (16–21).

TFIIB interacts both genetically and physically with the termination factor Ssu72 (suppressor of sua7, gene 2) (22–24). Ssu72 dephosphorylates serine 5 and serine 7 in the C-terminal domain (CTD) of the pol II subunit Rpb1 during transcription termination, allowing dephosphorylated pol II to reinitiate for another round of transcription (25–27). Ssu72 binds to the N-terminal region of an RNA-processing protein, symplekin, which stimulates the phosphatase activity of Ssu72 (28). Both Ssu72 and symplekin are involved in pre-mRNA 3′-end cleavage and polyadenylation in yeast and human (24, 29).

Transcription-coupled functional cross-talk between promoters and terminators has long been noted. The general transcription factor TFIID, consisting of TBP and TBP-associated factors, was shown to recruit cleavage and polyadenylation specificity factor CPSF, to which both Ssu72 and symplekin are also bound on terminators (30, 31). In addition to Ssu72, TFIIB also interacts with the CstF64 (homolog of Rna15 in yeast) component of the cleavage stimulation factor (CstF). In particular, TFIIB phosphorylation on serine 65 is crucial for this interaction and for CstF occupancy on promoters as well (32, 33). Furthermore, both TFIIB and the general transcription factor TFIIF were found to be associated with and modulate the enzymatic activity of another pol II CTD phosphatase, Fcp1, which is involved in dephosphorylation of serine 2 on CTD (34, 35). Deletion of the transcription termination factor Pcf11 depletes TFIIB and TBP from promoters (36). Notably, a point mutation of the polyadenylation site causes defects in transcription initiation (36).

These functional connections between promoters and terminators may be understood in the framework of chromatin looping. Chromatin looping is a phenomenon in which distal genomic elements are brought within close spatial proximity of each other to influence transcription. Looping occurs between enhancer elements and promoters, intergenic regions and promoters, and promoters and terminators. Promoter-terminator gene looping was first discovered in Saccharomyces cerevisiae and was later shown to be present in other organisms, such as human and plants, as well as in mitochondria and HIV (37–44). Promoter-terminator gene looping is believed to facilitate pol II recycling during transcription reinitiation (45, 46). It is also involved in sustaining transcriptional memory and enhancing transcription directionality (47–49).

TFIIB and Ssu72 occupy both promoters and terminators and are required for gene loop formation (49, 50). Mutation of TFIIB or Ssu72 abolishes gene looping in yeast, as demonstrated by chromatin conformation capture (3C) assays (49, 50). Loss of Ssu72 leads to defects in TFIIB recruitment to promoters and elimination of TFIIB from terminators (50) (data not shown). To begin to reveal the mechanism of transcription-dependent promoter-terminator cross-talk that may be achieved at least in part through the interaction between TFIIB and Ssu72, we first conducted structural analysis of the core domain of human TFIIB captured in two new conformations. We next carried out systematic, structure-guided mapping of the binding interface of the TFIIB-Ssu72 complex using a series of in vitro binding assays and photocross-linking analysis based on site-specifically incorporated unnatural amino acids. We also generated a knowledge-based structural model for the TFIIB-Ssu72 complex. We propose a handoff mechanism to explain the role of the TFIIB-Ssu72 interaction in facilitating pol II reinitiation.

Results

The core domain of TFIIB displays a large degree of conformational plasticity

We solved the crystal structure of human apo-TFIIB_c to 3.4 Å resolution by molecular replacement, with four molecules per asymmetric unit (Table 1 and Fig. S1, labeled as Molecules A–D). TFIIB_c forms two distinct, previously uncharacterized conformations (Fig. 1B). Molecules A and B are found in one conformation, and C and D are in the other conformation; for simplicity, we will only discuss molecules A and D further (Fig. 1B). Notably, each conformation is characterized by prominent translational and rotational movement of the two cyclin-like domains along the flexible C-linker between them (Fig. 1, A and B). Whereas the secondary structure of each individual cyclin-like domain remains the same, their orientation and distance with respect to each other differ (Fig. S2, A and B).

Table 1.

Data collection and refinement statistics (molecular replacement)

Data were collected from a single crystal.

Crystal	TFIIBc
Data collection
Space group	P212121
Cell dimensions
a, b, c (Å)	108.2, 126.5, 158.4
α, β, γ (degrees)	90, 90, 90
Resolution (Å)	50.00–3.40 (3.46–3.40)a
Rmerge	0.238 (0.00)b
Rpim	0.144 (0.960)
I/σI	9.15 (1.20)
Completeness (%)	100.0 (100.0)
Redundancy	7.2 (7.2)
CC1/2	(0.546)
Refinement
Resolution (Å)	50.00–3.40 (3.46–3.40)
No. of reflections	30,767
Rwork/Rfree	0.194/0.214
No. of atoms	6640
Protein	6510
Sulfate	130
Water	0
Average B-factors (Å2)
Protein	103.28
Sulfate	155.14
Water	0
Root mean square deviations
Bond lengths (Å)	0.010
Bond angles (degrees)	1.24
Ramachandran plot
Favored	95.4
Allowed	3.5
Outliers	1.1

^a Values in parentheses are for highest-resolution shell.

^b HKL2000 does not include values >1.

Our structure reveals an unprecedented degree of plasticity of TFIIB_c, although we also note that the conformations of TFIIB_c from our structure, like all crystal structures, are partially influenced by crystal packing. Although we cannot say for certain the extent to which these conformations occur in vivo, in the following, we interpret how this plasticity would influence the biological roles of TFIIB. Two separate conserved regions that would contact the TATA box (e.g. residues Arg¹⁸⁹ and Lys¹⁹³ on helix H5), the BREu (e.g. residues Ala²⁸¹, Val²⁸³, Arg²⁸⁶, and Arg²⁹⁰ on helix H5′), and BREd (e.g. residues 152–154 between helices H2 and H3) are solvent-accessible in both molecules A and D (Fig. 2A). However, they are not spatially aligned and hence in an inactive conformation compared with their counterparts in TFIIB_c bound to TBP and the TATA box, where the two cyclin-like domains are orientated to allow simultaneous binding of helix H5 to the TATA box, the C-linker to TBP, helix H5′ to the BREu, and the loop between H2 and H3 to the BREd (Fig. 2B and Fig. S3A) (8). Interestingly, apo-TFIIB_c from Trypanosoma brucei follows essentially the same conformation as human TFIIB_c in the active ternary complex, with the exception that the C-linker is replaced by a rigid bent helix (51), implying that T. brucei TFIIB may always assume an active conformation regardless of whether TBP and the TATA box are bound (Fig. 2C and Fig. S3B).

Figure 2.

Sequence alignment and structural comparison of TFIIB_c. A, sequence alignment of TFIIBc from Homo sapiens (Hs), S. cerevisiae (Sc), D. melanogaster (Dm), and T. brucei (Tb). Secondary structural domain organization is labeled based on the human TFIIBc structures determined in this report. Residues mutated in experiments are labeled by blue triangles. B, alignment of TFIIBc molecule D (color-coded according to Fig. 1A) with human TFIIBc from the TFIIB_c-TBP_c-DNA structure (PDB code 1C9B, TFIIBc in gray schematic, DNA in multicolor schematic, and TBP_c omitted). Cyclin-like domain 1 of molecule D was aligned with that of TFIIBc from 1C9B. In the subsequent panels, alignment follows the same scheme, except that the second TFIIB molecule was first aligned with TFIIBc from 1C9B to allow for modeling of the DNA. C, alignment of molecule D with TFIIBc from T. brucei (PDB code 3H4C; magenta). D, alignment of molecule D with human TFIIBc determined by NMR (PDB code 1TFB; cyan). The same TATA box DNA molecule from B is shown in C and D as well to guide the view. The purpose of the structural alignment in B, C, and D is to illustrate the conformational plasticity but not the actual new conformations of TFIIB_c. E, electromobility shift assay with E4 promoter DNA, TBP_c, and TFIIB variants.

Molecules A and D are also distinct from the inactive conformation of a human apo-TFIIB_c determined previously by NMR (Fig. 2D and Fig. S3C) (20, 52). In the latter case, the two cyclin-like domains are stably packed against each other such that about 1900 Ų of solvent-accessible surface area is buried. In stark contrast, the same two domains in the current structures barely contact one another, displaying an extraordinary rotational and translational plasticity that is probably subjected to cellular regulation. In line with this proposal, residues Arg²⁸⁶ and Arg²⁹⁰ from helix H5′ of the second cyclin-like domain change conformation when interacting with the archetypal acidic activator VP16 (20, 53). Thus, it appears possible that TFIIB_c can assume multiple flexible, inactive conformations.

The C-linker of TFIIB is involved in ternary complex formation (7, 8). Interestingly, this region varies in length between species (Fig. 2A). To test whether the relative position of the two cyclin-like domains in TFIIB_c is controlled by the C-linker, we appended a GSGS linker directly C-terminal of residue Leu²⁰⁸ located in the middle of the C-linker. This TFIIB_c variant was found to bind TBP and the TATA box DNA to the same extent as wild-type protein (Fig. 2E, WT and GSGS-C), which agrees with the evolutionary divergence of TFIIB, in that S. cerevisiae TFIIB has an extended C-linker beyond residue Leu²⁰⁸ compared with human and fly TFIIB but still retains the ability to bind TBP and the TATA box (Fig. 2A). In contrast, the precise arrangement of the first part of the C-linker is critical for formation of the TFIIB_c-TBP-TATA ternary complex (8), and replacing residues 200–208 with a GSG linker or adding a GSGS linker directly N-terminal of residue Lys²⁰⁰ significantly decreased formation of the TFIIB_c-TBP-TATA box ternary complex (Fig. 2E, GSGS-C and GSGS-N). Overall, our results indicate that the semiconservative C-linker is not the only determinant of the active TFIIB_c conformation.

Ssu72 binds to the first cyclin-like domain of TFIIB_c

Previous studies have implicated a direct physical interaction between TFIIB and Ssu72 (23, 24). To understand the molecular basis of this interaction, we first measured the binding affinity between TFIIB_c and Ssu72 by isothermal titration calorimetry (ITC), which was estimated to be around 20.2 μm (Fig. 3A). Next, we conducted pulldown assays of C-terminal FLAG-tagged human TFIIB with His₆-tagged Ssu72. Human TFIIB constructs used for these assays included full-length TFIIB (TFIIB_FL), TFIIB_c (residues 107–316), and the isolated cyclin-like domain 1 (TFIIB_c1; residues 107–206) and 2 (TFIIB_c2; residues 207–316). Whereas TFIIB_FL, TFIIB_c, and TFIIB_c1 all bound to Ssu72, TFIIB_c2 could not do so (Fig. 3B), indicating that the first cyclin-like domain of TFIIB_c serves as the minimal region of TFIIB for Ssu72 binding. TFIIB_c2 is required for the full Ssu72-binding activity of TFIIB; in its absence, the binding of TFIIB_c1 to Ssu72 became too weak to be detected by ITC (Fig. S4). Interaction of TFIIB_c with Ssu72 did not appear stoichiometric in the pulldown analysis, probably due to the relatively weak interaction, as indicated by the ITC results. However, the interaction is specific, as is detailed in the studies that follow.

Figure 3.

Physical interaction of TFIIB_c and Ssu72. A, ITC experiment of Ssu72 and TFIIBc. The best fit K_d value (95% confidence interval) is 20.2 (16.8–24.4) μm. B, FLAG pulldown assay with TFIIB-FLAG variants and His₆-Ssu72, as visualized by Coomassie staining and Western blotting with a His₆ antibody. *, IgG light chain that leeched from the resin upon elution with glycine. C, FLAG pulldown assay with TFIIBc-FLAG mutants and His₆-Ssu72. D, FLAG pulldown assay with TFIIBc-FLAG WT and mutants from various species (top labels) with His₆-Ssu72 from the corresponding species as visualized by Western blotting with a His₆ antibody. In the figure, h represents human, d is D. melanogaster, and y is S. cerevisiae. Lanes labeled with FLAG indicate controls without TFIIBc added.

Charge reversal mutation of any pair of the positively charged residues Arg¹⁸⁵, Lys¹⁸⁹, Arg¹⁹³, and Lys²⁰⁰ from helix H5 or the linker between helices H4 and H5 in TFIIB_c1 decreased binding to Ssu72 compared with wild-type TFIIB_c, and the K189E/R193E mutation essentially abolished the interaction (Fig. 3C). All TFIIB_c variants were monomeric by gel filtration chromatography analysis, indicating that the mutations did not significantly perturb protein structure (Fig. S5). Thus, a positively charged surface of TFIIB_c1 proves to be necessary for Ssu72 binding. Intriguingly, an overlapping set of residues from this region of TFIIB_c1 is also implicated in promoter DNA and acidic activator binding (8, 20).

In addition, we tested whether the binding interface between TFIIB_c and Ssu72 was conserved across species using purified proteins from S. cerevisiae (yTFIIB_c and ySsu72) and Drosophila melanogaster (dTFIIB_c and dSsu72). In both cases, TFIIB and Ssu72 were found to interact directly (Fig. 3D). Notably, whereas critical interacting residues Lys¹⁸⁹ and Arg¹⁹³ of human TFIIB are fairly conserved in yeast (as Lys²⁰¹ and Lys²⁰⁵, respectively; Fig. 2A), residues Arg¹⁸⁵ and Lys²⁰⁰ are not conserved (His¹⁹⁷ and Asn²¹² in yeast; Fig. 2A). In the pulldown assays, the conserved K201E/K205E mutation of yTFIIB abolished the interaction with ySsu72 in a manner similar to the human mutation. All yTFIIBc mutants were monomeric by gel filtration analysis, indicating that mutation did not disrupt normal protein structure (Fig. S5). Surprisingly, the H197E/N212E mutation of yTFIIB also significantly reduced binding to ySsu72 (Fig. 3D), suggesting that the mode of interaction between TFIIB and Ssu72 is highly conserved from yeast to humans despite differences in protein sequence.

TFIIB_c interacts with an Ssu72 surface formed by three discrete sequence patches

To probe Ssu72 residues responsible for TFIIB_c binding, we used a site-specific photocross-linking approach based on incorporation of the unnatural amino acid p-benzoyl-l-phenylalanine (pBpa) via suppression of an amber stop codon (54, 55). Under UV illumination, pBpa can cross-link to residues on a binding protein within 2.4–4 Å, allowing for a clear readout of protein-protein interactions (56). Based on analysis of the human Ssu72-symplekin structure (28), several residues of Ssu72 with surface-exposed side chains were chosen for substitution. A cluster of negatively charged residues (positions 171–181) were chosen under the assumption that they may interact with positively charged residues of TFIIB_c1 important to interaction (Fig. 3C). Residues around the interface with symplekin (28) were also chosen under the hypothesis that they may form a similar binding interface with TFIIB.

Ssu72 surface residues that were substituted for pBpa included Glu¹²⁷, Gln¹²⁸, Thr¹³⁰, Cys¹³¹, Pro¹³³, Asp¹⁶⁹, Glu¹⁷³, Leu¹⁸⁸, Phe¹⁹³, and Tyr¹⁹⁴. Strong UV-dependent cross-linking to TFIIB was observed for all of the pBpa substitutions except E127pBpa, L188pBpa, and Y194pBpa (Fig. 4A). In agreement with the results from the pulldown assays, no cross-linking was observed with the K189E/R193E mutant of TFIIB_c that loses the Ssu72-binding capacity (Fig. 4B). The photocross-linkable substitutions are clustered on an Ssu72 surface on the back of its substrate-binding site, outlining an elongated TFIIB binding surface (Fig. 4C, green dashed outline).

Figure 4.

Photocross-linking–based structural mapping of TFIIB_c binding interface on Ssu72. A, cross-linking assays with TFIIBc-FLAG and Ssu72-pBpA substituted mutants, visualized by Western blotting with FLAG and His₆ antibodies. B, cross-linking of TFIIBc-FLAG mutant (Mut) with Ssu72-pBpA variants, visualized by His₆ antibody Western blotting. C, modeling of TFIIB-interacting residues determined by pBpA cross-linking onto the structure of human Ssu72 (from the Ssu72-symplekin structure, PDB code 3O2Q). The TFIIB-interacting surface is labeled by green outline, and residues essential for symplekin binding are labeled by blue outline. D, cross-linking assays of TFIIBc-FLAG and Ssu72-pBpA substituted mutants from the negatively charged helix region as visualized by Western blotting with FLAG and His₆ antibodies. E, cross-species cross-linking of S. cerevisiae TFIIBc (y) with human Ssu72 (h) visualized by Western blotting. The topmost bands in the anti-FLAG blot are bands that are present regardless of UV illumination (Nonspecific). F, sequence alignment of Ssu72 from human (Hs), fly (Dm), and yeast (Sc). Green plus signs indicate pBpA-substituted residues in humans that cross-link to TFIIBc, whereas yellow minus signs are residues that do not cross-link to TFIIB. Orange triangles, residues critical for symplekin interaction.

Residues 128–133 of Ssu72 form a loop that is partially buried in the Ssu72-symplekin complex (28) (Fig. 4C and Fig. S5). Residue Asp¹⁶⁹ sticks out of a helix opposite to this loop and approaches residue Pro¹³³. Residue Glu¹⁷³ is further down in the same helix and both Asp¹⁶⁹ and Glu¹⁷³ are a part of a negatively charged, surface-exposed patch that also includes residues Glu¹⁷¹, Glu¹⁷⁴, and Glu¹⁸¹ (Fig. 4C, green sticks). When any of these residues are mutated to pBpa, cross-linking to TFIIB_c was observed (Fig. 4D). Residue Phe¹⁹³ was known to be critical for symplekin binding, and it now appears to contribute to the TFIIB-binding surface as well (Fig. 4C and Fig. S6) (28). Residues Glu¹²⁷ and Leu¹⁸⁸ are located close to but outside of the TFIIB-binding surface, and residue Tyr¹⁹⁴ is partially buried during Ssu72 folding (Fig. 4C, yellow sticks). These facts not only account for the negative photocross-linking results upon UV illumination for the corresponding pBpa substitutions but also support the remarkable specificity of photocross-linking offered by pBpa. Thus, three discrete and spatially proximate patches (i.e. regions centered on residues 128–133, residues 169–181, and residue 193) of Ssu72 form the binding surface for TFIIB (Fig. 4C).

To support the conservation of Ssu72-TFIIB binding, we further showed that the pBpa substitutions of human Ssu72 within the three TFIIB binding patches cross-linked to yeast TFIIB_c. The cross-linking was abolished when the K201E/K205E mutant of yeast TFIIB_c was attempted (Fig. 4E), indicating that the binding mode between TFIIB and Ssu72 is highly conserved across species, although one of the three patches exhibits poor sequence conservation (Fig. 4F).

TFIIB and symplekin bind to overlapped Ssu72 surfaces

Ssu72 is known to form a stable complex with the N-terminal region (residues 30–360) of symplekin (referred to below as Symp-N) (28). In our pulldown assays, TFIIB was unable to interact with Ssu72 in the presence of Symp-N, indicating that the binding sites for TFIIB and Symp-N overlap on the Ssu72 surface (Fig. 5A). To further delineate the competitive binding of TFIIB and Symp-N to Ssu72, we utilized a competition photocross-linking assay. Ssu72 with the pBpa substitutions were prebound with an excess of either TFIIB_c or Symp-N, incubated with the competitor protein, and UV-cross-linked. Symp-N strongly cross-linked to Ssu72 C131pBpa (Fig. 5B, lane 2). When cross-linked in competition with TFIIB_c, only the cross-linked Ssu72–Symp-N but not Ssu72-TFIIB complex was visible (Fig. 5B, lane 6), which indicates that Symp-N outcompetes TFIIB in Ssu72 binding, probably due to a higher binding affinity (Fig. 5A). Notably, Ssu72 F193pBpa cross-linked to Symp-N in a much weaker manner compared with Ssu72 C131pBpa (Fig. 5B, compare lanes 2 and 8), possibly because the former disturbs Symp-N binding (28). The weaker interaction between Ssu72 F193pBpa and Symp-N allowed TFIIB_c to cross-link to Ssu72 to a similar degree in both the presence and absence of an excess of Symp-N (Fig. 5B, compare lanes 10 and 12). In a similar experiment, the K185A mutant of Symp-N that weakens Ssu72 binding also allowed photocross-linking between Ssu72 and TFIIB_c (Fig. 5C, lane 6) (28). Overall, our results indicate that Ssu72 contains an overlapping yet not identical binding surface for TFIIB_c and symplekin.

Figure 5.

Competition of TFIIB_c and symplekin for Ssu72 binding. A, competition pulldown with TFIIBc, Ssu72, and the N-terminal fragment of symplekin (Symp-N) as visualized by Coomassie staining. Lanes labeled FLAG contained only FLAG peptide as a control. Lanes labeled TFIIBc FT depict the flow-through proteins of the experimental samples that fail to bind to the resin. #, free IgG heavy chain; *, free IgG light chain that leeched from the resin during glycine elution. B, competition cross-linking between TFIIBc and symplekin for Ssu72 pBpA mutants as visualized by His₆ antibody Western blotting. C, competition cross-linking assay with symplekin K185A mutant.

Although binding to an overlapped Ssu72 surface, unlike symplekin, TFIIB did not enhance the intrinsic phosphatase activity of Ssu72. In addition, TFIIB did not dramatically influence the stimulation of Ssu72 catalysis by symplekin, even in large excess (Fig. S7), confirming that TFIIB cannot outcompete symplekin for Ssu72 binding, at least at the concentration used in our assays.

Ssu72-binding site on TFIIB_c overlaps with the VP16AD- and TFIIB_n-binding site

Two additional interactions mediated by TFIIB_c were noted to influence transcription initiation, including VP16AD acidic activator binding and TFIIB_n binding, in the context of a TFIIB intramolecular complex. Because Ssu72 binds to a similar region of TFIIB_c as VP16AD and TFIIB_n, we further investigated such functional cross-talk with the photocross-linking competition assays.

We first established that TFIIB_c could be photocross-linked to an N-terminal SUMO fusion of TFIIB_n (residues 1–106) with a pBpa substitution at residue Trp⁵² located in the finger/reader region (Fig. 6A, compare lanes 1 and 2). In the competition assays, we next observed that unlabeled Ssu72 decreased TFIIB_c-TFIIB_n cross-linking compared with the GST control, probably due to competitive binding of Ssu72 and TFIIB_n to TFIIB_c (Fig. 6A, compare lanes 3 and 4 with lanes 6 and 7). In a reciprocal competition cross-linking experiment, GST-tagged TFIIB_n could barely disrupt TFIIB_c-Ssu72 cross-linking compared with the GST control (Fig. 6B, compare lanes 4 and 6 with lane 12), indicating that TFIIB_n displays a comparable or a lower binding affinity toward TFIIB_c when compared with Ssu72. Conversely, GST-tagged VP16AD efficiently prevented cross-linking between Ssu72 and TFIIB_c (Fig. 6B, compare lanes 8 and 10 with lanes 4 and 6). Accordingly, we conclude that Ssu72 may open up the inhibitory TFIIB_c-TFIIB_n intramolecular complex to facilitate pol II transcription with a similar mechanism used by VP16AD (16–21).

Figure 6.

Disruption of TFIIB autoinhibition by Ssu72. A, competition cross-linking between SUMO TFIIBn W52pBpA and Ssu72 for TFIIBc WT visualized by anti-FLAG Western blotting. Lanes labeled Mut utilized the TFIIBc K189E/R193E mutant. Bottom, TFIIBc-FLAG becomes distorted in some lanes due to GST that runs in a position similar to that of TFIIBc. B, competition cross-linking assay between Ssu72 C131pBpA and either GST-TFIIBn or GST-VP16AD for TFIIBc as visualized by FLAG antibody Western blotting.

A computational model predicts the interactions of TFIIB_c and Ssu72

To further elucidate how the residues identified by our experiments interact on the TFIIB_c-Ssu72 interface, we devised a computational approach combining molecular dynamics (MD) simulations and knowledge-based protein-protein docking. Our approach successfully generated an interface model that agrees with all experimental observations. This model suggests a mechanism whereby Ssu72 activates TFIIB for reinitiation. Moreover, the model includes additional, hypothetical TFIIB_c and Ssu72 interactions that may represent secondary binding interfaces.

We first performed MD simulations of TFIIB_c and Ssu72 separately. We observed that whereas Ssu72 is a rigid protein, TFIIB_c is highly flexible (Fig. S8), in line with our structural observations analyzed above (Fig. 1B). Therefore, we extracted TFIIB_c structures from the MD simulations that may potentially bind to Ssu72 (example in Fig. S9) and then performed protein-protein docking to generate the binding models. Models with low HADDOCK score (less negative) and experimental violation were disregarded, resulting in a final high-quality model that best fits the experimental results.

In this model, the cross-linked residues on Ssu72 are very close to TFIIB_c1. A 60-ns MD simulation of this model revealed that the average D2 distance of all cross-linked residues is well below the threshold value (Fig. 7A), indicating that this binding interface is rather stable. Consistent with the mutagenesis experiment on Lys²⁰⁰, Arg¹⁸⁹, and Arg¹⁹³ of TFIIB_c, four salt bridges are found on the interface: Lys²⁰⁰-Glu¹²¹, Lys²⁰⁰-Asp¹¹⁷, Lys¹⁸⁹-Glu¹⁶⁷, Arg¹⁹³-Glu¹⁶⁹, with the TFIIBc residues underlined (Fig. 7B, bottom). These salt bridges are mostly mediated by TFIIB_c1, consistent with its dominant role in Ssu72 binding as shown by our pulldown assay (Fig. 3B). Additional interactions include the salt bridges Lys¹⁵²-Glu¹²⁷, Lys¹⁸⁸-Asp¹⁷³, Arg²⁹⁰-Glu¹⁸¹, Lys²⁷²-Glu¹⁷⁴, and Arg²⁸⁶-Glu¹⁷⁸. The last three interactions involve residues of TFIIB_c2. Probably, these interactions are weaker compared with those of TFIIB_c1 because TFIIB_c2 is not sufficient to pull down Ssu72 (Fig. 3B), and mutation of TFIIB_c1 abolishes interaction with Ssu72 (Figs. 3C and 4B).

Figure 7.

Structural modeling of a TFIIB_c-Ssu72 complex. A, average D2 distance of all cross-linked residues on Ssu72 in the last 60-ns MD simulation of the TFIIBc-Ssu72 complex are shown as a bar graph. The threshold (15 Å) is shown as a green line. Error bars, S.D. B, model of the TFIIB-Ssu72 complex. Ssu72 is shown in gray, TFIIB_c1 is yellow, and TFIIB_c2 is black. Red or blue sticks represent negatively or positively charged residues, respectively. The inset shows a closer view of salt bridge interactions of TFIIB_c1 residues Lys¹⁸⁹, Arg¹⁹³, and Lys²⁰⁰ with Ssu72 residues Asp¹⁶⁷, Glu¹⁶⁹, Asp¹¹⁷ and Glu¹²¹ of Ssu72.

Discussion

Whereas the role of TFIIB in transcription initiation is well established, its role in other processes such as gene looping is not clear. The current study sheds light on possible new roles of TFIIB in this process by revealing a structure of human TFIIB_c that adopted two new conformations. We also examined interactions between TFIIB_c and Ssu72 and other factors known to interact with these two proteins, such as VP16AD and symplekin, respectively.

The structure of human TFIIB_c displays the dynamic nature of the protein and indicates that conformational plasticity of TFIIB may underlie a mechanism for functional control. Apo-TFIIB is in an autoinhibited, “closed” conformation where TFIIB_n blocks the TBP and the TATA DNA-binding region of TFIIB_c (16–21) (Fig. 8, “Closed” Autoinhibited state). VP16AD displaces TFIIB_n by interacting with an overlapping surface on TFIIB_c, promoting the structural conversion of TFIIB to an “open” conformation (20) that is then stabilized by TBP, TATA DNA, and other components of the transcription machinery during initiation. Both conformations of TFIIB_c revealed by our study are essentially transcriptionally inactive because the two cyclin-like domains and C-linker are not aligned to interact with TBP and the TATA DNA due to intrinsic conformational flexibility, although structural elements for these functional interactions are all surface-exposed. The structural transition from an inactive conformation to an active conformation may be subjected to additional cellular regulation.

Figure 8.

A schematic model that illustrates a possible role of the TFIIB_c-Ssu72 complex in pol II transcription reinitiation. A “hand-off” model may explain the conceivable role of Ssu72 in pol II reinitiation by modulating TFIIB conformation, in a manner similar to the archetypal acidic activator VP16. Arrows, relative orientations of the cyclin domains of TFIIB_c. Ssu72 may further maintain the relative orientation of the two cyclin-like domains in an active conformation.

We showed that Ssu72 predominantly interacts with the TATA-binding region of cyclin-like domain 1 of TFIIB_c (TFIIB_c1) and that residues Arg¹⁸⁹ and Arg¹⁹³ are critical for binding (Fig. 3C). This region is also a binding site of VP16AD, suggesting that Ssu72 could function to transition TFIIB from a closed to an open conformation in a similar manner (Fig. 8). Indeed, similar to VP16AD, Ssu72 can easily outcompete the binding of TFIIB_c to TFIIB_n, indicating that it can at least relieve TFIIB from autoinhibition (Fig. 8). In addition, our computational study provides a possibility that Ssu72 may further form a stable complex with the active form of TFIIB_c (Fig. 8, “Open” Active state). The open active state of TFIIB_c maintained by Ssu72 may facilitate formation of the TFIIB-TBP-TATA ternary complex through a “hand-off” model. This process may occur during transcription reinitiation in the context of a gene loop, through a reinitiation scaffold complex on a TATA promoter that contains TBP but not TFIIB (14). The hand-off model in transcriptional regulation has also been proposed previously for transcriptional activators (57).

Interaction between TFIIB and Ssu72 is well conserved from yeast to flies and humans (Fig. 3D), suggesting a likely functional conservation. TFIIB binds to Ssu72 over an extended surface that includes a negatively charged helix, a loop, and a region near the C terminus of the protein. The latter two TFIIB-binding regions overlap with the binding surface of symplekin, which precludes TFIIB from binding to Ssu72. The Ssu72-symplekin interaction is strong, but it can be disrupted by a point mutation of Phe¹⁹³ of Ssu72 that does not impede TFIIB binding. Interestingly, residue Phe¹⁹³ is close to several conserved serine, threonine, and tyrosine residues. Although we have not found a known phosphorylation motif in this area, it is possible that phosphorylation or other posttranslational modification of the C terminus of Ssu72 could be used to weaken the interaction with symplekin such that TFIIB binding is allowed.

The fact that TFIIB and Ssu72 physically interact yet are involved in disparate steps of transcription, initiation and termination, respectively, is intriguing. In the context of promoter-terminator gene looping, one can imagine a mechanism in which Ssu72 dephosphorylates the CTD of pol II during transcription termination, recruits TFIIB, and keeps it in an open conformation to allow for reassembly of PIC on the promoter for subsequent rounds of transcription. This hypothetical mechanism would explain why both TFIIB and Ssu72 are required for gene looping, and it can be further tested with separation-of-function mutants in future studies.

Materials and methods

Protein expression and purification

All proteins were produced recombinantly in Escherichia coli. DNA sequences for each protein were cloned into a pET28a vector (containing an N-terminal His₆ tag), a SUMO-pET28a vector (containing a His₆ SUMO tag), or pGEX4T1 (containing an N-terminal GST tag). All mutations were introduced by site-directed mutagenesis of the parental plasmid. Expression plasmids were transformed into BL21*(DE3)-Rosetta II cells and cultured in LB medium supplemented with 50 μg/ml chloramphenicol and either 50 μg/ml kanamycin or 100 μg/ml ampicillin and cultured at 37 °C until reaching an A₆₀₀ of 0.6, at which point a final concentration of 0.5 mm isopropyl 1-thio-β-d-galactopyranoside was added, and cells were incubated overnight at 16 °C.

All TFIIB proteins, with the exception of GST-TFIIBn, were purified by nickel chromatography and contained a His₆-SUMO tag and C-terminal FLAG tag. Cell pellets were resuspended in lysis buffer (20 mm HEPES, pH 8.0, 500 mm NaCl, 10 mm imidazole, and 2 mm β-mercaptoethanol) and lysed by sonication. Following centrifugation, the cleared lysate was applied to HisPure nickel resin (Thermo Scientific), the resin was washed with 20 column volumes of lysis buffer, and proteins were eluted with elution buffer (20 mm HEPES, pH 8.0, 500 mm NaCl, 300 mm imidazole, and 2 mm β-mercaptoethanol). Proteins that contained the N terminus of TFIIB (i.e. TFIIB_FL and TFIIB_n) additionally contained 10 μm zinc acetate in all buffers. The His₆-SUMO tag was removed by Ulp1 cleavage overnight during dialysis into low imidazole buffer (20 mm HEPES, pH 8.0, 300 mm NaCl, 10 mm imidazole, and 2 mm β-mercaptoethanol). Proteins were then reapplied to a new nickel column to remove Ulp1 and contaminants, and the flow-through was collected. Proteins were dialyzed into a low-salt buffer (HEPES, pH 7.0 or 8.0, 100 mm NaCl, 10 mm imidazole, and 2 mm β-mercaptoethanol) and then applied to either a HiTrap heparin column (human TFIIB_FL wild type and mutants) or a MonoS 5/50 column (human TFIIBc, TFIIB cyclin-like 1, and TBP_c) and eluted with a gradient of NaCl (both columns were from GE Healthcare). The crystallized human TFIIBc that lacked a C-terminal FLAG tag was concentrated following the MonoS 5/50 column and then loaded onto a Superdex 200 10/300 GL column (GE Healthcare) in 20 mm HEPES, pH 8.0, 150 mm NaCl, and 1 mm DTT. Because TFIIB cyclin-like 2 and TFIIBc mutants (human K189E/K200E, R185E/R193E, R185E/K200E, K189E/R193E; yeast H197E/N212E and K201E/K205E) failed to bind to heparin, they were passed through a MonoQ 5/50 column (GE Healthcare) to remove contaminants, and the flow-through was collected.

All Ssu72 and N-terminal symplekin (residues 30–360) proteins contained an N-terminal His₆ tag and were purified by nickel chromatography followed by dialysis into a low-salt buffer (HEPES, pH 8.0, 100 mm NaCl, and 2 mm β-mercaptoethanol) and a final MonoQ purification step. To assemble the Ssu72-symplekin complex, Ssu72 was mixed with symplekin in a 2:1 molar ratio, incubated on ice for 1 h, and then separated on a Superdex 200 10/300 GL column in 20 mm Tris, pH 8.5, 200 mm NaCl, and 10 mm DTT. Fractions containing the complex were pooled, concentrated, and stored at −80 °C until use.

Cells containing GST fusion proteins (TFIIBn and VP16AD) were lysed by sonication in GST lysis buffer (50 mm Tris, pH 8.0, 150 mm NaCl, and 5 mm DTT), and clarified lysate was bound to glutathione-agarose (Thermo Scientific). The resin was washed with 20 column volumes of GST lysis buffer and eluted with lysis buffer containing 20 mm reduced glutathione. The proteins were then applied to a MonoQ 5/50 column and eluted over a gradient of NaCl. Following purification, all proteins were concentrated, flash-frozen in liquid nitrogen, and stored at −80 °C until needed.

For Ssu72 proteins containing pBpA mutations, the Ssu72 plasmid containing the amber mutation of interest was transformed into BL21* (DE3) cells containing the pEVOL-pBpA plasmid that encodes for an evolved aminoacyl tRNA synthetase and tRNA that incorporate pBpA into the amber suppression site (55). Cells were cultured at 37 °C in 100 ml of 2XYT medium supplemented with 50 μg/ml chloramphenicol and 50 μg/ml kanamycin. At an A₆₀₀ of 0.3, a final concentration of 0.2% arabinose was added to the culture. At an A₆₀₀ of 0.6, a final concentration of 1 mm isopropyl 1-thio-β-d-galactopyranoside and 1 mm pBpA were added to the culture, and the culture was then allowed to incubate overnight at 30 °C. Proteins were purified in a manner similar to that described for Ssu72 by nickel and Q Sepharose Fast Flow (GE Healthcare) chromatography. SUMO-TFIIBn-W52pBpA, containing an N-terminal His₆ tag, was expressed in the same manner as Ssu72-pBpA proteins. It was purified by nickel chromatography in a manner similar to other His-tagged proteins, with the addition of 10 μm zinc acetate in all purification buffers.

Protein crystallization, data collection, and structure solution and refinement

Human TFIIBc was crystallized at a protein concentration of 7 mg/ml in the hanging drop format, over a well solution containing 100 mm sodium acetate trihydrate, pH 4.5, and 2 m ammonium sulfate. Sucrose at a concentration of 3% (w/v) was used as an additive to improve crystal quality. Crystals were cryoprotected in mother solution supplemented with a final concentration of 30% glycerol and plunged into liquid nitrogen. Diffraction data were collected at beamline 191D of the Advanced Photon Source at Argonne National Laboratory. Data were collected over a total of 180° with oscillation of 1° and an exposure time of 2 s/degree. Diffraction data were processed with HKL2000 (58), and TFIIBc was found to be in space group P2₁2₁2₁ (R_meas for the lowest-resolution shell (50.00–9.21) is 6.0%). The structure of TFIIBc was solved by using the separate cyclin-like 1 and cyclin-like 2 domains from the TFIIB_c-TBP_c-DNA structure (8) using MOLREP (59). Manual building of connecting loops was completed with Coot (60), followed by refinement with PHENIX (61). Figures were created with PyMOL (PyMOL Molecular Graphics System, Version 1.8.6.2., Schroedinger, LLC, New York).

Isothermal titration calorimetry (ITC)

ITC was performed on a VP-ITC instrument (GE Healthcare) at 25 °C in 25 mm HEPES, pH 8.0, 150 mm NaCl, 0.5 mm tris(2-carboxyethyl)phosphine. Ssu72 (1 mm) in the syringe was titrated into TFIIBc (50 μm) in the cell over 30 injections, and data were background-corrected using a control titration where buffer was injected into Ssu72. Data were analyzed with NITPIC and Sedphat software (62). We noticed slight precipitation after the titration, which might cause an inaccuracy of the protein concentrations and the estimate of K_d.

Pulldown assays

For FLAG pulldown assays, an amount of 75 μg of TFIIBc variant with a C-terminal FLAG tag was mixed with 150 μg of N-terminal tagged Ssu72 in binding buffer (50 mm Tris, pH 8.0, 150 mm NaCl, and 0.1% Tween) and bound to 50 μl of anti-FLAG-agarose (Sigma-Aldrich) at room temperature for 1 h with rotation. For the assay conducted in Fig. 5A, TFIIBc-FLAG was prebound to the resin, followed by extensive washing before the addition of other proteins. The resin was then centrifuged for 3 min at 500 rpm at 4 °C, the supernatant was removed, and the resin was washed three times with 1 ml of binding buffer. Proteins were then eluted with 100 mm glycine, pH 3.5, neutralized with 1 μl of 1 m Tris, pH 8.0, and run on SDS-PAGE. Protein interactions were analyzed by staining with Coomassie Brilliant Blue and/or Western blotting with an anti-His₆ antibody (Abcam).

Site-specific UV-cross-linking analysis

Amounts of 20 μg of TFIIBc-FLAG and 40 μg of His₆-Ssu72-pBpA mutant were mixed in assay buffer (20 mm Tris, pH 8.0, 150 mm NaCl, 1 mm DTT) in a final volume of 50 μl and incubated on ice for 20 min. An amount of 25 μl was removed from each sample as a no UV control. Samples were then UV-cross-linked on ice for four cycles at energy level 9999 in a Spectrolinker cross-linker (Krackeler Scientific), with 5 min of incubation on ice between cycles. 6.25 μl of 6× SDS dye was added, samples were boiled, and 12.5 μl was run on SDS-PAGE. Cross-linking was analyzed by separate Western blots with an anti-FLAG antibody and an anti-His₆ antibody (Abcam). For competition cross-linking with TFIIBn and VP16AD (Fig. 4), TFIIBc was preincubated with the molar excess of competitor, as indicated in the figure, for 15 min on ice. Samples were then processed as described above. For competition cross-linking between TFIIBc, Ssu72, and symplekin (Fig. 5), 40 μg of Ssu72 was preincubated with 30 μg of symplekin for 20 min on ice. An amount of 60 μg of TFIIBc was then added, and samples were then processed as described above.

EMSA

The template strand DNA oligonucleotide containing the E4 promoter sequence (TTTTTAGTCCTATATATACTCGCTCT) was annealed to the reverse complement strand containing a 3′-end Cy5 label (Sigma-Aldrich). TFIIB_FL, TBP_c, and DNA were mixed at equal molar concentrations (300 nm) in assay buffer (20 mm Tris, pH 8.0, 60 mm KCl, 5 mm MgCl₂, 4% glycerol, and 10 μg bovine serum albumin in a final volume of 20 μl and incubated at 30 °C for 40 min. Samples were then subjected to electrophoresis on a 6%, 37.5:1 (acrylamide/bisacrylamide) gel at 4 °C in 25 mm Tris, pH 8.3, 190 mm glycine running buffer. Fluorescence was visualized with a Pharos imager (Bio-Rad).

Molecular dynamics simulation of TFIIB_c

The two available crystal structures of TFIIB_c were used as initial structures for MD simulation. The first one is TFIIB_c in complex with TBP and DNA promoter (PDB code 1C9B) (8). The other one is the crystal structure of apo-TFIIB_c (this report).

For TFIIB_c from PDB entry 1C9B, only the TFIIB_c structure was used. For apo-TFIIB_c crystal structure, only molecule D was used. Both structures were solvated in a dodecahedron box with 17,779 TIP3P (63) water molecules. The system also contains 51 Na⁺ and 61 Cl⁻ ions to create a neutral environment with 0.15 mol/liter salt concentration. The GROMACS version 4.5 (64) simulation package and AMBER 99SB-ILDN (65) force field were used to carry out the succeeding steps. Long-range electrostatic interactions were treated by the particle mesh–Ewald method (66). Electrostatic and van der Waals short-range interactions were calculated using a cutoff of 10 Å.

Energy minimization was performed using the steepest-descent method, followed by NVT equilibration for 100 ps with position restraints on the heavy atom of TFIIB_c at 300 K using V-rescale thermostat (67), which is used in all MD simulations in succeeding steps. At this step, the positions of heavy atoms were restrained with a force constant of 1000 kJ mol⁻¹ nm⁻¹, and all bonds in protein molecules and water were constrained using the LINCS algorithm (68). NPT equilibration was then carried out using the Parrinello–Rahman barostat (69), to a reference pressure of 1 bar until the average pressure reached around 1 bar.

Eight production MD simulations starting from TFIIB_c structure from PDB entry 1C9B were performed in the NVT ensemble with the length of each simulation ranging from 50 to 300 ns, with an accumulated time of 1600 ns for TFIIB_c structure from PDB entry 1C9B. Five production MD simulations starting from apo-TFIIB_c were performed in the NVT ensemble with the length of each simulation ranging from 100 to 400 ns, giving an accumulated time of 1300 ns. In the succeeding MD simulations, we used the same simulation package, force field, non-bonded interaction calculation method, barostat, thermostat, and bond constraint.

TFIIB_c is an inherently flexible protein, as shown by the large root mean square fluctuation values for most of the backbone atoms (Fig. S8A). Because we obtained many TFIIB_c structures other than the crystal structures, we selected the starting models based on the following criteria. In TFIIB_c1, residues 189, 193, and 200 are likely to interact with Ssu72 (Fig. 3C). Given that residue Ala²⁸¹ in TFIIB_c2 was shown previously to bind VP16AD and that Ssu72 and VP16AD bind to an overlapping surface of TFIIB_c (Fig. 6B), we assumed that residues 281–284 of TFIIB_c are located on the binding interface of the TFIIB_c-Ssu72 complex. Due to the flexibility of TFIIB_c, these two clusters of interacting residues on TFIIB_c1 or TFIIB_c2 can be on the same plane (coplanar) (Fig. S9A) or not (Fig. S9B). To choose TFIIB_c structures, clustering for simulations from each crystal structure was performed by K-center clustering (70) to 50 states. Eighteen structures were chosen based on 1) the coplanarity of the interacting residues that mimics the active conformation of TFIIB_c when it binds to TBP and the TATA DNA and 2) the distance between the center of mass of TFIIB_c1 and TFIIB_c2 being less than 40 Å. The crystal structure of TFIIB_c from PDB entry 1C9B was also used for protein-protein docking, which resulted in a total of 19 starting structural models of TFIIB_c.

Molecular dynamics simulation of Ssu72

The starting structure for MD simulation was taken from PDB entry 3O2Q (28). It was solvated in a dodecahedron box with 11,321 TIP3P water molecules. The system also contains 44 Na⁺ ions and 34 Cl⁻ ions to neutralize the system and creates a 0.15 mol/liter salt environment. Energy minimization was performed using the steepest-descent method, followed by NVT equilibration for 100 ps with position restraints (force constant = 1000 kJ mol⁻¹ nm⁻¹) on the heavy atom of Ssu72 at T = 300 K with coupling constant = 0.1 ps. NPT equilibration was then carried out to a reference pressure of 1 bar with coupling constant = 0.2 ps until the average pressure reached around 1 bar. Six production NVT MD simulations with different random initial velocities were performed for 50 ns each, giving an accumulated time of 300 ns. Because Ssu72 is a rigid protein (as shown by the small root mean square fluctuation value of all of the backbone atoms; Fig. S8B), we used the crystal structure to do protein-protein docking.

Protein-protein docking using HADDOCK

The 19 selected structures from MD simulation of TFIIB_c were used as input for protein-protein docking, along with the crystal structure of Ssu72 (PDB code 3O2Q). The cross-linked residues on Ssu72 were used as active residues input into the HADDOCK web server (71) (i.e. Pro¹³³, Phe¹⁹³, Gln¹²⁸, Thr¹³⁰, Cys¹³¹, Glu¹⁶⁹, Asp¹⁷³, Glu¹⁷⁴, Glu¹⁸¹. The interacting residues of TFIIB_c, which were either determined by mutagenesis or prior knowledge of interaction with VP16AD, were also used as active residues (i.e. Lys¹⁸⁹, Arg¹⁹³, Lys²⁰⁰, Ala²⁸¹, Asp²⁸², Val²⁸³, Thr²⁸⁴). The intermolecular and intramolecular interactions were determined by CNS 1.3 (72, 73) along with PARALLHDG5.4 (74, 75) as force field for protein. For each docking simulation, the two input molecules were separated for 25 Å and rotated randomly around their centers of mass, followed by rigid body minimization and docking. Two hundred best structures from rigid body docking were chosen for semiflexible refinement, based on the weighted sum of several of energy terms (i.e. electrostatic, van der Waals, desolvation, ambiguous interaction restraints, and total buried surface area). Of 1000 structures generated by rigid body docking, 200 structures were used for final solvated refinement and clustering. Clustering was done based on fraction of native contacts using 0.75 similarity as the threshold. For each cluster of every docking simulation, we picked the four models with the lowest HADDOCK scores for the following analysis.

Selection of docking model

HADDOCK score and experimental results were considered to select the best model. The HADDOCK score used in the succeeding steps excluded the E_AIR part of the score. For consideration of the cross-linking experiment, we defined a distance that measured the likelihood of cross-linking reaction (D2 distance, shown in Fig. S10). The D2 distance is defined as the distance between the C-α atom of cross-linked residues on Ssu72 and the C-α atom of the nearest residue on TFIIB_c that can potentially form a cross-linking bond. The cross-linking reaction only occurs between pBpa and a non-quarternary carbon atom (i.e. a carbon atom that binds to at least one hydrogen atom). The threshold for the D2 distance was determined to be 15 Å. Any cross-linked residue that has a D2 distance violating the threshold is considered as 1 violation count. The contacts between residues 189, 193, 200, 281, 282, 283, and 284 on TFIIB_c and Ssu72 residues were determined by using the g_contacts module in GROMACS (76), with a threshold of 3 Å. If any of these residues was not in contact, the violation count was 2 for residues 189, 193, and 200, giving priority to the mutagenesis experiment, and 1 for residues 281, 282, 283, and 284. The total experimental violation count was the sum of all of the violations. The plot of HADDOCK score versus experimental violation count is shown in Fig. S11A. All of the models with violation less than 1 were analyzed further. According to the pulldown data, the interaction between TFIIB_c1 and Ssu72 is stronger than that between TFIIB_c2 and Ssu72. Considering this result, we calculated the ratio of contacts between TFIIB_c1 and Ssu72 and contacts between TFIIB_c2 and Ssu72. The plot in Fig. S11B clearly shows one model having the largest ratio and a low HADDOCK score (represented as a star), hence fitting best to the pulldown assay experiment (Table S1).

MD simulation of TFIIB-Ssu72 complex

We solvated the TFIIB_c-Ssu72 model in a dodecahedron box with a 1-nm distance between the closest point of the protein and the walls of the box. The protein was then solvated in TIP3P water molecules and an equal number of sodium and chloride ions to create a 0.15 mol/liter salt concentration.

The prepared system was then energy-minimized by the steepest-descent method, followed by NVT equilibration with T = 300 K and coupling constant = 0.1 ps as well as position restraints on heavy atoms of the protein (force constant = 1000 kJ mol⁻¹ nm⁻¹) for 100 ps. Next, NPT equilibration was performed to reference pressure = 1 bar and coupling constant = 0.2 ps, until the average pressure reached 1 bar. The frame from MD simulation that has a volume equal to the average volume was chosen for a 200-ps NVT MD simulation. The last frame of this short MD simulation was the starting ensemble for the production MD simulations. Finally, MD simulation in an NVT environment was performed for 60 ns, with the first 10 ns excluded in analysis.

Author contributions

X. L. conceived the study. M. B., I. C. U., X. H., and X. L. designed the experiments. M. B. carried out all of the experiments with help from M. S. I. C. U. and L. Z. performed computational structure modeling. M. B., I. C. U., X. H., and X. L. wrote the manuscript.