Activation of plasmacytoid dendritic cells by apoptotic particles – mechanism for the loss of immunological tolerance in Sjögren's syndrome

M Ainola; P Porola; Y Takakubo; B Przybyla; V P Kouri; T A Tolvanen; A Hänninen; D C Nordström

doi:10.1111/cei.13077

. 2017 Nov 28;191(3):301–310. doi: 10.1111/cei.13077

Activation of plasmacytoid dendritic cells by apoptotic particles – mechanism for the loss of immunological tolerance in Sjögren's syndrome

M Ainola ^1,^✉, P Porola ¹, Y Takakubo ², B Przybyla ³, V P Kouri ¹, T A Tolvanen ⁴, A Hänninen ⁵, D C Nordström ⁶

PMCID: PMC5801512 PMID: 29105068

Summary

Sjögren's syndrome (SS) is a common autoimmune disease targeting salivary and lacrimal glands. It is strongly female‐dominant, characterized by low oestrogen levels combined with a local intracrine dihydrotestosterone defect. We hypothesized that these hormonal deficits lead to increased apoptosis of the epithelial cells and plasmacytoid dendritic cell (pDC)‐mediated proinflammatory host responses. Expression of Toll‐like receptors (TLRs)‐7 and ‐9 and cytokine profiles was studied in pDCs treated with apoptotic particles collected in consecutive centrifugation steps of media from apoptotic cells. Expression and localization of SS autoantigens in these particles was also analysed. Furthermore, the effects of sex steroids were studied in pDCs cultured with several concentrations of dihydrotestosterone and 17‐β‐oestradiol, and in saliva of patient treated with dehydroepiandrosterone. Apoptosis of the epithelial cells led to cleavage and translocation of SS‐autoantigens, α‐fodrin and SS‐A, into apoptotic particles. The apoptosis‐induced apoptotic particles also contained another SS‐autoantigen, hy1‐RNA. These particles were internalized by pDCs in a size‐dependent manner and affected TLR‐7 and ‐9 expression and the production of proinflammatory cytokines. The analysed androgens protected cells from apoptosis, influenced redistribution of autoantigens and diminished the apoptotic particle‐stimulated increase of the TLRs in pDCs. Our findings suggest that the formation of apoptotic particles may play a role in loss of immune tolerance, manifested by production of autoantibodies and the onset of autoinflammation in SS.

Keywords: apoptosis, autoimmunity, cytokines, dendritic cells, Toll‐like receptors (TLRs)

Introduction

Primary Sjögren's syndrome (pSS) is a female‐dominant autoimmune disease with an obscure aetiology, which targets the exocrine glands 1. Due to the strong female dominance and late onset of SS, usually coinciding with menopause and a decrease in sex steroid levels, we developed the hypothesis that sex steroids are central to the aetiology of SS. We have shown previously that patients with SS are androgen‐depleted both systemically and locally in the salivary glands, a target tissue of SS, and suffer from endocrine and intracrine androgen defects 2, 3, 4, 5.

Diagnosis of SS requires an indication of the autoimmune character of the disease in the form of either the presence of SS autoantibodies directed towards intracellular autoantigens such as Ro52, La or cleaved α‐fodrin 6, 7 or the presence of lymphocyte infiltrates in labial salivary glands 8. The inflammatory foci in the target glands consist of T and B lymphocytes, as well as macrophages and plasmacytoid dendritic cells (pDCs) 9. pDCs are the main producers of type I interferons (IFNs) and act as antigen‐presenting cells (APCs). They initiate an (auto)immune response, but they also induce and maintain tolerance. Compared to conventional DCs, pDCs have high expression of endosomal Toll‐like receptors (TLRs)‐7 and −9, which sense single‐stranded RNA or unmethylated cytosine–phosphate–guanine (CpG) DNA, respectively 10, 11, 12. The nucleic acid stimulating the TLRs and activating pDCs can originate from either invading viruses and bacteria or in the context of autoimmune diseases, albeit of self‐origin.

Immunocomplexes composed of autoantibodies, SS‐autoantigens and single‐stranded hy1‐RNA maintain the inflammatory environment in the target glands by activating local pDCs. This activation is initiated by adhesion of the immunocomplexes via autoantibodies to FcγRIIa receptors on the surface of pDCs followed by internalization of the complexes. This leads to stimulation of endosomal TLR‐7 and ‐9 by hy1‐RNA and secretion of IFN and/or proinflammatory cytokines, which aggravate the inflammation further. Additionally, activation of pDCs leads to processing and presentation of SS autoantigens to T cells and, further, to their priming 13, 14.

Despite intensive research, the mechanisms leading to pDC stimulation and loss of immune tolerance in SS are still unknown. Apoptosis of the epithelial cells is increased in SS target glands 15, 16. In apoptotic cells SS autoantigens are redistributed first to the cell surface and further to apoptotic membrane particles blebbing from the apoptotic cells 17, 18. These particles, composed of smaller microparticles (200–1000 nm) emerging in early apoptosis and larger apoptotic bodies, appearing in later stages of the apoptosis, are carriers of cellular proteins and nucleic acids. Apoptotic particles have been associated with several inflammatory autoimmune diseases 19.

We believe that defects in the production of sex steroids in SS salivary glands lead to increased apoptosis of the epithelial cells. Oestrogen deficiency has been shown to cause apoptosis of the submandibular gland serous epithelial cells and lead to an SS‐like autoimmune exocrinopathy in female, but not male, mice 20, 21. We thus hypothesized that androgens could protect from the oestrogen depletion‐induced apoptosis that could explain the strong female dominance of SS. We propose that apoptotic particles derived from the apoptotic salivary gland cells transfer SS autoantigens and single‐stranded nucleic acids, such as hy1‐RNA, to local pDCs in SS salivary glands. This enables autoantigens and nucleic acids to reach and activate pDCs via endosomal TLRs. Activated pDCs secrete type I IFN and/or proinflammatory cytokines, which may further activate salivary gland epithelial cells and/or immune cells to perpetuate SS inflammation. Thus, androgen depletion in SS not only predisposes salivary gland cells to apoptosis, but also has later affects during pDC‐related stages of the disease, when secretion of IFN‐α leads to amplification of local injury in salivary glands and activation of lymphocytes to promote systemic inflammation. According to our hypothesis, the particle‐mediated activation of pDCs may affect immune tolerance in SS 22. In this study we explore further the role of apoptotic particles and pDC‐mediated autoimmune responses by analysing in‐vitro effects of apoptotic particles from epithelial cells on pDCs in a hormone‐supplemented/depleted environment.

Materials and methods

Cell cultures

HSG cells used in this study for the production of apoptotic particles were thought originally to be established from a human submandibular gland 23, but were found to be indistinguishable from the HeLa epithelial cell line by short‐tandem repeat polymerase chain reaction (STR PCR) DNA profiling, and are therefore currently deposited in Sigma cat. no. 95031024 (St Louis, MO, USA) as HSG (HeLa derivative). Cells were cultured in RPMI‐1640 (Gibco BRL, Grand Island, NY, USA) supplemented with 10% fetal calf serum (FCS), L‐glutamine and antibiotics. Apoptosis was induced with 10 ng/ml tumour necrosis factor (TNF; R&D Systems, Minneapolis, MN, USA) and 10 µg/ml cycloheximide (CHX; Sigma) for 4 h 24. Live cells and apoptotic blebs were visualized with CellTrace green dye (Molecular Probes, Leiden, the Netherlands) and live and dead cells with the live/dead kit for mammalian cells (Invitrogen, San Diego, CA, USA). Cells cultured on coverslips and treated with apoptotic agents with or without sex steroids were stained according to the manufacturer's instructions and observed with a fluorescence microscope. Living cells and the ratio of live/dead cells were counted by segmenting, using the maximum entropy‐based thresholding and watershed‐algorithm (Image J; National Institutes of Health, Bethesda, MD, USA). Apoptosis was also detected by annexin V staining with a polyclonal goat antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA) and fluorescein isothiocyanate (FITC)‐conjugated donkey anti‐goat immunoglobulin (Ig)G as a secondary antibody (Molecular Probes) blocked with 10% donkey normal serum (Dako, Glostrup, Denmark). Propidium iodide was used as a nuclear stain, while control cells were permeabilized with 0·5% Triton X‐100.

A human pDC cell line GEN2.2 (I‐2938, CNCM) was a gift from Professor Chaperot and Professor Plumas [Etablissement Français du Sang (EFS)/(French Blood Establishment), Saint Denis, Paris, France]. Cells were first cultured on irradiated mouse stromal feeder cells MS‐5 [ACC 441; Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (German Collection of Microorganisms and Cell Cultures), Braunschweig, Germany] in RPMI‐1640 (Gibco BRL) 25 and stimulations were performed without feeder cells.

Patients and samples

Serum and saliva samples were collected for α‐fodrin measurement, as described previously 3, 26, from patients with pSS (n = 13, aged 44–70 years, average 56 years) before and after dehydroepiandrosterone (DHEA) replacement therapy 27 and from healthy controls (n = 13, aged 23–51 years, average 37 years). α‐Fodrin was measured with enzyme‐linked immunosorbent assay (ELISA) (USCN Life Science, Inc., Wuhan, China).

Isolation of apoptotic microparticles

After apoptosis induction in epithelial cell cultures, particles were collected by five consecutive centrifugations of the culture media at different speeds: first, at 89 g for 10 min yielded pellet 1; secondly, pellet 2 at 357 g for 10 min; thirdly, pellet 3 at 1400 g for 10 min; fourthly, pellet 4 at 16 000 g for 120 min; and finally, pellet 5 at 100 000 g for 1 h. For flow cytometry, 200 µl of phosphate‐buffered saline (PBS) was added to pellets and the samples were analysed with fluorescence activated cell sorter (FACS)Aria (BD Biosciences, San Jose, CA, USA). Gates were set for 1 and 4 µm with control latex fluorescence (FITC) beads (L4655; Sigma) and FACSAria control beads (Supporting information, Fig. S1). Epithelial cells were labelled fluorescently with CellTrace™ carboxyfluorescein succinimidyl ester (CFSE) (Molecular Probes/Life Technologies, Grand Island, NY, USA) for flow cytometry, electron microscopy and cytochemistry analyses. For imaging, 100 µl of suspended pellets were cytospinned and particles/cells were analysed using a Leica DM6000 microscope (Leica Microsystems, Wetzlar, Germany) and Leica TCS SP2 AOBS laser scanning confocal microscope (Leica Microsystems). pDCs were stained with HCS CellMask Blue (Molecular Probes) for cytoplasm and To‐PRO‐3 (Molecular Probes) for nuclei.

To quantify microparticles with flow cytometry, events in the size range of 0·1–1·0 µm particle diameter were gated and recorded during a 60‐s running time. Results were expressed as relative number of microparticles in relation to particles from untreated cells. For autoantigen expression within the apoptotic bodies and microparticles, they were fixed and permeabilized with 0·25% saponin. Cleaved α‐fodrin was detected with a polyclonal rabbit antibody (Cell Signaling, Danvers, MA, USA) specific for the 150‐kD amino terminal cleavage product of human α‐fodrin (Asp 1185) and AlexaFluor FITC‐conjugated donkey anti‐rabbit IgG as a secondary antibody (Molecular Probes, Leiden, the Netherlands). SSA/Ro 52 was detected using a reference human serum (with SSA/Ro52 reactivity, Centers for Disease Control Atlanta, GA, USA) and FITC‐conjugated anti‐human IgG (Nova Diagnostics Inc., Brooklyn, NY, USA)

Stimulation of pDC

pDCs were stimulated with isolated apoptotic particles for 18 h. Pellets 3–5 were suspended with 500 µl of cell culture media (RPMI‐1640; Gibco BRL) and 100 µl was used for stimulation pDCs cultured at 8 × 10⁵ cells/ml in a 96‐well plate. TLR‐7 ligand (Imiquimod‐R837; InvivoGen, San Diego, CA, USA) was used as positive and negative control without apoptotic particles. The effect of hormones on pDC activation was tested by adding dihydrotestosterone (DHT; 1, 10, 100 nM) or 17‐β‐oestradiol (E2; 0·1, 1, 10 nM) 24 h prior to stimulation.

Quantitative reverse transcription–polymerase chain reaction (RT–PCR)

Total RNA was extracted from pDC using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA). Complementary first‐strand DNA (cDNA) was synthesized from 100 ng of total RNA in 20 µl with iScript cDNA Synthesis Kit (Bio‐Rad, Hercules, CA, USA). Expression of TLR‐7 and ‐9 in stimulated pDCs and type I IFNs in TLR‐7 ligand‐ and particle‐stimulated pDCs was studied with quantitative iQ5 real‐time PCR detection system (Bio‐Rad) containing 2 µl of cDNA and 250 nM of each primer (Table 1). Relative expression was analysed using the ΔΔCt method.

Table 1.

Primer sequences and accession numbers of target genes for qRT–PCR analysis

Gene	Accession no.	Forward	Reverse
TLR‐7	NM_016562	ATGCTCTGCTCTCTTCAACC	TGGTTAATGGTGAGGGTGAG
TLR‐9	NM_017442	TGTTGTCCTACAACCGCATC	TCAACACCAGGCCTTCAAGA
IFN‐α2	NM_000605	TTCGTATGCCAGCTCACCTT	ATCAGTCAGCATGGTCCTCTG
IFN‐β1	NM_002176	GAGCTACAACTTGCTTGGATTCC	CAAGCCTCCCATTCAATTGC
hy1‐RNA	NR_004391	GGCTGGTCCGAAGGTAGTGA	GCAGTAGTGAGAAGGGGGGA
RPLP0	NM_001002/NM_053275	CCATCAGCACCACAGCCTTC	GGCGACCTGGAAGTCCAACT
HPRT	NM_000194	AGATCCATTCCTATGACT	CATCTCCACCAATTACTT

Open in a new tab

qRT–PCR = quantitative polymerase chain reaction; TLR = Toll‐like receptor; IFN = interferon; RPLP0 = ribosomal protein lateral stalk subunit P0; HPRT = hypoxanthine–guanine phosphoribosyltransferase.

Immunofluorescence staining

Staining of α‐fodrin was performed with antibody recognizing only the cleaved form of α‐fodrin (Cell Signaling). Cells grown on coverslips, treated with apoptotic inducers with or without sex steroids, were permeabilized with 0·5% Triton X‐100, blocked with 10% goat normal serum (Dako) and incubated in the primary antibody diluted 1 : 100 overnight in +4°C. Rabbit IgG was used as negative control. Nuclei were stained with 4',6‐diamidino‐2‐phenylindole (DAPI) (Sigma).

Western blot

The pellets of apoptotic particles were suspended in lysis buffer [10 mM Tris, 150 mM NaCl, ethylenediamine tetraacetic acid (EDTA) 7 mM, 0·5% NP‐40, pH 7.7] supplemented with 1 mM phenylmethane sulphonyl fluoride (PMSF) and 1/100 aprotinin. Cells treated with TNF and CHX were used as positive controls. Samples were incubated for 15 min on ice in lysis buffer and heated for 8 min at +70°C in sample buffer (Invitrogen). Protein electrophoresis was performed using 10% sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS‐PAGE) (NuPAGE; Invitrogen). For Western blot, membranes were incubated with primary antibodies (cleaved α‐fodrin, SSA/Ro52; see above) overnight at +4°C, with horseradish peroxidase (HRP)‐conjugated secondary antibody for 1 h at room temperature (RT) and finally in chemiluminescence substrate solution (GE Healthcare, Amersham, UK).

Analysis of pDC cytokine profiles

The effect of apoptotic particles on cytokine secretion by pDCs was assessed with the xMAP kit (MPXHCYTO‐60K; Millipore) using the Bio‐Plex 200 system (Bio‐Rad). To measure the effect of 17‐β‐oestradiol and DHT on the pDC cytokine profile, the cytokines that were most affected by apoptotic particles [interleukin (IL)‐4, IL‐6, IL‐8, TNF and IL‐10] were also quantified with the fluorokine multi‐analyte profiling (MAP) kit (R&D Systems, Minneapolis, MN, USA) after hormone stimulation. The production of type I IFN‐α in TLR‐7 ligand‐ and particle‐stimulated pDCs was also verified with the Verikine human IFN‐α ELISA kit (PBL Assay Science, Piscataway, NJ, USA).

Statistical analysis

Relative proportions of live/dead cells after apoptotic ± hormone stimulations were compared using the Mann–Whitney U‐test. Overall effects of stimulations with different concentrations of sex steroids were studied using the Kruskall–Wallis test. The levels of α‐fodrin in serum and saliva, the amount of microparticles and hy1‐RNA expression were compared with the Mann–Whitney test. qPCR data were analysed using one‐way analysis of variance (anova) with Tukey's post‐hoc test. Data in figures are presented as mean ± standard error of the mean (s.e.m.). The level of significance was set at 0·05.

Results

Induction and isolation of apoptotic particles in epithelial cells by TNF and cycloheximide

Treatment with 10 ng/ml TNF and 10 µg/ml CHX for 4 h, which induces extrinsic apoptosis 22, decreased the proportion of living cells (from 87·4 to 11·9%; P < 0·001; Fig. 1a) and almost doubled the secretion of apoptotic particles compared with untreated cells (P < 0·001; n = 12, Fig. 1b). Cell death was shown to be due to apoptosis, as shown by positive annexin V staining (Fig. 1c). During the first steps of isolation apoptotic particles were separated from cells and cell debris in pellets 1 and 2. Apoptotic bodies (1–4 µm) and microparticles (200–1000 nm) were collected during the next centrifugation steps. Exact separation of apoptotic bodies and microparticles was not feasible, because their sizes overlapped partially. In pellet 3 there were more apoptotic bodies, while there were more microparticles in pellet 5. Pellet 4 contained equal amounts of both (Supporting information, Fig. S2).

Induction of apoptosis by tumour necrosis factor/cycloheximide (TNF/CHX). (a) Cells before apoptotic treatment and after exposure to TNF/CHX forming apoptotic blebs. Green: CellTrace green dye. (b) Increase of apoptotic particle levels after TNF/CHX treatment. Value 1 represents the arithmetic mean of microparticle numbers counted from 12 control wells (n = 12). (c) Increased apoptosis after TNF/CHX treatment by positive annexin V staining. Green: annexin V, red: propidium iodide. ***P < 0·001; CTRL: control cells. Scale bar 100 µm.

Apoptosis induces the secretion of apoptotic particles and leads to processing of SS autoantigens and the presence of hy1‐RNA in apoptotic particles

Apoptotic treatment with 10 ng/ml TNF and 10 µg/ml CHX was associated with increased cleavage of SS autoantigen α‐fodrin (Fig. 2a). Single‐stranded hy1‐RNA, which is part of the RNP complexes, together with SS autoantigens Ro and La, was detected in cell‐derived apoptotic particles (n = 12, Fig. 2b). Apoptotic particles contained SS autoantigen‐cleaved α‐fodrin and SSA/Ro52, as shown by flow cytometry (n = 12). SSA/Ro52 was increased significantly by TNF/CHX and was localized both on the surface and inside the particles (Fig. 2c). Conversely, the differences of cleaved α‐fodrin was found in cell‐derived particles only after the TNF/CHX stimulation and was found only inside the particles (Fig. 2c).

Apoptosis induced Sjögren's syndrome (SS) autoantigens. Apoptotic treatment [tumour necrosis factor + cycloheximide (TNF + CHX)] leads to α‐fodrin cleavage (a), increase of hy1‐RNA (b, n = 12) and accumulation of SSA/Ro52 on the surface of the apoptotic particles and inside of the particles (c, n = 12). The amount of cleaved α‐fodrin is the same before and after apoptotic treatment on the surface of particles, but inside the particles there is an increase of accumulation of cleaved α‐fodrin (c). *P < 0·05; ***P < 0·0001; y‐axis: mean fluorescence intensity. Grey bars: untreated cells, black bars: cells treated with TNF and CHX.

Expression of TLRs and the secretion of cytokines after pDC stimulation with apoptotic particles

Apoptotic particles were attached to or taken into pDCs (Fig. 3a). The intake of fraction P4 increased the expression of endosomal TLR‐9 (P = 0·035) and P5 TLR‐7 (P = 0·013, n = 4, Fig. 3b). The TLR‐7 ligand induced pDC maturation, as determined by the induction of IFNs, while particle fractions showed a slight or no increase (Fig. 3c). Stimulation of pDCs with apoptotic particles had a clear effect on the secretion of proinflammatory cytokines by pDCs. The most increased cytokines were TNF (95·2 and 1465·6 pg/ml, before and after P5 stimulation, respectively, n = 4) and IL‐8 (1·4 and 2366·1 pg/ml) (Fig. 3d). The production of anti‐inflammatory cytokines (IL‐4, IL‐10) was either non‐detectable or very weak (data not shown).

The intake of apoptotic particles increased Toll‐like receptors (TLRs) and proinflammatory cytokines in plasmacytoid dendritic cells (pDCs). Cell‐derived apoptotic particles were attached to the surface or taken into pDCs (a). Expression of endosomal TLR‐7 and ‐9 (b, n = 4), interferon (IFN)‐α2 and IFN‐β1 (c, n = 3) and production of proinflammatory cytokines (d, n = 4) in pDCs. *P < 0·05; ****P < 0·0001; panel (c) *versus* TLR‐7 ligand‐induced stimulation. Scale bar 20 µm. Red: nuclear stain, blue: cytoplasm, green: apoptotic particles.

Effect of sex steroids on pDC cytokine profile and TLR expression

DHT and pretreatments decreased apoptotic particle fraction P4‐induced expression of TLR‐9 in pDCs (P = 0·049; n = 4, Fig. 4), but had no effect on P4‐induced expression on TLR‐7. DHT and E2 had no significant effect on P3‐ and P5‐induced TLR expression. Pretreatment with either DHT or E2 did not affect the production of proinflammatory TNF, IL‐6 or IL‐8 or anti‐inflammatory IL‐4 and IL‐10.

Androgen effects on Toll‐like receptor (TLR) expression in plasmacytoid dendritic cells (pDCs). Dihydrotestosterone (DHT) pretreatment resulted in decrease of TLR‐9 and increase of TLR‐7 expression in pDCs (n = 3). P4: fraction of apoptotic particles, E₂: oestradiol. *P < 0·05; **P < 0·01 *versus* control; ⁺ P < 0·05 *versus* P4.

Effect of androgens on epithelial cells apoptosis and cleavage of α‐fodrin

DHT decreased epithelial cell apoptosis induced by TNF and CHX (Fig. 5a–c). Pretreatment of cells with different concentrations of DHT prior to 10 ng/ml TNF and 10 μg/ml CHX treatment increased the proportion of living cells compared to cells with no hormonal pretreatment (P = 0·017; n = 12). Individual effects of DHT concentrations were as follows: pretreatment with 0·5 nM DHT increased the proportion of living cells from 11·9 to 25·8% (P = 0·018), 10 nM DHT to 26·6% (P = 0·004), 100 nM DHT to 20% (P = 0·009) and 1 µM DHT to 23·4% (P = 0·01). One µM DHEA also increased the proportion of living cells (from 13·7 to 22·4%) observed after apoptosis induction, but the difference was not significant (P = 0·091). α‐Fodrin cleavage was protected with 1 µM DHEA and higher concentrations of DHT (10, 100 and 1000 nM), but not 0·5 nM (Fig. 5d–g); 17‐β‐oestradiol had no effect on apoptosis or α‐fodrin cleavage of TNF/CHX‐treated cells.

Androgens protected cells from apoptosis. Untreated cells (a) were induced to apoptosis with tumour necrosis factor and cycloheximide (TNF and CHX) (b) and protected from apoptosis by dihydrotestosterone (DHT) (c). Green: live cells, red: dead cells. α‐Fodrin cleavage was induced by TNF and CHX (e) compared to untreated cells (d). Minor α‐fodrin cleavage was observed in cultures containing 1 µM dehydroepiandrosterone (DHEA) (f) and 100 nM DHT (g). Blue: nuclear stain, green: cleaved α‐fodrin (d–g). Scale bar 100 µm.

SS autoantigen α‐fodrin in saliva and serum of pSS patients

The amount of α‐fodrin in serum did not differ significantly between healthy controls and pSS patients (11·38 ± 1·02 ng/ml versus 10·95 ± 0·51 ng/ml, respectively; n = 13). Additionally, DHEA treatment did not affect serum levels of α‐fodrin in pSS patients (10·95 ± 0·51 ng/ml versus 11·33 ± 0·55 ng/ml before and after DHEA treatment, respectively) (data not shown). However, salivary α‐fodrin was higher in patients with SS compared to healthy controls (2·0 ± 0·49 ng/ml versus 0·929 ± 0·24 ng/ml, respectively; P < 0·05, n = 13). DHEA treatment caused a decrease of salivary α‐fodrin levels, but this change did not reach statistical significance in our group of patients (2·0 ± 0·49 ng/ml versus 1·66 ± 0·31 ng/ml before and after DHEA treatment, respectively; Fig. 6).

Autoantigen α‐fodrin is increased in saliva of Sjögren's syndrome (SS) patients. SS patients have higher amounts of α‐fodrin in saliva than the control group. Salivary α‐fodrin decreased after dehydroepiandrosterone (DHEA) treatment, but the change was not statistically significant in this group (n = 13). *P < 0·05 *versus* control.

Discussion

The factors causing the loss of immune tolerance and onset of pSS are still obscure. We postulated that epithelial cell apoptosis and the following pDC activation cause the breakdown of immune tolerance in pSS patients. As SS‐related autoimmune processes affect women so discriminatingly and not men, we hypothesized that hormonal imbalance is the fundamental cause of the increased apoptosis associated with autoimmune inflammation in the SS target glands. Although, in this study, we have focused upon hormonal aspects, genetic and environmental factors also influence the development of SS 7, 28. We tested our hypothesis by studying the role of apoptosis‐related events on the activation of pDCs and onset of autoimmunity in salivary glands. We also evaluated the effect of sex steroids in these processes.

Apoptosis plays a role in normal tissue homeostasis as well as during embryogenesis. However, apoptosis participates in the pathogenic processes of many diseases, of which SS is an example [16]. In this study we showed that apoptosis of the epithelial cells leads to the processing and redistribution of SS autoantigens α‐fodrin and SS‐A (Ro) to cell surface blebs. We found that the effects of apoptotic particles depend upon their size. Differential localization of autoantigens, either on the surface or inside the particles, may also affect separate pathways in target cells: smaller particles binding receptors inside and larger particles outside on the surface of the cells. Future study of the content of different fractions may identify new markers and potential different pathways associated with different populations of apoptotic particles in autoimmunity. Here, current observations supported our hypothesis, according to which these particles carry SS autoantigens, and demonstrated that these apoptotic particles are attached to or taken into pDCs. Accordingly, epithelial cell‐derived apoptotic particles can carry SS‐autoantigens to local pDCs located in SS salivary glands, and consequently pDCs can be activated by autoantigens in SS.

Once inside the pDCs, hy1‐RNA can activate the cells via TLR‐7 or TLR‐9. We showed that the stimulation of pDCs with apoptotic particles leads to increased expression of both TLR‐7 and TLR‐9. Additionally, we showed that apoptotic particles also carry self‐hy1‐RNA, which is a ligand for TLR‐7. We also demonstrated that the TLR‐mediated activation of pDCs results in increased secretion of proinflammatory cytokines TNF and IL‐8. Interestingly, intake of apoptotic particles only slightly induced the production of type I IFN in pDCs. However, this was predictable, as the stimulation of pDCs via TLR agonists has been shown to lead to either IFN regulatory factor 7 (IRF7)‐mediated type I IFN production or nuclear factor kappa B (NF‐κB)‐mediated production of proinflammatory cytokines and maturation into antigen‐presenting cells. TLR ligands targeted to early endosomes lead to type I IFNs production, whereas TLR ligands that localize in the late endosomes lead to maturation of pDCs and production of proinflammatory cytokines 29, 30, 31. Thus, our results suggest that cell‐derived apoptotic particles activate TLRs in late rather than early endosomes.

Cytokines produced by pDCs can direct the differentiation of T lymphocytes into different T helper (Th) subsets. IL‐12 and type I IFNs promote the synthesis of Th1 cells and may take part in the autoimmune processes 32. Th2 cells, involved in allergic responses and asthma, are produced in the presence of IL‐4. However, the maturation of pDCs following particle stimulation enables pDCs to express proinflammatory cytokines TNF and IL‐8. In SS, pDCs are present in salivary glands and may thus contribute to local inflammation 33. Increase of TNF and IL‐6 cytokines was observed earlier in patients with pSS on systemic and/or salivary gland levels. Systemic levels of IL‐8 were demonstrated to be decreased significantly in pSS 34, 35, while in our study IL‐8 increased in the apoptotic environment of pDC. Apoptotic particles may induce autoimmunity by expressing autoantigens and initiate autoantibody production although, in SS, the production of autoantibodies may appear years before the onset of SS and, thus, before menopause 36. It has been shown that autoantibodies from SS patients trigger apoptosis 37. Consequently, the increased production of apoptotic particles after menopause may play a role in maintaining and perpetuating the production of autoantibodies and inflammation leading to the clinical manifestation of SS.

We have demonstrated that androgens reduce apoptosis and α‐fodrin cleavage in epithelial cells, which could explain the epithelial cell destruction in SS salivary glands in which only limited amounts of androgens are available. At the patient level, we demonstrated higher levels of α‐fodrin in SS saliva, but not in serum, in DHEA‐deficient pSS patients. Local defects in the synthesis of the most active androgen DHT from DHEA in SS salivary glands 4, 5 could explain why oral DHEA treatment did not decrease the α‐fodrin levels significantly in SS saliva. We showed that androgens also affect pDC by decreasing TLR‐9 expression in pDCs stimulated with apoptotic particles. In women, who do not have testicle‐derived testosterone in their circulation, the local intracrine synthesis of androgens is essential, especially after the menopause. When both systemic DHEA production and local DHT synthesis are defective, as is the case in pSS salivary glands 4, 5, patients suffer from local androgen depletion. Accordingly, androgen impediments seen in SS can predispose women to apoptosis, pDC activation and finally to loss of immunological tolerance.

The present study has some limitations. The study was started with the primary idea of using an HSG cell line as a model for salivary gland epithelial cells. Unfortunately, this cell line was found afterwards to be contaminated with HeLa cells at an earlier stage. However, the cell line was then used in this study only as a source for apoptotic particles. A pDC cell line was also used instead of primary cells, as concentration in peripheral blood is only < 0·4%, and thus it was not possible to acquire enough primary cells for this study. Further studies with salivary gland cells and primary pDCs are needed to confirm our results.

In conclusion, we have demonstrated that apoptosis of the epithelial cells leads to the redistribution of SS autoantigens, including hy1‐RNA, to apoptotic particles blebbing from the apoptotic cells. These particles carry autoantigens and adjuvant nucleic acid to pDCs found in local infiltrates in pSS salivary glands. pDCs are stimulated via TLR‐7 and ‐9 by the nucleic acid to mature and produce proinflammatory cytokines, enabling the activation of autoreactive T and B cells. We found that the effects of apoptotic particles on TLR expression and cytokine production depend upon the particle size. These events could explain how immune tolerance is broken in SS. Androgens protect epithelial cells from apoptosis and the redistribution of autoantigens and prevent the up‐regulation of TLR‐9 in particle‐stimulated pDCs. Thus, androgen defects during menopause, caused by systemic androgen depletion and defective local DHT production in SS salivary glands, might enhance salivary gland cell apoptosis, the presentation of danger signals and potential autoantigens resulting in pDC activation, which might lead to the loss of immune tolerance, the production of autoantibodies and the onset of autoinflammation.

Disclosure

The authors declare that they have no competing interests.

Author contributions

M. A., P. P., Y. T., V. P. K. and A. T. T. made substantial contributions to analysis and interpretation of data. M. A., P. P., B. P., A. H. and D. C. N. made substantial contributions to study concept and design. M. A., P. P., Y. T., B. P., V. P. K. and D. C. N. made substantial contributions to manuscript preparation.

Supporting information

Additional Supporting information may be found in the online version of this article at the publisher's web‐site:

Fig S1. (a) Gating strategy for apoptotic particles (G1, G2, G3) with control beads (1, 2·5 and 5 um) and (b) representative flow cytometry images from pellets 1 and 3. Yellow G1: microparticles (MP), blue G2: apoptotic bodies (AB), green G3: cells/cell debris.

Click here for additional data file.^{(1.5MB, pdf)}

Fig. S2. Extraction of apoptotic particles using different centrifugation steps. Apoptotic bodies (1–4 µm) were secreted mainly in pellet 3 (P3) and microparticles (200–1000 nm) in pellet 5 (P5), as shown with immunofluorescence staining (a) and flow cytometry (b). (a) Green colour: CellTracker inside the cells, apoptotic bodies and microparticles. Red: DNA stain. Microparticles are shown without DNA stain mainly in Fig. P5, with higher magnification included. Scale bars for µm indication. (b) Green: cells more than 4 µm; blue: apoptotic bodies, 1–4 µm; yellow: microparticles under 1 µm.

Click here for additional data file.^{(7.2MB, jpg)}

Acknowledgements

We would like to thank the late Professor Yrjö Konttinen for his leadership and encouragement. We also thank the Biomedicum Imaging Unit in Helsinki, Finland for imaging facilities. Eija Kaila and Erkki Hänninen are acknowledged for technical help. All patients provided written informed consent and ethical approval was granted by the Ethical Committee of the Helsinki and Uusimaa Hospital District. All the procedures in the study were followed in accordance with the Declaration of Helsinki. This work was supported by the Academy of Finland, Finnish‐Norwegian Medical Foundation, Finnish Society for Rheumatology, Finska Läkaresällskapet, Helsinki University Central Hospital, Jane and Aatos Erkko Foundation, Magnus Ehrnrooth Foundation, Maire Lisko Foundation, The Finnish Rheumatism Association, Orion Research Foundation, ORTON Foundation, Scandinavian Rheumatology Research Foundation and University of Helsinki. The funders had no role in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript.

References

1. Fox RI. Sjögren's syndrome. Lancet 2005; 366:321–31. [DOI] [PubMed] [Google Scholar]
2. Laine M, Porola P, Udby L et al Low salivary dehydroepiandrosterone and androgen‐regulated cysteine‐rich secretory protein 3 levels in Sjogren's syndrome. Arthritis Rheum 2007; 56:2575–84. [DOI] [PubMed] [Google Scholar]
3. Porola P, Virkki L, Przybyla BD et al Androgen deficiency and defective intracrine processing of dehydroepiandrosterone in salivary glands in Sjogren's syndrome. J Rheumatol 2008; 35:2229–35. [DOI] [PubMed] [Google Scholar]
4. Spaan M, Porola P, Laine M, Rozman B, Azuma M, Konttinen YT. Healthy human salivary glands contain a DHEA‐sulphate processing intracrine machinery, which is deranged in primary Sjogren's syndrome. J Cell Mol Med 2009; 13:1261–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
5. Porola P, Straub RH, Virkki LM, Konttinen YT, Nordstrom DC. Failure of oral DHEA treatment to increase local salivary androgen outputs of female patients with Sjogren's syndrome. Scand J Rheumatol 2011; 40:387–90. [DOI] [PubMed] [Google Scholar]
6. Witte T, Matthias T, Arnett FC et al IgA and IgG autoantibodies against alpha‐fodrin as markers for Sjogren's syndrome. Systemic lupus erythematosus. J Rheumatol 2000; 27:2617–20. [PubMed] [Google Scholar]
7. Jonsson R, Vogelsang P, Volchenkov R, Espinosa A, Wahren‐Herlenius M, Appel S. The complexity of Sjögren's syndrome: novel aspects on pathogenesis. Immunol Lett 2011; 141:1–9. [DOI] [PubMed] [Google Scholar]
8. Vitali C, Bombardieri S, Jonsson R et al Classification criteria for Sjogren's syndrome: a revised version of the European criteria proposed by the American–European Consensus Group. Ann Rheum Dis 2002; 61:554–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
9. Manoussakis MN, Boiu S, Korkolopoulou P et al Rates of infiltration by macrophages and dendritic cells and expression of interleukin‐18 and interleukin‐12 in the chronic inflammatory lesions of Sjogren's syndrome: correlation with certain features of immune hyperactivity and factors associated with high risk of lymphoma development. Arthritis Rheum 2007; 56:3977–88. [DOI] [PubMed] [Google Scholar]
10. Colonna M, Trinchieri G, Liu YJ. Plasmacytoid dendritic cells in immunity. Nat Immunol 2004; 5:1219–26. [DOI] [PubMed] [Google Scholar]
11. Gilliet M, Cao W, Liu YJ. Plasmacytoid dendritic cells: sensing nucleic acids in viral infection and autoimmune diseases. Nat Rev Immunol 2008; 8:594–606. [DOI] [PubMed] [Google Scholar]
12. Swiecki M, Colonna M. Unraveling the functions of plasmacytoid dendritic cells during viral infections, autoimmunity, and tolerance. Immunol Rev 2010; 234:142–62. [DOI] [PMC free article] [PubMed] [Google Scholar]
13. Båve U, Nordmark G, Lövgren T et al Activation of the type I interferon system in primary Sjogren's syndrome: a possible etiopathogenic mechanism. Arthritis Rheum 2005; 52:1185–95. [DOI] [PubMed] [Google Scholar]
14. Vakaloglou KM, Mavragani CP. Activation of the type I interferon pathway in primary Sjogren's syndrome: an update. Curr Opin Rheumatol 2011; 23:459–64. [DOI] [PubMed] [Google Scholar]
15. Kong L, Ogawa N, Nakabayashi T et al Fas and Fas ligand expression in the salivary glands of patients with primary Sjogren's syndrome. Arthritis Rheum 1997; 40:87–97. [DOI] [PubMed] [Google Scholar]
16. Manganelli P, Fietta P. Apoptosis and Sjogren syndrome. Semin Arthritis Rheum 2003; 33:49–65. [DOI] [PubMed] [Google Scholar]
17. McArthur C, Wang Y, Veno P, Zhang J, Fiorella R. Intracellular trafficking and surface expression of SS‐A (Ro), SS‐B (La), poly(ADP‐ribose) polymerase and alpha‐fodrin autoantigens during apoptosis in human salivary gland cells induced by tumour necrosis factor‐alpha. Arch Oral Biol 2002; 47:443–8. [DOI] [PubMed] [Google Scholar]
18. Ohlsson M, Jonsson R, Brokstad KA. Subcellular redistribution and surface exposure of the Ro52, Ro60 and La48 autoantigens during apoptosis in human ductal epithelial cells: a possible mechanism in the pathogenesis of Sjogren's syndrome. Scand J Immunol 2002; 56:456–69. [DOI] [PubMed] [Google Scholar]
19. Beyer C, Pisetsky DS. The role of microparticles in the pathogenesis of rheumatic diseases. Nat Rev Rheumatol 2010; 6:21–9. [DOI] [PubMed] [Google Scholar]
20. Ishimaru N, Saegusa K, Yanagi K, Haneji N, Saito I, Hayashi Y. Estrogen deficiency accelerates autoimmune exocrinopathy in murine Sjogren's syndrome through Fas‐mediated apoptosis. Am J Pathol 1999; 155:173–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
21. Ishimaru N, Arakaki R, Watanabe M, Kobayashi M, Miyazaki K, Hayashi Y. Development of autoimmune exocrinopathy resembling Sjogren's syndrome in estrogen‐deficient mice of healthy background. Am J Pathol 2003; 163:1481–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
22. Konttinen YT, Fuellen G, Bing Y et al Sex steroids in Sjogren's syndrome. J Autoimmun 2012; 39:49–56. [DOI] [PubMed] [Google Scholar]
23. Shirasuna K, Sato M, Miyazaki T. A neoplastic epithelial duct cell line established from an irradiated human salivary gland. Cancer 1981; 48:745–52. [DOI] [PubMed] [Google Scholar]
24. Wang Y, Shnyra A, Africa C, Warholic C, McArthur C. Activation of the extrinsic apoptotic pathway by TNF‐alpha in human salivary gland (HSG) cells in vitro suggests a role for the TNF receptor (TNF‐R) and intercellular adhesion molecule‐1 (ICAM‐1) in Sjogren's syndrome‐associated autoimmune sialadenitis. Arch Oral Biol 2009; 54:986–96. [DOI] [PubMed] [Google Scholar]
25. Chaperot L, Blum A, Manches O et al Virus or TLR agonists induce TRAIL‐mediated cytotoxic activity of plasmacytoid dendritic cells. J Immunol 2006; 176:248–55. [DOI] [PubMed] [Google Scholar]
26. Konttinen YT, Platts LA, Tuominen S et al Role of nitric oxide in Sjogren's syndrome. Arthritis Rheum 1997; 40:875–83.] [DOI] [PubMed] [Google Scholar]
27. Virkki LM, Porola P, Forsblad‐d'Elia H, Valtysdottir S, Solovieva SA, Konttinen YT. Dehydroepiandrosterone (DHEA) substitution treatment for severe fatigue in DHEA‐deficient patients with primary Sjogren's syndrome. Arthritis Care Res (Hoboken) 2010; 62:118–24. [DOI] [PubMed] [Google Scholar]
28. Klein SL, Flanagan KL. Sex differences in immune responses. Nat Rev Immunol 2016; 16:626–38. [DOI] [PubMed] [Google Scholar]
29. Latz E, Schoenemeyer A, Visintin A et al TLR9 signals after translocating from the ER to CpG DNA in the lysosome. Nat Immunol 2004; 5:190–8. [DOI] [PubMed] [Google Scholar]
30. Guiducci C, Ott G, Chan JH et al Properties regulating the nature of the plasmacytoid dendritic cell response to Toll‐like receptor 9 activation. J Exp Med 2006; 203:1999–2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
31. Jaehn PS, Zaenker KS, Schmitz J, Dzionek A. Functional dichotomy of plasmacytoid dendritic cells: antigen‐specific activation of T cells versus production of type I interferon. Eur J Immunol 2008; 38:1822–32. [DOI] [PubMed] [Google Scholar]
32. Cella M, Facchetti F, Lanzavecchia A, Colonna M. Plasmacytoid dendritic cells activated by influenza virus and CD40L drive a potent TH1 polarization. Nat Immunol 2000; 1:305–10. [DOI] [PubMed] [Google Scholar]
33. Vogelsang P, Brun JG, Oijordsbakken G, Skarstein K, Jonsson R, Appel S. Levels of plasmacytoid dendritic cells and type‐2 myeloid dendritic cells are reduced in peripheral blood of patients with primary Sjogren's syndrome. Ann Rheum Dis 2010; 69:1235–8. [DOI] [PubMed] [Google Scholar]
34. Szodoray P, Alex P, Brun JG, Centola M, Jonsson R. Circulating cytokines in primary Sjogren's syndrome determined by a multiplex cytokine array system. Scand J Immunol 2004; 59:592–9. [DOI] [PubMed] [Google Scholar]
35. Kang EH, Lee YJ, Hyon JY, Yun PY, Song YW. Salivary cytokine profiles in primary Sjogren's syndrome differ from those in non‐Sjogren sicca in terms of TNF‐alpha levels and Th‐1/Th‐2 ratios. Clin Exp Rheumatol 2011; 29:970–6. [PubMed] [Google Scholar]
36. Theander E, Jonsson R, Sjöström B, Brokstad K, Olsson P, Henriksson G. Prediction of Sjögren's syndrome years before diagnosis and identification of patients with early onset and severe disease course by autoantibody profiling. Arthritis Rheumatol 2015; 67:2427–36. [DOI] [PubMed] [Google Scholar]
37. Sisto M, Lisi S, Lofrumento D, D'Amore M, Scagliusi P, Mitolo V. Autoantibodies from Sjögren's syndrome trigger apoptosis in salivary gland cell line. Ann NY Acad Sci 2007; 1108:418–25. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Additional Supporting information may be found in the online version of this article at the publisher's web‐site:

Click here for additional data file.^{(1.5MB, pdf)}

Click here for additional data file.^{(7.2MB, jpg)}

[cei13077-bib-0001] 1. Fox RI. Sjögren's syndrome. Lancet 2005; 366:321–31. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0002] 2. Laine M, Porola P, Udby L et al Low salivary dehydroepiandrosterone and androgen‐regulated cysteine‐rich secretory protein 3 levels in Sjogren's syndrome. Arthritis Rheum 2007; 56:2575–84. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0003] 3. Porola P, Virkki L, Przybyla BD et al Androgen deficiency and defective intracrine processing of dehydroepiandrosterone in salivary glands in Sjogren's syndrome. J Rheumatol 2008; 35:2229–35. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0004] 4. Spaan M, Porola P, Laine M, Rozman B, Azuma M, Konttinen YT. Healthy human salivary glands contain a DHEA‐sulphate processing intracrine machinery, which is deranged in primary Sjogren's syndrome. J Cell Mol Med 2009; 13:1261–70. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cei13077-bib-0005] 5. Porola P, Straub RH, Virkki LM, Konttinen YT, Nordstrom DC. Failure of oral DHEA treatment to increase local salivary androgen outputs of female patients with Sjogren's syndrome. Scand J Rheumatol 2011; 40:387–90. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0006] 6. Witte T, Matthias T, Arnett FC et al IgA and IgG autoantibodies against alpha‐fodrin as markers for Sjogren's syndrome. Systemic lupus erythematosus. J Rheumatol 2000; 27:2617–20. [PubMed] [Google Scholar]

[cei13077-bib-0007] 7. Jonsson R, Vogelsang P, Volchenkov R, Espinosa A, Wahren‐Herlenius M, Appel S. The complexity of Sjögren's syndrome: novel aspects on pathogenesis. Immunol Lett 2011; 141:1–9. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0008] 8. Vitali C, Bombardieri S, Jonsson R et al Classification criteria for Sjogren's syndrome: a revised version of the European criteria proposed by the American–European Consensus Group. Ann Rheum Dis 2002; 61:554–8. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cei13077-bib-0009] 9. Manoussakis MN, Boiu S, Korkolopoulou P et al Rates of infiltration by macrophages and dendritic cells and expression of interleukin‐18 and interleukin‐12 in the chronic inflammatory lesions of Sjogren's syndrome: correlation with certain features of immune hyperactivity and factors associated with high risk of lymphoma development. Arthritis Rheum 2007; 56:3977–88. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0010] 10. Colonna M, Trinchieri G, Liu YJ. Plasmacytoid dendritic cells in immunity. Nat Immunol 2004; 5:1219–26. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0011] 11. Gilliet M, Cao W, Liu YJ. Plasmacytoid dendritic cells: sensing nucleic acids in viral infection and autoimmune diseases. Nat Rev Immunol 2008; 8:594–606. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0012] 12. Swiecki M, Colonna M. Unraveling the functions of plasmacytoid dendritic cells during viral infections, autoimmunity, and tolerance. Immunol Rev 2010; 234:142–62. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cei13077-bib-0013] 13. Båve U, Nordmark G, Lövgren T et al Activation of the type I interferon system in primary Sjogren's syndrome: a possible etiopathogenic mechanism. Arthritis Rheum 2005; 52:1185–95. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0014] 14. Vakaloglou KM, Mavragani CP. Activation of the type I interferon pathway in primary Sjogren's syndrome: an update. Curr Opin Rheumatol 2011; 23:459–64. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0015] 15. Kong L, Ogawa N, Nakabayashi T et al Fas and Fas ligand expression in the salivary glands of patients with primary Sjogren's syndrome. Arthritis Rheum 1997; 40:87–97. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0016] 16. Manganelli P, Fietta P. Apoptosis and Sjogren syndrome. Semin Arthritis Rheum 2003; 33:49–65. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0017] 17. McArthur C, Wang Y, Veno P, Zhang J, Fiorella R. Intracellular trafficking and surface expression of SS‐A (Ro), SS‐B (La), poly(ADP‐ribose) polymerase and alpha‐fodrin autoantigens during apoptosis in human salivary gland cells induced by tumour necrosis factor‐alpha. Arch Oral Biol 2002; 47:443–8. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0018] 18. Ohlsson M, Jonsson R, Brokstad KA. Subcellular redistribution and surface exposure of the Ro52, Ro60 and La48 autoantigens during apoptosis in human ductal epithelial cells: a possible mechanism in the pathogenesis of Sjogren's syndrome. Scand J Immunol 2002; 56:456–69. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0019] 19. Beyer C, Pisetsky DS. The role of microparticles in the pathogenesis of rheumatic diseases. Nat Rev Rheumatol 2010; 6:21–9. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0020] 20. Ishimaru N, Saegusa K, Yanagi K, Haneji N, Saito I, Hayashi Y. Estrogen deficiency accelerates autoimmune exocrinopathy in murine Sjogren's syndrome through Fas‐mediated apoptosis. Am J Pathol 1999; 155:173–81. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cei13077-bib-0021] 21. Ishimaru N, Arakaki R, Watanabe M, Kobayashi M, Miyazaki K, Hayashi Y. Development of autoimmune exocrinopathy resembling Sjogren's syndrome in estrogen‐deficient mice of healthy background. Am J Pathol 2003; 163:1481–90. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cei13077-bib-0022] 22. Konttinen YT, Fuellen G, Bing Y et al Sex steroids in Sjogren's syndrome. J Autoimmun 2012; 39:49–56. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0023] 23. Shirasuna K, Sato M, Miyazaki T. A neoplastic epithelial duct cell line established from an irradiated human salivary gland. Cancer 1981; 48:745–52. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0024] 24. Wang Y, Shnyra A, Africa C, Warholic C, McArthur C. Activation of the extrinsic apoptotic pathway by TNF‐alpha in human salivary gland (HSG) cells in vitro suggests a role for the TNF receptor (TNF‐R) and intercellular adhesion molecule‐1 (ICAM‐1) in Sjogren's syndrome‐associated autoimmune sialadenitis. Arch Oral Biol 2009; 54:986–96. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0025] 25. Chaperot L, Blum A, Manches O et al Virus or TLR agonists induce TRAIL‐mediated cytotoxic activity of plasmacytoid dendritic cells. J Immunol 2006; 176:248–55. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0026] 26. Konttinen YT, Platts LA, Tuominen S et al Role of nitric oxide in Sjogren's syndrome. Arthritis Rheum 1997; 40:875–83.] [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0027] 27. Virkki LM, Porola P, Forsblad‐d'Elia H, Valtysdottir S, Solovieva SA, Konttinen YT. Dehydroepiandrosterone (DHEA) substitution treatment for severe fatigue in DHEA‐deficient patients with primary Sjogren's syndrome. Arthritis Care Res (Hoboken) 2010; 62:118–24. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0028] 28. Klein SL, Flanagan KL. Sex differences in immune responses. Nat Rev Immunol 2016; 16:626–38. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0029] 29. Latz E, Schoenemeyer A, Visintin A et al TLR9 signals after translocating from the ER to CpG DNA in the lysosome. Nat Immunol 2004; 5:190–8. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0030] 30. Guiducci C, Ott G, Chan JH et al Properties regulating the nature of the plasmacytoid dendritic cell response to Toll‐like receptor 9 activation. J Exp Med 2006; 203:1999–2008. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cei13077-bib-0031] 31. Jaehn PS, Zaenker KS, Schmitz J, Dzionek A. Functional dichotomy of plasmacytoid dendritic cells: antigen‐specific activation of T cells versus production of type I interferon. Eur J Immunol 2008; 38:1822–32. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0032] 32. Cella M, Facchetti F, Lanzavecchia A, Colonna M. Plasmacytoid dendritic cells activated by influenza virus and CD40L drive a potent TH1 polarization. Nat Immunol 2000; 1:305–10. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0033] 33. Vogelsang P, Brun JG, Oijordsbakken G, Skarstein K, Jonsson R, Appel S. Levels of plasmacytoid dendritic cells and type‐2 myeloid dendritic cells are reduced in peripheral blood of patients with primary Sjogren's syndrome. Ann Rheum Dis 2010; 69:1235–8. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0034] 34. Szodoray P, Alex P, Brun JG, Centola M, Jonsson R. Circulating cytokines in primary Sjogren's syndrome determined by a multiplex cytokine array system. Scand J Immunol 2004; 59:592–9. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0035] 35. Kang EH, Lee YJ, Hyon JY, Yun PY, Song YW. Salivary cytokine profiles in primary Sjogren's syndrome differ from those in non‐Sjogren sicca in terms of TNF‐alpha levels and Th‐1/Th‐2 ratios. Clin Exp Rheumatol 2011; 29:970–6. [PubMed] [Google Scholar]

[cei13077-bib-0036] 36. Theander E, Jonsson R, Sjöström B, Brokstad K, Olsson P, Henriksson G. Prediction of Sjögren's syndrome years before diagnosis and identification of patients with early onset and severe disease course by autoantibody profiling. Arthritis Rheumatol 2015; 67:2427–36. [DOI] [PubMed] [Google Scholar]

[cei13077-bib-0037] 37. Sisto M, Lisi S, Lofrumento D, D'Amore M, Scagliusi P, Mitolo V. Autoantibodies from Sjögren's syndrome trigger apoptosis in salivary gland cell line. Ann NY Acad Sci 2007; 1108:418–25. [DOI] [PubMed] [Google Scholar]

PERMALINK

Activation of plasmacytoid dendritic cells by apoptotic particles – mechanism for the loss of immunological tolerance in Sjögren's syndrome

M Ainola

P Porola

Y Takakubo

B Przybyla

V P Kouri

T A Tolvanen

A Hänninen

D C Nordström