Skip to main content
PLOS Neglected Tropical Diseases logoLink to PLOS Neglected Tropical Diseases
. 2018 Jan 22;12(1):e0006174. doi: 10.1371/journal.pntd.0006174

Molecular detection of airborne Emergomyces africanus, a thermally dimorphic fungal pathogen, in Cape Town, South Africa

Ilan S Schwartz 1,2,‡,*, Josh D McLoud 3,‡, Dilys Berman 4, Alfred Botha 5, Barbra Lerm 5, Robert Colebunders 2, Estelle Levetin 3,‡, Chris Kenyon 6,‡
Editor: Ángel González7
PMCID: PMC5800596  PMID: 29357352

Abstract

Emergomyces africanus is a thermally dimorphic fungus that causes a systemic mycosis in immunocompromised persons in South Africa. Infection is presumed to follow inhalation of airborne propagules. We developed a quantitative PCR protocol able to detect as few as 5 Es. africanus propagules per day. Samples were collected in Cape Town, South Africa over 50 weeks by a Burkard spore trap with an alternate orifice. We detected Es. africanus in air samples from 34 days (10%) distributed over 11 weeks. These results suggest environmental exposure to airborne Es. africanus propagules occurs more commonly in endemic areas than previously appreciated.

Author summary

Emergomyces africanus is a recently described dimorphic fungus that causes a serious and often fatal disease in immunocompromised patients in South Africa. Infection is presumed to occur via inhalation of infectious propagules; however, no attempts have yet been made to detect this fungus in the air. We developed a highly specific and sensitive protocol for the molecular detection and quantification of Es. africanus, and tested air samples collected over a 50-week period from an urban area of Cape Town, Western Cape, South Africa, where the disease is endemic. We detected Es. africanus in the air on 10% of all days sampled, suggesting that exposure to this fungus is common in this area. This study lays the groundwork for further investigations that might explore environmental, host, and pathogen factors that influence the development of this fungal disease.

Introduction

Emergomyces africanus is an emerging opportunistic dimorphic fungal pathogen that causes emergomycosis, a systemic and often-fatal HIV-associated mycosis in South Africa [1,2]. It is a member of a newly-described genus within the family Ajellomycetaceae called Emergomyces, so-named because of the striking appearance or recognition of new dimorphic fungal pathogens reported globally [2]. In addition to Emergomyces africanus, which has been reported from South Africa and Lesotho [1–3], the genus includes Emergomyces pasteurianus (formerly Emmonsia pasteuriana, reported from Europe, Asia and Africa [4–10]) and Emergomyces orientalis (reported from China [11]). Similar but distinct fungi have also been reported from North America [12].

Although, the true incidence is unknown, cases of disease caused by Emergomyces species other than Es. africanus are uncommon, with only 13 cases reported to date. On the other hand, disease caused by Es. africanus is relatively common: although only described in 2013 (as Emmonsia species [1]), Es. africanus is now recognized to cause the most frequently diagnosed dimorphic fungal infection in South Africa [10]. In Cape Town, a clinical and laboratory surveillance study at public hospitals over a 15-month period identified 14 cases of culture-proven emergomycosis [13].

Emergomycosis is an opportunistic infection of immunocompromised hosts. In South Africa, one patient was a kidney transplant recipient, and the remainder have occurred in patients with advanced HIV infection (among whom the median CD4 lymphocyte count was 16 cells/μL) [1,3,14,15]. Patients most commonly present with widespread skin lesions and pulmonary disease [3], and the disease often only becomes clinically apparent after the initiation of antiretroviral therapy [3,13]. The reported case-fatality ratio is 50% [3].

Most patients with emergomycosis caused by Es. africanus have been diagnosed in the Western Cape province [3], although cases have been reported from 6 of 9 South African provinces and Lesotho [3,10].

The ecological niche of Es. africanus is still being elucidated, although an environmental reservoir of the mycelial phase in the soil is supported by molecular detection of Es. africanus in 30% of soils sampled from the Western Cape [16]. Nonetheless, most patients diagnosed with emergomycosis do not report occupational or other frequent exposure to soil [13]. Based on what is known of the pathogenesis of most other dimorphic fungal infections [17], Es. africanus infection likely follows inhalation of conidia or other infectious propagules. However, no attempts have been made to detect Es. africanus in the air.

We developed a protocol for the molecular detection and quantification of Es. africanus propagules from air samples, and used this to evaluate air samples collected from Cape Town, Western Cape.

Methods

Sampling

We sampled airborne propagules using a Hirst-type volumetric 7-day spore trap (Burkard Manufacturing Co. Ltd., Rickmansworth, Hertfordshire, England) [18] fitted with an alternate orifice (Burkard) [19]. This spore trap samples air continuously at a rate of 10 l/min (14.4 m3/day) [18]. The spore trap was set up on the roof of a building 4 m high in Bellville, an urban area of Cape Town, Western Cape, South Africa near where cases of Es. africanus infection have been diagnosed [3]. Permission was provided for sampling by the Air Pollution Department of the City of Cape Town, the owner of the property. Sampling took place over a period of 50 weeks from 15 September 2015 to 29 August 2016. Melinex tape was fixed to the sampler drum, greased with petroleum jelly and replaced weekly. Tapes were stored in individually labeled storage boxes at room temperature and shipped to the Aerobiology Lab at the University of Tulsa for molecular analysis. For processing, each Burkard tape was cut into 7 48-mm segments, with each segment representing a 24-hour period. The 48-mm segments were temporarily fixed on microscope slides labeled with the sampling date.

DNA extraction from air samples

Each 48-mm tape segment containing the daily air sample was removed from the slide, cut into small strips and loaded into a sterile 2 ml bead-beating tube containing 0.3–0.4 g of 0.5 mm glass beads. The DNA extraction protocol was a variation of the cetrimonium bromide (CTAB) method [20]. A 2% CTAB extraction solution (pH 8.0) was added to the tube at a volume of 500 μl, along with 10 μl of β-mercaptoethanol. The tubes were loaded into the bead beater and shaken for 3 min at max speed. Tubes were incubated at 70°C for 1 hr before being centrifuged at 15,000 g for 1 min. The supernatant was transferred to a 2-ml centrifuge tube and centrifuged at 15,000 g for 10 min. The supernatant was transferred to another tube and 500 μl of chloroform:isoamyl-alcohol (24:1) was added, and vortexed for 10 sec. To separate the phases, tubes were centrifuged at 15,000 g for 10 min. The upper aqueous phase was collected and transferred to a clean tube with 100 μl of 5 M sodium acetate and 500 μl of ice-cold isopropyl, and the tubes vortexed for 5 sec. Tubes were stored at -20°C overnight. The next day, tubes were centrifuged at 15,000 g for 15 min at 4°C to pellet DNA. The supernatant was removed and discarded before the DNA pellet was washed with 800 μl ice-cold 70% ethanol at 4°C and centrifuged at 15,000 g for 10 min at 4°C. The supernatant was removed and the DNA pellet was air dried for ~30 min. The DNA pellet was suspended in 50 μl of enzyme free water and vortexed for 5 s and centrifuged at 15,000 g for 10 min before the DNA extract (from the daily air sample) was stored at -20°C.

For each week, fractions of the DNA from 7 daily air samples were pooled to produce a weekly air sample, which allowed testing of daily and weekly samples. A 15 μl aliquot of each 50 μl daily air sample (30%) was transferred to a 2-ml centrifuge tube, which produced a weekly sample with a final volume of 105 μl. Both the daily and weekly air sample DNA extracts were stored at 4°C until analyzed.

qPCR assay development

qPCR assays specific for Es. africanus isolates (CBS 136730 and CBS 136260) were developed for regions of the nuclear ribosomal internal transcribed spacer (ITS) and the β-tubulin gene. All accessions of Es. africanus and gene constructs of closely related species used in this study are listed in S1 and S2 Tables. Gene constructs were manufactured by Eurofins MWG Operon USA, Louisville, KY. DNA sequence alignments were performed using the Multiple Sequence Comparison by Log-Expectation (MUSCLE) algorithm implemented in European Bioinformatics (EMBL-EBI; http://www.ebi.ac.uk) web browser. An alignment of Es. africanus JX398299 (formerly Emmonsia sp.), Es. pasteurianus KR150770 (formerly Ea. pasteuriana), Emmonsia crescens AF038336, Histoplasma capsulatum NR_149341, H. capsulatum KX646004, Ajellomyces capsulatus KM361509, A. capsulatus AF322386, Ajellomyces dermatitidis HQ026734, Paracoccidioides brasiliensis AY374339, P. brasiliensis JQ675762, Ajellomyces grisea AY527404, Blastomyces percursus KY195964, B. percursus KY 195963, Onygenales sp. KX148665, and Onygenales sp. KX148661 was performed in silico to test the specificity of the primers and probe for the Es. africanus assay.

TaqMan (Applied Biosystems, Foster City, CA) primer and probe design was performed manually using the alignment files with the following criteria: the maximum melting temperature differences between primers used in an assay were ±1.6°C and probes >7.5°C when compared to primers. The resulting primers and probe are shown in Table 1; these were manufactured by Eurofins MWG Operon USA. The probe was labeled with a fluorescein dye (6-FAM) at the 5’ end and a Black Hole Quencher 1 (BHQ-1) nonfluorescent quencher.

Table 1. The primers and probe used in this study.

Name Tm Sequence 5’-3’
EmeITS(F) 56.0 CTGGCCACCCTTGTCTAT
EmeITS(R) 57.6 GACGTCAATCTTTAACCAGTGTTT
EmeITSprobe 65.5 [6-FAM]TCTTGGCTCTCCGGGCTCGC[BHQ-1]
EmeB-tubulin(F) 66.4 AGGGCCATTACACCGAAGGTGC
EmeB-tubulin(R) 66.3 AAGTGGCCATCATGCGATCTGGG
SepRef1(F) 64.5 GGACTTCCAAGGCAGGTACATG
SepRef1(R) 64.5 GGGAAGTCCATCCAGCGATAGTAA

TaqMan species-specific assay validation / qPCR assay for test samples

The specificity of the Es. africanus qPCR assay was validated in silico using the BLAST alignment tool in NCBI. The in silico specificity was also validated against the NCBI nucleotide database and there were no closely related isolates homologous for the assay target, including two isolates of the dimorphic fungus Blastomyces percursus (CBS 139878 and NCPF 4091) that is endemic to South Africa [2]. The specificity of the primers EmeITS(F) and EmeITS(R) was further validated in vitro by end-point PCR using Es. africanus gDNA and gene constructs from other closely related species (S1 Table), as well as a mock community of fungal species potentially present in air samples. The mock community consisted of gDNA from Alternaria sp., Aspergillus niger, Cladosporium sp., Epicoccum nigrum, and Trichoderma sp. Each member of the mock community was isolated from air samples and identified by morphology. A single fragment of 129 bp was amplified from the Es. africanus gDNA. No product was observed with the gene constructs of Es. pasteurianus or Ea. crescens (accessions KR150770 and AF038336, respectively) or the air sample mock community gDNA. Development of the qPCR assay included the addition of the TaqMan probe.

Quantitative PCR using the Es. africanus ITS primers described above and Taqman probe was performed with a StepOnePlus System (Applied Biosystems, Foster City, CA). All reactions were performed in a final volume of 25 μl and contained 12.5 μl of 2× TaqMan Gene Expression Master Mix (Applied Biosystems), 2.5 μl of each 5 μM primer solution, 2.5 μl of 2.5 μM TaqMan probe solution, and 5 μl of template DNA. PCR thermocycling conditions were set at 95°C for 15 min, 40 cycles at 95°C for 15 s and 61.9°C for 30 s. All air samples were tested in triplicate.

TaqMan qPCR standard curve

To produce amplicon standards for the standard curve, end-point PCR was performed with the ITS primers using 20 ng of Es. africanus (CBS 136260) gDNA. Gel electrophoresis was used to remove the unincorporated nucleotides from the PCR amplicons; this was followed by column purification with Illustra GFX PCR DNA and Gel Band Purification Kit, isolating the amplicons. Purified amplicons were quantified with a Qubit 2.0 and dsDNA HS assay Kit. The quantified amplicon solution was diluted based on the mass of amplicon and concentration of amplicon in the initial solution (Applied Biosystems, 2003). This resulted in solutions containing 60,000, 6,000, 600, 60, and 6 target gene copies in 5 μl of solution, which were used to create the standard curve. The positive control was 20 ng/μl of gDNA and the negative control was water in replacement of the gDNA. For the qPCR assay, each 96-well plate included reactions for a standard curve, positive control, and negative control with three replicates for all reactions. In addition, for days positive for Es. africanus, quantification was repeated on a different day to increase the number of replicates and to confirm there were no false positives.

Calculation of target copy number in gDNA

Deducing the number of Es. africanus cells or propagules from the number of target sequences detected by absolute qPCR required the knowledge of target copy number per cell. The β-tubulin gene is a single-copy gene [21–24]; therefore, the comparisons between the β-tubulin target and ITS targets for the same gDNA concentration enabled calculation of the number of ITS targets per genome. The ITS targets for our assay were normalized to the single β-tubulin target, allowing use of the amplicon standard curve to create an assay with a sensitivity below one propagule per 5 μl sample volume analyzed.

Standards were developed for an absolute qPCR β-tubulin SYBR Green assay. To produce known standards, end-point PCR was carried out with the β-tubulin and ITS primers using 20 ng of Es. africanus gDNA; each PCR product was column purified with Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare, Chicago, IL). Cleaned PCR product was quantified with a Qubit 2.0 and dsDNA HS assay Kit (Thermofisher Scientific, Waltham, MA), and each quantified PCR product was diluted based on mass of amplicon and concentration of amplicon in the initial solution [25]. This resulted in solutions containing 60,000, 6,000, 600, 60, and 6 target gene copies in 5 μl of solution for each gene. These solutions were used to generate qPCR reactions with final volumes of 20 μl with 10 μl of 2× PowerUp SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA), 2 μl of each 5 μM primer solution, 1 μl of enzyme free water, and 5 μl of standard template solution. Quantitative PCR was performed with a StepOnePlus System (Applied Biosystems). PCR thermocycling conditions were set at 95°C for 2 min, 40 cycles at 95°C for 15 s and 60°C for 1 min. Fluorescence was read at the end of each extension step and there were four replicates for all standards.

An absolute qPCR β-tubulin SYBR Green assay was used to test the mean copy number of targets from two isolates (CBS 136260 and CBS 136730) of Es. africanus gDNA. Genomic DNA reactions containing 60, 6, and 0.6 ng were performed in a final volume of 20 μl, containing 10 μl of 2× PowerUp SYBR Green PCR Master Mix, 2 μl of each 5 μM primer solution (Table 1), 3 μl of enzyme free water, and 3 μl of template DNA. There were four replicates for each gDNA concentration. For the 0.6 ng reaction only isolate CBS 136260 was used. The quantity of ITS and β-tubulin target copy numbers were determined by comparing the Ct values of different gDNA concentrations to those of the known target number of the standard curve (Fig 1).

Fig 1. Standard curves from the amplification of 10-fold dilutions of ITS and β-tubulin amplicons.

Fig 1

These curves showed a linear relationship across the whole range (ITS, R2 = 0.99 and β-TUB, R2 = 0.98), between the log10 value of the amplicon concentrations and the threshold cycles. The high coefficient of determination indicated low intra-assay variability. The dotted lines are the 95% CI of the coefficient of determination, which show that there is no significant difference between the 2 standard curves used to generate the mean target copy number per genome.

The absolute quantification resulted in ITS target copy numbers of 5.97x108 and 5.04x108 (for the 60 ng reactions) 1.33x106 and 1.03x105 (6 ng reactions) and 2.98x103 (0.6 ng reactions) and β-tubulin target copy number of 5.92x107 and 5.09x107 (60 ng), 9.08x104 and 5.85x103 (6 ng), and 1.08x102 (0.6 ng) respectively. When ITS target numbers were divided by the β-tubulin target numbers for the same DNA concentration, the calculated ITS targets per genome from highest to lowest DNA concentration were 10, 10, 15, 18, and 28, respectively. The mean (n = 5) ± SE ITS target number using all gDNA concentrations was 16 ± 3 with a SD of 7.3, and after removal of two outliers was 12 ± 2 with a SD of 2.7. Accordingly, 12 ITS targets were used to determine the number of Es. africanus propagules. The SYBR Green quantification was followed with a melting curve analysis, which produced single peaks for both the ITS and β-tubulin amplicons (S1 Fig).

PCR inhibition analysis

DNA extracts were tested for PCR inhibitors to confirm the ability to amplify DNA. The qPCR master mix was spiked with a known concentration of a gene construct (S1 Table) of the reflectin gene of cuttlefish (Sepia officinalis), an ocean living mollusk (the DNA of which should not be found in air samples), and the Ct value of the DNA extract from air samples tested [26]. All weekly air samples were amplified with cuttlefish primers (Table 1) and had a mean (± SD) Ct value of 11 ± 0.47 (Fig 2). When the daily air samples from the Emergomyces positive weeks were tested, 6 samples showed the presence of inhibitors. Samples were cleaned by repeating the chloroform: isoamyl alcohol and subsequent steps of the DNA extraction. After cleaning, all 77 daily samples amplified with cuttlefish primers and had a mean (± SD) Ct value of 10 ± 0.78.

Fig 2. Standard curve for the SepRef (cuttlefish) inhibition assay (R2 = 0.98).

Fig 2

Analysis

StepOne Software v2.0 (Applied Biosystems) was used to determine the quantity of ITS target copy numbers for weekly (pooled daily samples) and daily air samples. The targets in the total DNA extract sample volume (105 μl for the weekly samples and 50 μl for the daily samples) and the resulting total propagules were determined by comparing the Ct values of gDNA concentrations from air samples to the Ct values of the standard curve (Fig 3A and 3B). The mean ITS target copy numbers were computed using all replicates of daily air samples (Fig 3B).

Fig 3. Mean ITS target number of quantifiable weekly and daily air samples for Es. africanus fit on the standard curve.

Fig 3

Note: Five standards were used to generate the standard curve; however, only three standards are shown in these figures to increase the visibility and separation of the test samples. A) Weekly air samples B) Daily air samples.

Meteorological data

Daily meteorological data was obtained for the sampling period from South African Weather Service for Cape Town International Airport 6.8 km away. This included wind speed (collected at the times 0800, 1400 and 2000), daily maximum and minimum temperatures, and daily rainfall. Mean values for each week were plotted using GraphPad Prism version 6.00 against the number of days in that week that Es. africanus propagules were detected.

Results

A standard curve for the qPCR assay was obtained from 5 different amplicon concentrations from 6 to 60,000 ITS target copies (Fig 1). There was amplification of all amplicon dilutions and the positive control. The limit of quantification was 6 ITS target copies. Therefore, target quantities with fewer than 6 were only used for qualitative assessments of the presence of Es. africanus DNA. No amplification was detected for the no-template control.

Es. africanus DNA was detected among weekly samples during 11 of 50 weeks. Ten of the 11 weeks produced ITS target numbers that were within the range of the standard curve (Fig 3A) and could be quantified (Table 2). During the 11th week in which Es. africanus DNA was detected, fewer than 6 targets were amplified.

Table 2. Detection of Es. africanus propagules in weekly air samples.

Week Mean copies of target gene detected in 5 μl aliquot amplified Total propagules in pooled weekly sample (105 μl total volume)
6 Oct to 12 Oct 15 8 14
3 Nov to 9 Nov 15 10 17
24 Nov to 30 Nov 15 21 37
8 Dec to 14 Dec 15 3* BLQ
24 May to 30 May 16 8 14
7 Jun to 14 Jun 16 7 12
14 Jun to 20 Jun 16 6 11
12 Jul to 18 Jul 16 7 12
19 Jul to 25 Jul 16 14 25
26 Jul to 1 Aug 16 36 63
9 Aug to 15 Aug 16 6 11

Below the limit of quantification (BLQ)

*This value was outside of the standard curve and unreliable for quantification

Aliquots of DNA from the daily air samples (n = 77) from the 11 positive weekly samples were analyzed for Es. africanus. Initially, there were 31 daily samples positive for Es. africanus DNA. Although the weekly samples did not show PCR inhibition, all daily air samples from the Es. africanus positive weeks were also tested for the presence of PCR inhibition. DNA extracts from 6 daily air samples were determined to contain PCR inhibitors; after cleaning, the 6 samples were retested for Emergomyces. Three of the 6 previously inhibited daily samples were positive for Es. africanus, bringing the total number of Es. africanus positive daily samples to 34; however, only 11 daily samples were within the range of the standard curve and quantified (Table 3). This left a total of 23 daily samples that were positive for Es. africanus DNA but outside the standard curve (Fig 3B) and thus below the limit of quantification (S2 Fig).

Table 3. Detection of Es. africanus propagules in daily air samples.

Date Mean copies of target gene detected in 5 μl aliquot amplified Total propagules in air sample
7 Oct 15 15 13
13 Jun 16 14 12
16 Jun 16 6 5
13 Jul 16 8 7
19 Jul 16 13 11
20 Jul 16 6 5
21 Jul 16 10 8
24 Jul 16 6 5
31 Jul 16 31 26
1 Aug 16 29 24
14 Aug 16 7 6

The respective relationships between the detection of Es. africanus (34 days during the 11 positive weeks) at our sampling site and the prevailing mean wind speed, maximum and minimum daily temperatures, and mean rainfall at Cape Town International Airport are demonstrated in Fig 4. Although not enough Es. africanus positive weeks were detected to attempt statistical correlations with meteorological variables, it is possible that cooler temperatures (during winter and spring) and rainfall coincided with Es. africanus propagules in the air samples.

Fig 4. Weather conditions in relation to the detection of airborne propagules of Es. africanus.

Fig 4

The number of days per week in which Es. africanus was detected using qPCR is plotted against (A) weekly mean maximum and minimum temperature, (B) wind speed (C) rainfall, and (D) all variables.

Discussion

Emergomyces africanus is an important cause of an AIDS-related mycosis in South Africa [13]. We developed a qPCR assay that is highly specific and sensitive for the detection and quantification of Es. africanus in spore trap air samples, and demonstrated the frequent airborne circulation of Es. africanus in an industrial area of Cape Town.

Other studies have used different protocols for molecular detection of Es. africanus in South Africa. Using a conventional PCR, Cronjé et al failed to detect Es. africanus in tissues of 1402 small terrestrial mammals from across South Africa [27]. Schwartz et al used a nested (conventional) PCR strategy and found Es. africanus in 30% of soil samples assessed [16]. The main advantage of the protocol presented here is the ability of qPCR to quantify the number of propagules present. Additional advantages of our assay include the high specificity for Es. africanus, which could be clearly distinguished from other closely related fungi in addition to a distantly related mock community. Moreover, our assay was highly sensitive, detecting as few as five propagules per day; the minimum inhaled dose of Es. africanus propagules required to cause infection is unknown.

Limitations of our study include the fact that only a single spore trap was used from a single location. Additionally, the climatic data in our study is from a meteorological station 6.8 km away from the sampling site, and conditions at the spore trap may have been different from those measured. A limitation of the Burkard spore trap is the inability to use culture-based analyses [28]. Consequently, we cannot definitively conclude the infectivity of the detected propagules. Alternatively, the Burkard spore trap can be a robust sampling technique that allows molecular analyses of samples [29,30]. Our study is useful in demonstrating that airborne propagules of Es. africanus can be detected. Future investigations should include multiple concurrent spore traps in different locations to further characterize the range of detection as well as clarify the factors associated with the presence of airborne Es. africanus propagules.

That Es. africanus propagules were frequently detected in an urban setting suggests that exposure to Es. africanus is common in Cape Town (and perhaps other areas where infection has been diagnosed). While emergomycosis has only been reported in patients who are immunocompromised, many similarly immunocompromised patients do not develop the disease [13]. Further research should consider the question of which environmental, host and/or pathogen factors influence whether infection leads to disease.

Supporting information

S1 Table. Accessions of partial ITS1; 5.8S rRNA gene; partial ITS2 in NCBI database used to test specificity of Emergomyces africanus assay in silico and in vitro and the accession used for the inhibitor testing.

(PDF)

S2 Table. Accessions of partial β-tubulin gene used to develop a β-tubulin assay for Emergomyces africanus to determine target copy number.

(DOCX)

S1 Fig. Melting curve analysis confirming specificity of PCR reactions.

A) ITS amplicon melting curve. B) β-tubulin amplicon melting curve.

(TIF)

S2 Fig. Number of positive days in each of the 11 weeks during which Emergomyces africanus was detected by PCR but at numbers below the limits of quantification.

(TIF)

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

This study was funded by the Fonds Wetenschappelijk Onderzoek – Vlaanderen (G.0514.14N). ISS was supported by a grant from the R. Samuel McLaughlin – Manitoba Medical Services Foundation and University of Manitoba Dean’s Fellowship Fund (2015/2016). JDM was supported by a National Science Foundation Graduate Research Fellowship. The founders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Kenyon C, Bonorchis K, Corcoran C, Meintjes G, Locketz M, Lehloenya R, et al. A dimorphic fungus causing disseminated infection in South Africa. N Engl J Med. 2013;369: 1416–1424. doi: 10.1056/NEJMoa1215460 [DOI] [PubMed] [Google Scholar]
  • 2.Dukik K, Muñoz JF, Jiang Y, Feng P, Sigler L, Stielow JB, et al. Novel taxa of thermally dimorphic systemic pathogens in the Ajellomycetaceae (Onygenales). Mycoses. 2017;60: 296–309. doi: 10.1111/myc.12601 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Schwartz IS, Govender NP, Corcoran C, Dlamini S, Prozesky H, Burton R, et al. Clinical characteristics, diagnosis, management and outcomes of disseminated emmonsiosis: a retrospective case series. Clin Infect Dis. 2015;61: 1004–1012. doi: 10.1093/cid/civ439 [DOI] [PubMed] [Google Scholar]
  • 4.Gori S, Drouhet E. Cutaneous disseminated mycosis in a patient with AIDS due to a new dimorphic fungus. J Mycol Med. 1998;8: 57–63. [Google Scholar]
  • 5.Pelegrín I, Alastruey-Izquierdo A, Ayats J, Cuenca-Estrella M, Cabellos C. A second look at Emmonsia infection can make the difference. Transpl Infect Dis. 2014;0: 1–2. doi: 10.1111/tid.12214 [DOI] [PubMed] [Google Scholar]
  • 6.Lavergne R-A, Kandel-Aznar C, Khatchatourian L, Garcia-Hermoso D, Jeddi F, Boutoille D, et al. Emmonsia pasteuriana: une cause rare d’infection fongique chez l’immunodéprimé. J Mycol Med. 2017;27: e7–e8. doi: 10.1016/j.mycmed.2017.04.025 [Google Scholar]
  • 7.Malik R, Capoor MR, Vanidassane I, Gogna A, Singh A, Sen B, et al. Disseminated Emmonsia pasteuriana infection in India: a case report and a review. Mycoses. 2016;59: 127–32. doi: 10.1111/myc.12437 [DOI] [PubMed] [Google Scholar]
  • 8.Tang XH, Zhou H, Zhang XQ, Han J De, Gao Q. Cutaneous disseminated emmonsiosis due to Emmonsia pasteuriana in a patient With cytomegalovirus enteritis. JAMA Dermatology. 2015;151: 1263–4. doi: 10.1001/jamadermatol.2015.1792 [DOI] [PubMed] [Google Scholar]
  • 9.Feng P, Yin S, Zhu G, Li M, Wu B, Xie Y, et al. Disseminated infection caused by Emmonsia pasteuriana in a renal transplant recipient. J Dermatol. 2015; doi: 10.1111/1346-8138.12975 [DOI] [PubMed] [Google Scholar]
  • 10.Maphanga TG, Britz E, Zulu TG, MR S, Naicker SD, Schwartz IS, et al. In vitro antifungal susceptibility of the yeast- and mould-phases of the dimorphic fungal pathogen, Emergomyces africanus (formerly Emmonsia species), from HIV-infected South African patients. J Clin Microbiol. 2017;55: 1812–1820. doi: 10.1128/JCM.02524-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Wang P, Kenyon C, de Hoog S, Guo L, Fan H, Liu H, et al. A novel dimorphic pathogen, Emergomyces orientalis (Onygenales), agent of disseminated infection. Mycoses. 2017;60: 310–319. doi: 10.1111/myc.12583 [DOI] [PubMed] [Google Scholar]
  • 12.Sanche S, Wong A, Sigler L, Angel S, Peterson S. Invasive infection caused by a novel Emmonsia species in a renal transplant patient. Focus on Fungal Infections. Miami; 2005. p. Abstr 87.
  • 13.Schwartz IS, Kenyon C, Lehloenya R, Claasens S, Spengane Z, Prozesky H, et al. AIDS-related endemic mycoses in Western Cape, South Africa and clinical mimics: a cross-sectional study of adults with advanced HIV and recent-onset, widespread skin lesions. Open Forum Infect Dis. 2017; doi: 10.1093/ofid/ofx186 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Lochan H, Naicker P, Maphanga T, Ryan A, Pillay K, Govender NP, et al. A case of emmonsiosis in an HIV-infected child. S Afr J HIV Med. 2015;16: 2–5. doi: 10.4102/sajhivmed.v16i1.352 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.van Hougenhouck-Tulleken WG, Papavarnavas NS, Nel JS, Blackburn LY, Govender NP, Spencer DC, et al. HIV-Associated Disseminated Emmonsiosis, Johannesburg, South Africa. Emerg Infect Dis. 2014;20: 2164–2166. doi: 10.3201/eid2012.140902 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Schwartz IS, Lerm B, Hoving JC, Kenyon C, Horsnell WG, Basson WJ, et al. Emergomyces africanus in soil, South Africa. Emerg Infect Dis. 2018;24: 377–80. doi: 10.3201/eid2402.171351 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Sil A, Andrianopoulos A. Thermally dimorphic human fungal pathogens-polyphyletic pathogens with a convergent pathogenicity trait. Cold Spring Harb Perspect Med. Cold Spring Harbor Laboratory Press; 2014;5: a019794 doi: 10.1101/cshperspect.a019794 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Hirst JM. An automatic volumetric spore trap. Ann Appl Biol. Blackwell Publishing Ltd; 1952;39: 257–265. doi: 10.1111/j.1744-7348.1952.tb00904.x [Google Scholar]
  • 19.Kattab A, Levetin E. Preliminary studies on the effect of the Burkard alternate orifice on airborne fungal spore concentrations. Aerobiologia (Bologna). 2008;24: 165–71. doi: 10.1007/s10453-008-9096-0 [Google Scholar]
  • 20.Murray MG, Thompson WF. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 1980;8: 4321–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Ludueña RF. Multiple forms of tubulin: different gene products and covalent modifications. Int Rev Cytol. 1998;178: 207–75. [DOI] [PubMed] [Google Scholar]
  • 22.Ayliffe MA, Dodds PN, Lawrence GJ. Characterization of a β-tubulin gene from Melampsora lini and comparison of fungal β-tubulin genes. Mycol Res. 2001;105: 828–826. [Google Scholar]
  • 23.Aguileta G, Marthey S, Chiapello H, Lebrun MH, Rodolphe F, Fournier E, et al. Assessing the performance of single-copy genes for recovering robust phylogenies. Syst Biol. 2008;57: 613–27. doi: 10.1080/10635150802306527 [DOI] [PubMed] [Google Scholar]
  • 24.Schmitt I, Crespo A, Divakar PK, Fankhauser JD, Herman-Sackett E, Kalb K, et al. New primers for promising single-copy genes in fungal phylogenetics and systematics. Persoonia. 2009;23: 35–40. doi: 10.3767/003158509X470602 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Biosystems A. Creating Standard Curves with Genomic DNA or Plasmid DNA Templates for Use in Quantitative PCR. 2003. pp. 5–7.
  • 26.Bustin SA, Beaulieu J-F, Huggett J, Jaggi R, Kibenge FSB, Olsvik PA, et al. MIQE précis: Practical implementation of minimum standard guidelines for fluorescence- based quantitative real-time PCR experiments. BMC Mol Biol. 2010;11: 74 doi: 10.1186/1471-2199-11-74 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Cronje N, Schwartz IS, Retief L, Bastos ADS, Matthee S, Preiser W, et al. Attempted molecular detection of the thermally dimorphic human fungal pathogen Emergomyces africanus in terrestrial small mammals in South Africa. Med Mycol. 2017; doi: 10.1093/mmy/myx065 [DOI] [PubMed] [Google Scholar]
  • 28.Muilenberg ML. Sampling devices. Immunol Allergy Clin North Am. 2003;23: 337–55. [DOI] [PubMed] [Google Scholar]
  • 29.Wakefield AE. DNA sequences identical to Pneumocystis carinii f. sp. carinii and Pneumocystis carinii f. sp. hominis in samples of air spora. J Clin Microbiol. 1996;34: 1754–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Calderon C, Ward E, Freeman J, McCartney A. Detection of airborne fungal spores sampled by rotating-arm and Hirst-type spore traps using polymerase chain reaction assays. J Aerosol Sci. 2002;33: 283–296. doi: 10.1016/S0021-8502(01)00179-3 [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Table. Accessions of partial ITS1; 5.8S rRNA gene; partial ITS2 in NCBI database used to test specificity of Emergomyces africanus assay in silico and in vitro and the accession used for the inhibitor testing.

(PDF)

S2 Table. Accessions of partial β-tubulin gene used to develop a β-tubulin assay for Emergomyces africanus to determine target copy number.

(DOCX)

S1 Fig. Melting curve analysis confirming specificity of PCR reactions.

A) ITS amplicon melting curve. B) β-tubulin amplicon melting curve.

(TIF)

S2 Fig. Number of positive days in each of the 11 weeks during which Emergomyces africanus was detected by PCR but at numbers below the limits of quantification.

(TIF)

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.


Articles from PLoS Neglected Tropical Diseases are provided here courtesy of PLOS

RESOURCES