Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2018 Feb 12;8:2789. doi: 10.1038/s41598-018-21268-2

Comparative transcriptomics provides novel insights into the mechanisms of selenium tolerance in the hyperaccumulator plant Cardamine hupingshanensis

Yifeng Zhou 1,2,3, Qiaoyu Tang 2, Meiru Wu 2, Di Mou 2, Hui Liu 3, Shouchuang Wang 1, Chi Zhang 3, Li Ding 3, Jie Luo 1,✉
PMCID: PMC5809607  PMID: 29434336

Abstract

Selenium (Se) is an essential mineral element for animals and humans. Cardamine hupingshanensis (Brassicaceae), found in the Wuling mountain area of China, has been identified as a novel Se hyperaccumulator plant. However, the mechanism for selenium tolerance in Cardamine plants remains unknown. In this study, two cDNA libraries were constructed from seedlings of C. hupingshanensis treated with selenite. Approximately 100 million clean sequencing reads were de novo assembled into 48,989 unigenes, of which 39,579 and 33,510 were expressed in the roots and leaves, respectively. Biological pathways and candidate genes involved in selenium tolerance mechanisms were identified. Differential expression analysis identified 25 genes located in four pathways that were significantly responsive to selenite in C. hupingshanensis seedlings. The results of RNA sequencing (RNA-Seq) and quantitative real-time PCR (RT-qPCR) confirmed that storage function, oxidation, transamination and selenation play very important roles in the selenium tolerance in C. hupingshanensis. Furthermore, a different degradation pathway synthesizing malformed or deformed selenoproteins increased selenium tolerance at different selenite concentrations. This study provides novel insights into the mechanisms of selenium tolerance in a hyperaccumulator plant, and should serve as a rich gene resource for C. hupingshanensis.

Introduction

Selenium (Se) is an essential trace element for animals and humans that can be acquired from plant accumulators growing in seleniferous soil. According to tolerance and accumulation quantities of Se, plants can be categorized into three groups: <100 mg Se kg−1, 100–1000 mg Se kg−1 and 1000–15000 mg Se kg−1. Plants which can tolerate or accumulate Se at a concentration of 1000–15000 mg Se kg−1 are called Se hyperaccumulators1. Most species known to hyperaccumulate Se belong to the Fabaceae family. The ability of hyperaccumulation of Se in plants has evolved several times within the Asteraceae, Brassicaceae and Fabaceae1. Astragalus bisulcatus, Stanleya pinnata and Symphyotrichum ericoides are the most widely studied Se hyperaccumulators2–7.

Cardamine hupingshanensis is a novel hyperaccumulator plant found in the Wuling mountain area. Bai et al.8 found that C. hupingshanensis is primarily distributed in Hunan province in China, at 800–1400 m. However, we found it grows where there is a cloudy slope or valley with coal gangue and running water in the city of Enshi as well as in the counties of Xuan’en, Changyang and Wufeng in Hubei province at 800–1900 m. Yuan et al. (2013) and Shao et al. (2014) measured concentrations of total Se by hydride generation-atomic fluorescence spectrometry (HG-AFS) and HPLC-ICP-MS, respectively. These studies showed that C. hupingshanensis could accumulate Se in excess of 1400 mg Se kg−1 of dry matter in all tissues of seedlings, with most not exceeding 4000 mg Se kg−1 of dry matter in roots9,10.

Selenium can be taken up, transported and metabolized by sulfur (S) assimilation pathways because Se is chemically similar to S in plants1,11,12. Therefore, inorganic selenium can be assimilated into selenocysteine and selenomethionine, and incorporated into proteins. Several studies have showed that the misincorporation of selenocysteine seems to be the main reason for selenium toxicity4,11,13,14. The mechanisms of Se hyperaccumulation and tolerance are based on the common sulfur metabolic pathway but are further focused on special metabolic processes, such as methylation, in Astragalus bisulcatus and Stanleya pinnata1–3,15. The details are described in Fig. 1. The first step is that selenate actived by adenosine-5′-phosphoselenate synthetase (APS), and then the actived selenate on adenosine-5′-phosphoselenate (APSe) reduced by APSe reductase (APR) and converted to selenied. The next step is synthesis of L-Selenocysteine (SeCys) in which serine O-acetyltransferase (cysE) and cysteine synthase A (cysK) catalyzed the integration of selenide. Additionally, 3′-phosphoadenosine 5′-phosphosulfate synthase (PAPSS) leads a branch which formed selenate donor, 3′-phosphoadenosine 5′-phosphoselenate (PAPSe), it can be used to selenation for biomolecules. When selenate and selenite are reduced to SeCys, there are three steps that will result in non-specific incorporation of Se into proteins: first, the selenocysteine lyase (SL) and NifS-like enzymes (CpNifS) specifically break SeCys; second, SeCys methylation mediated by methyltrans- ferases (SMTs) is another important approach for seleniun detoxification and can increase the concentration of internal Se; third, cystathionine-γ-synthase (CγS) converts methylated SeCys to volatile DMSe16. The other researchers also detected appreciable concentrations of seleno-glucosinolates and their Se aglycons and selenosugars, possible chemical components of cell wall origin, in selenized plants1,17–21.

Figure 1.

Figure 1

Schematic overview of Se metabolism in plants. Enzyme and metabolites names are abbreviated as follows: APS, Adenosine-5′-phosphsulfate synthetase; APR, adenylylsulfate reductase; PAPSS, 3′-phosphoadenosine 5′-phosphosulfate synthase; cysE, serine O-acetyltransferase; cysK, cysteine synthase A; metB, cystathionine gamma-synthase; metC, cystathionine beta-lyase; metE, 5-methyltetrahydropteroyl- triglutamate-homocysteine methyltransferase; SL, selenocysteine lyase; CpNifS, chloroplastic NifS-like cysteine desulfurase; APSe, Adenosine-5′-phosphoselenate; PAPSe, 3′-Phosphoadenosine 5′-phosphoselenate; SeCys, L-Selenocysteine; SeMet, L-Selenomethionine; Methyl-SeMet,Se-Methylselenomethionine; DMSe, Dimethyl selenide; DMDSe, dimethyl diselenide; SeGSH,selenium-dependent glutathione.

Despite of the recognized superiority of selenium tolerance in C. hupingshanensis, the mechanisms underlying selenium tolerance remain unclear. Here, we performed a de novo transcriptome assembly in C. hupingshanensis and conducted a comparative transcriptome analysis to explore the putative mechanisms. Our study should be a useful reference for studying selenium tolerance in plants.

Results

Transcriptome characteristics in C. hupingshanensis

RNA samples from leaves and roots of C. hupingshanensis were prepared for library construction and subsequently sequenced on the Illumina HiSeq. 2500 platform. We obtained a total of 54,765,658 and 50,352,860 raw paired-end reads in leaves and roots, respectively. All sequencing data were deposited in the NCBI database and can be accessed with the Sequence Read Archive (SRA) number of SRP097726. After quality analysis and data filtering, 52,019,342 and 48,078,676 clean reads were retained with Q20 values of 99.0% and 98.9% and GC contents of 45.3% and 47.3% in the leaves and roots, respectively. We performed a de novo transcript assembly using these paired-end data to obtain transcript sequences. A total of 78,471 transcripts (average GC content of 41.18%), including 48,989 unigenes, were assembled with a total length of 86,620,844 bp (average transcript length of 1,104 bp). The size and copy distribution of the transcripts are displayed in Fig. 2a and b. The transcript abundance analyzed by bowtie (version 2.23) and RSEM (version 1.2.15) showed that 39,579 and 33,510 transcripts were expressed in the roots and leaves, respectively (displayed in Fig. 2c and d). The function of each unigene set in C. hupingshanensis was then annotated by Trinotate (version r20131110) based on homologies to putative or known sequences available in public databases (Table 1). In addition, a gene ontology (GO) analysis, which is a major bioinformatic approach utilizing to represent properties of gene and gene products across all species, was then carried out on the putative proteins. All unigenes were annotated using three ontologies, including biological process (BP), molecular function (MF) and cell component (CC) (Fig. 3). There was a total of 51 different sublevels narrowed down to form the three ontologies. According to the explanations in the non-redundant protein (NR) and the Pfam databases, 48,989 unigenes properly fit into one or more ontologies.

Figure 2.

Figure 2

Transcriptome characteristics in C. hupingshanensis. The length distribution (A) and copies (B) distribution of transcripts of C. Hupingshanensis. The abundance of transcripts in roots (C) and leaves (D) of C. Hupingshanensis.

Table 1.

Annotation results of C. hupingshanensis unigenes according to different databases.

Item Counts Percentage
All_transcripts 78,471 100.0%
Annotated_transcripts 58,470 74.5%
Top_BLASTX_hit 43,240 55.1%
Top_BLASTP_hit 38,386 48.9%
Pfam 37,041 47.2%
RNAMMER 7 0.0%
SignalP 3,650 4.7%
TmHMM 11,624 14.8%
eggnog 22,074 28.1%
gene_ontology 36,936 47.1%

Figure 3.

Figure 3

GO functional classification of C. hupingshanensis unigenes. Gene Ontology (GO) terms are summarized in three main categories of biological process, molecular function and cellular component.

There were 23 BP subcategories with 40,081 unigenes, 13 CC subcategories with 36,783 unigenes and 15 MF subcategories with 20,031 unigenes. Consistent with findings in other plants, the metabolic process, cellular process and single cell process ontologies in BP were the top three gene ontology terms, with 9,167, 8,555 and 5,581 unigenes, respectively22,23. Cell, cell part and organelle terms in CC were the top three classes with 10,818, 10,818 and 7,638 unigenes, respectively. Catalytic activity, nucleic acid binding and transcription factor activity in MF were the top three GO terms with 9,009, 7,543 and 1,313 unigenes, respectively. The COG function classification of the C. hupingshanensis unigenes is displayed in Fig. 4. Overall, 14,417 of 48,989 unigenes matched to the COG database were clustered into 24 functional clusters. According to the number of genes, the most significant cluster was the general function prediction only cluster (2,463, 17.08%), followed by the nucleotide transporter and metabolism (1,187, 8.23%); transcription (1,162, 8.06%); translation, ribosomal structure and biogenesis (1,125, 7.80%); and replication, recombination and repair clusters (1,035, 7.18%).

Figure 4.

Figure 4

Functional classification of C. hupingshanensis unigenes according to COG database.

To understand the functions and products of unigenes in putative metabolic pathways, the Kyoto Encyclopedia of Genes and Genomes (KEGG) was used to systematically analyze all unigenes in C. hupingshanensis (Fig. 5). A total of 5,196 unigenes obtained in this study were classified into five branches: cellular processes, environmental information processing, genetic information processing, metabolism, and organismal systems. More than half of those aligned with KEGG transcripts were classified into metabolism (59.37%), and 22.19% were classified into environmental information processing. The other highly represented pathways included the global and overview map (1,180, 22.71%), translation (546, 8.78%), carbohydrate metabolism (421, 8.10%), environmental adaptation (371, 7.14%), and folding, sorting, and degradation (354, 6.81%) pathways.

Figure 5.

Figure 5

KEGG pathway mapping for C. hupingshanensis.

General DEGs at all selenium concentrations

To understand the mechanisms of selenium tolerance in the hyperaccumulator plant C. hupingshanensis, another eighteen libraries (one sample including 3 biological replicates, nine libraries for roots and nine libraries for leaves) of seedlings were constructed to identify differentially expressed genes (DEGs) between the control and low Se treatment (100 μg Se/L, slightly higher than the concentration of Se in the water of the high-Se area, treated for 24 hours) and between the control and high Se treatment (80,000 μg Se/L, a stress concentration, treated 24 hours). Using a probability value of more than 0.8 and a minimal FPKM value of 3 (FPKM values used to define up- and down-regulated genes between treatment and control), the overlapping parts and exclusive sections of 670 unigenes from the four comparative groups are shown in Fig. 6. There were 50, 181, 95, and 128 unigenes annotated exclusively in these four groups. There were 4 unigenes that aggregated into a collection from the four groups (Supplementary Table S1). There were 43 and 50 unigenes transcribed in both the roots and leaves at two selenium concentrations, respectively. The roots and leaves shared 9 and 13 unigenes at low and high selenium concentrations, respectively.

Figure 6.

Figure 6

The significantly DEGs responsive to both two Se treated concentration in seedling of C. hupingshanensis. The significantly DEGs in roots of seedling between 100 μg Se/L (A) and 80,000 μg Se/L (B) treated concentration and control. The significantly DEGs in leaves of seedlingbetween 100 μg Se/L (C) and 80,000 μg Se/L (D) treated concentration and control.

Using a probability value of more than 0.8 and a minimal FPKM value of 10 (FPKM values used to define up- and down-regulated genes between treatment and control), 31 and 64 genes were associated with Se response in the root tissue, and 30 (23 genes up-regulated and 7 genes down-regulated) and 103 (42 genes up and 61 genes down) genes were associated with Se response in leaf tissue of seedlings treated with low and high concentrations of Se, respectively. At both concentrations of Se treatment, 6 annotated genes were up-regulated and 1 was down-regulated in root tissue, and 8 genes (including 3 un-annotated genes) were up-regulated and 6 (including 1 un-annotated gene) were down-regulated in the leaf tissue (Table 2).

Table 2.

The DEGs responsive to both two Se treated concentration. L: low Se treatment concentration, H: high Se treatment concentration.

No. GeneID log2Ratio (L/H) up/down Tissue KEGG/Nr/Swiss-Prot annotation
1 c25587_g1_i1 3.67/3.37 up Root sulfite oxidase
2 c8451_g1_i1 4.61/3.26 up Root LOB domain-containing protein 16
3 c23603_g1_i2 4.02/71.02 up Root aspartate aminotransferase, chloroplastic
4 c4063_g1_i1 4.76/5.02 up Root thioesterase family protein [Arabidopsis thaliana]
5 c23549_g1_i2 7.77/6.10 up Root pyridoxine 4-dehydrogenase
6 c22557_g2_i2 3.64/3.39 up Root ATP-binding cassette, subfamily B (MDR/TAP), member 1
7 c16776_g1_i1 2.17/2.25 up Leave glutathione S-transferase 12
8 c15496_g1_i1 3.66/3.83 up Leave ATGOLS3
9 c24366_g2_i1 4.94/7.17 up Leave aryl sulfotransferase
10 c19266_g1_i9 6.30/7.70 up Leave cold-inducible RNA-binding protein
11 c26649_g1_i3 5.26/5.19 up Leave ATP-binding cassette, subfamily C (CFTR/MRP), member 2
12 c23568_g2_i1 4.14/4.46 up Leave regulation of gene expression
13 c22186_g1_i5 11.68/13.03 up Leave Dormancy/auxin associated protein
14 c24788_g1_i2 5.23/4.70 up Leave none
15 c15033_g1_i1 2.11/2.321 up Leave glutathione S-transferase tau 4 (GST-u4)
16 c36512_g1_i1 −7.57/−10.30 down Root defensin-like protein 205 [Arabidopsis thaliana]
17 c33674_g1_i1 −3.31/−4.63 down Leave none
18 c9285_g2_i1 −4.07/−5.72 down Leave none
19 c19001_g1_i2 −3.57/−3.70 down Leave xyloglucan: xyloglucosyl transferase
20 c10770_g1_i1 −10.81/−10.81 down Leave 5′-AMP-activated protein kinase, regulatory beta subunit
21 c15335_g1_i2 −10.57/−10.57 down Leave none
22 c26522_g1_i1 −10.37/−10.36 down Leave tubulin beta
23 c22186_g1_i6 −10.17/−10.17 down Leave expressed protein
24 c10770_g2_i1 −9.99/−9.99 down Leave 2,4-dihydroxy-1,4-benzoxazin-3-one-glucoside dioxygenase

In this study, the expression of sulfite oxidase (SOX) gene in the root was up-regulated when selenite was added to the culture solution of the C. hupingshanensis seedlings (Table 2 and Fig. 7A), suggesting that selenite may be converted to selenate first and then the selenate continued through metabolism.

Figure 7.

Figure 7

RT-qPCR analysis of the genes related to selenium tolerance mechan- isms in hyperaccumulator plant C. hupingshanensis seedling. (A,C,E and G) Descripted changes of the genes in root; (B,D,F and H) descripted changes of the genes in leaves.

Vacuole is of great importance because of its storage function, which was demonstrated by the up-regulation of genes in metabolic and transport pathways. Based on the data from RNA-Seq and RT-qPCR (Table 2, Fig. 7A and B), the changes in genes of the glutathione S-transferase family and the C subfamily of the ATP-binding cassette transporters (ABCC) provided direct evidence. The glutathione S-transferase family gene GST-u4 in leaves, which promotes glutathione-chelated selenate to form phytochelatins (PCs)24, was up-regulated. The expression of ABCC2 was significantly up-regulated in leaves of C. hupingshanensis seedlings when the seedlings were treated with selenite. At the same time, there were four up-regulated genes associated with metal ion binding.

The results of RNA-Seq and RT-qPCR (Table 3, Fig. 7C) showed that the oxidation and transamination of SeCys might be two important processes for Se detoxification in the roots, but the results of RT-qPCR (Fig. 7D) suggested that conversion of SeCys to SeMet was also an important process for Se detoxification in the leaves. The transamination of SeCys or its oxides, such as L-cysteate and L-cysteine-sulfinate, has not been studied extensively in plants. The aspartate aminotransferase (chloroplastic, Aat), a pyridoxal phosphate dependent amino acid aminotransferase, which also located in cysteine and methionine metabolism pathway, could catalyze SeCys, L-cysteate and L-cystiene-sulfinate deaminize25–27. It was found that the expression of Aat and pyridoxine 4-dehydrogenase (PLR1) were up-regulated in the roots. Cystathionine gamma-synthase (CγS), cystathionine beta-lyase (CBL) and 5-methyltetrahydropteroyl-triglutamate-homocysteine methyltransferase (MET), which are three key enzymes in the methionine biosynthesis pathway, were found to be up-regulated by RT-qPCR at all concentrations of selenium treatment in leaves (Fig. 7D).

Table 3.

The significantly change transcripts treated by low selenium concentration in C. hupingshanensis seedling.

No. Gene ID log2 Ratio Probability up/down Tissue KEGG/Nr/Swiss-Prot annotation
1 c44959_g1_i1 3.35 0.801 up Root VQ motif-containing protein
2 c9362_g1_i1 4.87 0.807 up Root E3 ubiquitin-protein ligase RNF13
3 c4774_g1_i1 5.55 0.830 up Root E3 ubiquitin-protein ligase MUL1
4 c41336_g1_i1 10.48 0.952 up Root E3 ubiquitin-protein ligase MUL1
5 c19839_g2_i3 9.98 0.931 up Root Cysteine protease RD19A
6 c8804_g1_i1 5.01 0.828 up Root solute carrier family 25, member 44
7 c12744_g2_i1 4.63 0.820 up Root expressed protein
8 c24350_g2_i4 4.54 0.814 up Root phosphoenolpyruvate carboxykinase (ATP)
9 c21128_g2_i3 9.50 0.904 up Root putative S locus-linked protein
10 c22829_g1_i1 3.56 0.805 up Leave beta-amylase
11 c17901_g1_i1 3.47 0.803 up Leave beta-glucosidase
12 c26996_g1_i2 3.62 0.801 up Leave GIGANTEA
13 c25286_g1_i2 3.68 0.801 up Leave pseudo-response regulator 5
14 c25286_g1_i1 4.70 0.802 up Leave pseudo-response regulator 5
15 c20629_g1_i2 10.33 0.958 up Leave two-component response regulator ARR-B family
16 c17041_g1_i3 10.10 0.948 up Leave saposin
17 c25623_g1_i2 7.54 0.917 up Leave ATP-dependent RNA helicase/ATP-dependent RNA helicase DDX5/DBP2
18 c22072_g1_i3 −4.98 0.811 down Root ribulose-bisphosphate carboxylase small chain
19 c18750_g1_i2 −10.20 0.942 down Root brassinosteroid insensitive 1-associated receptor kinase 1
20 c26559_g1_i3 −10.16 0.940 down Root time for coffee
21 c22072_g1_i2 −10.09 0.937 down Root ribulose-bisphosphate carboxylase small chain
22 c19954_g1_i4 −9.92 0.929 down Root endonuclease 2
23 c10770_g1_i1 −6.35 0.847 down Root 2,4-dihydroxy-1,4-benzoxazin-3-one-glucoside dioxygenase
24 c22144_g1_i3 −5.96 0.874 down Leave golgin subfamily A member 6-like protein 22
25 c18949_g1_i3 −9.97 0.943 down Leave EUTSA_v10006302mg

Selenation which is similar to sulfation in plants, is another important pathway for detoxification of selenium because it can reduce SeCys biosynthesis. The aryl sulfotransferase enzyme (SULT1A, EC 2.8.2.1) is a member of the sulfotransferase (SOT, EC 2.8.2.-) protein family. This enzyme can transfer a sulfate group from the donor 3′-phosphoadenosine 5′-phosphosulfate (PAPS) to phenolic sulfate esters to a phenolic acceptor substrate in the sulfur and glucosinolate metabolism pathway. According to the KEGG analysis, this enzyme plays a key role in the selenation pathway28. However, aryl sulfotransferase is present in animals and prokaryotes, while aryl sulfotransferase is found only in R. communis L.28–30. The expression of SULT1A increased 4.94 (100 μg Se/L)- and 7.17 (80,000 μg Se/L)-fold in the leaves (Table 2 and Fig. 7F). That is, the response of selenation is a common pathway in leaves of C. hupingshanensis when seedlings are treated with selenium. Therefore, we can conclude that selenation is the more common approach of tolerating selenium stress in leaves of C. hupingshanensis seedlings.

The other genes that significantly responded to Se are involved in multiple physiological processes. The gene for transcription factor LBD 16 of the LBD family, which plays crucial roles in diverse growth and development processes, including the establishment and maintenance of the developmental boundary of lateral organs31, was up-regulated in the roots, indicating that selenium could promote lateral root formation in plants. AtGoLS3 is a member of the galactinol synthase (GolS) family, which initiates the biosynthesis of raffinose oligosaccharides (RFO), may act as an osmoprotectant in drought stress tolerance through UDP-galactose32,33. According to results of RNA-Seq, a novel possibility is that AtGoLS3 is induced not only by cold stress but also by selenium stress. The cellular-localized cold-inducible RNA-binding protein, also called the glycine-rich RNA-binding protein, which appears to be involved in the adaptation of abiotic and biotic stress34, was another significantly up-regulated gene that strongly responded to selenium in the leaves. Another significantly up-regulated gene that responded to selenium was that coding for the dormancy/auxin-associated protein, which is involved in growth suppression in bud and hypocotyl tissues and whose expression increases in response to abiotic or biotic factors35. However, xyloglucan xyloglucosyl transferase, also called xyloglucan endo-transglycosylase (XET), which is involved in wall-loosening, wall-strengthening process, gravitropic responses and the incorporation of nascent xyloglucan into the wall during biosynthesis36, was significantly down-regulated at all concentrations of selenium. The down-regulated regulatory beta subunit was one of three subunits of 5′-AMP-activated protein kinase (AMPK), which plays a role in maintaining cellular energy homeostasis37. Selenium also affected the process of phagolysosome formation by down-regulation of tubulin beta units of the microtubule.

Special DEGs at low concentrations of Se treatment

The same criteria described above were used to analyze special DEGs in the seedlings of C. hupingshanensis treated with low Se concentrations (100 μg Se/L). There were 9 up-regulated genes and 5 down-regulated genes that were found to be specifically expressed in the roots, and 7 up-regulated genes and 2 down-regulated genes were found to be specifically expressed in the leaves. The low Se concentration treatment not only significantly increased the storage function of the vacuole as well as selenation and transamination but also invoked protein degradation and other physiological responses (Table 3 and Fig. 7G). E3 ubiquitin-protein ligase RNF13 and MUL1, which are two important members of the ubiquitin–proteasome pathway (UPP), were significantly up-regulated in the roots under low Se treatment. RING finger protein 13 (RNF13) is a member of the largest family of ubiquitin ligases in eukaryotes and is an ER/Golgi membrane-associated E3 ubiquitin ligase that has been identified as a novel RING-based ubiquitin ligase38,39. Mitochondrial E3 ubiquitin protein ligase 1 (MUL1), which is localized to the mitochondria, is a crucial moderator of retinoic acid-inducible-gene I (RIG-I) signaling40. Cysteine protease RD19A, which is an important enzyme of proteolysis involved in cellular protein catabolic processes and responses to osmotic and salt stress that is located mainly in the vacuole and lysosome41, was also up-regulated (Table 3 and Fig. 7G). The low concentration of Se treatment significantly affected carbohydrate metabolism by up-regulating phosphoenolpyruvate carboxykinase and the small chain of ribulose-bisphosphate carboxylase in the roots and beta-amylase and beta-glucosidase in the leaves. Some genes related to the circadian clock, such as GIGANTEA (GI)42,43 and pseudo-response regulator 5 (PRR5)44 as well as those of the two-component response regulator ARR-B family (PCL1)45,46, were up-regulated, which may suggest effects of selenium on the circadian clock in leaves of C. hupingshanensis. The two least up-regulated genes were saposin and ATP-dependent RNA helicase DDX5/DBP2, and DDX5/DBP2 act in the process of nonsense-mediated mRNA decay and ribosome biogenesis through rRNA. A few genes including brassinosteroid insensitive 1-associated receptor kinase 1, time for coffee, endonuclease 2 and ribulose-bisphosphate carboxylase small chain were inhibited by low Se treatment in the roots. Only golgin subfamily A member 6-like protein 22 and a putative transcription factor were down-regulated in the leaves.

Special DEGs at high concentrations of Se treatment

The same criteria described above were used to analyze special DEGs in C. hupingshanensis seedlings treated by a high concentration of Se (80,000 μg Se/L). Compared with the low Se concentration treatment, there were more genes with expression changes of various physiological processes and cellular functions: 23 genes were up-regulated and 31 genes were down-regulated specifically in the roots, and 22 genes were up-regulated and 12 genes were down-regulated specifically in the leaves (Table 4).

Table 4.

The significantly change transcripts treated by high selenium concentration in C. hupingshanensis seedling.

No. Gene ID log2 Ratio Probability up/down Tissue KEGG/Nr/Swiss-Prot annotation
1 c19857_g1_i1 2.82 0.801 up Root ubiquitin-conjugating enzyme E2 7
2 c24366_g2_i1 4.05 0.819 up Root aryl sulfotransferase
3 c14018_g1_i1 3.81 0.816 up Root defensin
4 c19092_g1_i3 3.22 0.808 up Root tetratricopeptide repeat domain-containing protein
5 c16436_g1_i1 3.21 0.808 up Root thioredoxin 1
6 c33369_g1_i1 5.11 0.802 up Root glutaredoxin C-10
7 c22655_g1_i7 2.93 0.801 up Root calmodulin-binding protein
8 c16335_g1_i2 3.31 0.807 up Root histone H2A
9 c28060_g1_i1 4.40 0.822 up Root protein SPT2
10 c23323_g1_i1 3.20 0.803 up Root phosphoribosylamine–glycine ligase
11 c20557_g2_i1 3.55 0.806 up Root BREVIPEDICELLUS
12 c20557_g1_i1 4.79 0.825 up Root BREVIPEDICELLUS
13 c20557_g1_i3 4.02 0.800 up Root BREVIPEDICELLUS
14 c25718_g1_i2 3.89 0.801 up Root CCR4-NOT transcription complex subunit 6
15 c44228_g1_i1 5.09 0.824 up Root zinc finger protein-like
16 c24721_g3_i5 4.07 0.810 up Root phytochrome-interacting factor 3
17 c21356_g1_i1 3.39 0.803 up Root auxin-responsive protein IAA
18 c34034_g1_i1 4.48 0.814 up Root gibberellin 2-oxidase
19 c13127_g1_i1 4.38 0.817 up Root peroxidase 43
20 c8022_g1_i1 3.85 0.804 up Root peroxidase 67
21 c18293_g1_i3 4.51 0.820 up Root cathepsin A (carboxypeptidase C)
22 c31295_g1_i1 5.80 0.871 up Root glycosyl hydrolase family 9 protein
23 c22386_g2_i1 5.32 0.830 up Root 3,4-dihydroxy 2-butanone 4-phosphate synthase/GTP cyclohydrolase II
24 c24121_g1_i5 10.32 0.954 up Root Cd2+/Zn2+-exporting ATPase
25 c13966_g1_i1 5.33 0.803 up Root esterase/lipase/thioesterase family protein
26 c16776_g1_i1 2.17 0.801 up Root glutathione S-transferase 12
27 c26122_g2_i1 3.94 0.811 up Leave ferritin heavy chain
28 c22426_g1_i1 3.81 0.806 up Leave ARALYDRAFT_483040
29 c23861_g1_i3 3.47 0.802 up Leave RAV-like factor
30 c15569_g2_i1 3.89 0.806 up Leave ATHB-12
31 c15569_g1_i2 5.90 0.846 up Leave ATHB-12
32 c24052_g1_i1 4.95 0.821 up Leave transcription factor TGA; vacuolar protein 8
33 c21583_g1_i2 5.92 0.843 up Leave ANAC019
34 c21583_g1_i9 5.60 0.864 up Leave ANAC019
35 c13823_g1_i1 4.30 0.811 up Leave NAC transcription factor RD26
36 c21583_g1_i4 4.42 0.801 up Leave NAC domain-containing protein 19
37 c10147_g1_i1 5.11 0.838 up Leave group I late embryogenesis abundant protein
38 c24183_g1_i2 3.68 0.801 up Leave CTP synthase (glutamine metabolic process)
39 c14600_g1_i2 4.41 0.805 up Leave CARUB_v10020817mg
40 c23954_g1_i6 5.17 0.826 up Leave 12-oxophytodienoic acid reductase 1
41 c21478_g1_i2 5.16 0.816 up Leave desulfoglucosinolate sulfotransferase A/B/C
42 c5110_g1_i1 6.12 0.852 up Leave calcium-binding protein CML
43 c14080_g1_i2 4.26 0.811 up Leave ARALYDRAFT_908317
44 c14080_g2_i2 5.62 0.847 up Leave EUTSA_v10010032mg
45 c17912_g1_i1 4.94 0.804 up Leave CARUB_v10010130mg
46 c14156_g1_i1 5.50 0.826 up Leave F21J9.24
47 c25018_g1_i1 5.36 0.847 up Leave BnaC08g17590D
48 c22144_g1_i6 10.23 0.949 up Leave golgin subfamily A member 6-like protein 22
49 c25889_g1_i1 10.24 0.949 up Leave V-type H+-transporting ATPase subunit I
50 c18601_g1_i3 4.70 0.812 up Leave syntaxin 7
51 c25633_g1_i5 5.48 0.812 up Leave protein transport protein SEC. 23
52 c1958_g1_i1 −3.05 0.806 down Root pathogenesis-related protein 1
53 c40248_g1_i1 −3.64 0.814 down Root cysteine-rich secretory proteins
54 c16712_g3_i1 −2.81 0.800 down Root aquaporin PIP
55 c19607_g2_i1 −3.28 0.809 down Root ferulate-5-hydroxylase
56 c22389_g1_i2 −2.95 0.801 down Root coniferyl-aldehyde dehydrogenase
57 c13360_g1_i2 −3.97 0.818 down Root extensin-2-like
58 c20331_g1_i1 −3.46 0.811 down Root —
59 c13360_g1_i3 −3.44 0.809 down Root —
60 c20331_g3_i1 −3.64 0.810 down Root —
61 c21893_g1_i1 −4.23 0.821 down Root cytochrome P450 71A12
62 c19961_g1_i1 −2.99 0.802 down Root Peroxidase 3
63 c36847_g1_i1 −3.73 0.807 down Root Peroxidase 56
64 c6356_g1_i1 −6.08 0.885 down Root Peroxidase 11a (BnaAnng21310D)
65 c24169_g1_i3 −3.18 0.805 down Root adenylyl-sulfate reductase (glutathione), APR1
66 c13529_g1_i1 −7.08 0.902 down Root protein RESPONSE TO LOW SULFUR 3
67 c24828_g3_i1 −4.96 0.840 down Root sulfate transporter 1.2
68 c24828_g4_i4 −5.31 0.855 down Root sulfate transporter 1.2(F28K19.22)
69 c26204_g1_i2 −3.83 0.812 down Root putative cation/hydrogen exchanger
70 c7675_g1_i1 −3.44 0.806 down Root myb proto-oncogene protein, plant
71 c16368_g1_i3 −10.31 0.953 down Root myb proto-oncogene protein, plant
72 c17444_g1_i1 −3.58 0.809 down Root chitinase
73 c11828_g2_i1 −3.64 0.807 down Root FAD-binding domain-containing protein
74 c9067_g1_i1 −3.78 0.805 down Root respiratory burst oxidase-B
75 c18905_g2_i1 −3.67 0.803 down Root serine/threonine-protein kinase PBS1
76 c19857_g1_i2 −5.39 0.847 down Root ubiquitin-conjugating enzyme E2 G1
77 c44867_g1_i1 −5.57 0.858 down Root disease resistance response/ dirigent - like protein
78 c22386_g2_i3 −6.86 0.918 down Root 3,4-dihydroxy 2-butanone 4-phosphate synthase/GTP cyclohydrolase II
79 c25447_g1_i5 −7.45 0.937 down Root cyclic nucleotide gated channel, other eukaryote
80 c18259_g2_i2 −4.97 0.807 down Root senescence-associated protein
81 c33681_g1_i1 −5.31 0.823 down Root cathepsin L
82 c19954_g1_i4 −9.92 0.938 down Root endonuclease 1
83 c27203_g3_i1 −6.31 0.814 down Root longifolia 1
84 c9050_g2_i1 −3.39 0.803 down Leave Cell wall-associated hydrolase
85 c9050_g3_i1 −3.93 0.811 down Leave Mitochondrial protein
86 c10003_g1_i1 −3.38 0.803 down Leave Ribosomal protein S10
87 c8377_g2_i1 −5.45 0.863 down Leave PSI P700 apoprotein A2
88 c8377_g1_i1 −5.21 0.849 down Leave photosystem I P700 apoprotein A1
89 c36534_g1_i1 −3.61 0.805 down Leave ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit
90 c36532_g1_i1 −3.64 0.803 down Leave Photosystem II CP43 chlorophyll apoprotein
91 c32267_g1_i1 −5.30 0.854 down Leave senescence-associated protein
92 c17835_g6_i1 −5.35 0.855 down Leave cytochrome P450 like_TBP
93 c22145_g1_i2 −4.92 0.821 down Leave apocytochrome b
94 c26528_g1_i2 −10.62 0.962 down Leave ARALYDRAFT_355122
95 c26586_g1_i3 −10.08 0.943 down Leave glycosyl hydrolase family 38 protein

The plant C. hupingshanensis, a novel selenium hyperaccumulator, had distinctive reactions to high concentrations of selenium (Table 4 and Fig. 7D). The first reaction was repression of selenium uptake through down-regulating the expression of sulfate transporter 1.2 (Sultr1;2) which was a key protein involved in sulfate and selenate transport and expressed mainly in the root cortex, the root tip and lateral roots47,48. The second change was repressed reduction of selenate in roots by down-regulating the expression of adenylyl-sulfate reductase (glutathione, APR1), a critical enzyme catalyzing reduction of adenosine 5′ phoshposulfate (APS) or phoshposelenate (APSe), in which C and N terminal domains had a GRX and TRX like function respectively49. The last distinctive change comes from the up-regulated expression of aryl sulfotransferase (SULT1A), which is closely connected with sulfation or selenation. These results indicated that the flux of selenate on APS was converted to PAPSe and used for selenation, but was not reduced to selenide or combined into SeCys and selenoprotien in the root when C. hupingshanensis was treated with high concentrations of selenium50.

The visible effects of redox homeostasis when treated with high concentrations of selenium were through the regulation of thioredoxin (TRX) and glutaredoxin (GRX) which were involved in detoxifying reactive oxygen species (ROS) during stress responses and determination protein thiol/disulfide status, and played key roles in the maintenance of cellular redox homeostasis through the sensing and reducing equivalents to a large number of target proteins, such as reductases, peroxidases, transcription factors, metabolic enzymes of glycolysis, and photosynthesis or through structural modifications of target proteins51,52. The genes of thioredoxin 1 (Trx 1) and glutaredoxin C-10 (GrxC10) from the roots were up-regulated (Table 4 and Fig. 7D) when the seedlings of C. hupingshanensis were treated by high concentrations of selenite. Simultaneously, peroxidase 43 and 67 which were the important target proteins of TRX, and GRX were up-regulated in the roots53.

Regarding photosynthesis, high selenium concentration suppressed the expression of genes involved in light and dark reaction. CP43, one of the components of the core complex of photosystem II (PSII) which binds chlorophyll and helps catalyze the primary light-induced photochemical processes of PSII54, was down-regulated when treated with high concentrations of selenium in the leaves. PsaA and PsaB, which bind P700 and are the primary electron donor of photosystem I (PSI), as well as the electron acceptors A0, A1 and FX55, were also down-regulated when treated with high concentrations of selenium in the leaves. So, not only the light harvesting process located in PSII but also the transferring of electron process located in PSI of the light reaction of photosynthesis were suppressed when treated with high concentrations of selenium. On the other hand, Rubisco is the key enzyme complex in dark reaction and catalyzes two reactions: the carboxylation of D-ribulose 1,5-bisphosphate, the primary event in carbon dioxide fixation, as well as the oxidative fragmentation of the pentose substrate, but the L subunit of Rubisco was down-regulated when treated with high concentrations of selenium in the leaves. The carbon fixation in dark reaction was also inhibited by high concentrations of selenium through down-regulating the gene expression of the L subunit of Rubisco. In addition, phytochrome-interacting factor 3 (PIF3)56–58, which is a basic helix-loop-helix (bHLH) transcription factor closely related to the switch between skotomorphogenesis and photomorphogenesis, was up-regulated in the roots when the seedlings were exposed to light, but the function of PIF3 decided by its state phosphorylation, is still unclear.

The root growth and development of C. hupingshanensis seedlings were affected predominantly by high concentrations of selenium. The first change comes from the genes involved in lignin biosynthesis. Five members of class III perooxidases were changed, which play critical roles in lignin biosynthesis, reduction of hydrogen peroxide, auxin and secondary metabolism53. The genes of peroxidase 43 and 67 were up-regulated, and peroxidase 3, 11a and 56 were down-regulated in the roots. At the same time, the genes encoding ferulate-5-hydroxylase and coniferyl-aldehyde dehydrogenase in the phenylpropanoid biosynthesis pathway associated with the production of precursors for lignin biosynthesis were down-regulated59,60. Additionally, the down-regulation of respiratory burst oxidase homologs (rbohs) decreases the production of superoxide61 in the roots. The second change comes from the genes involved in the process of the development of roots. Gibberellin 2-oxidase (GA2ox), which plays very important roles in plant growth and development and can alter expression of lignin biosynthesis-related genes to reduce biomass accumulation and lignification62, was up-regulated; it is also involved in resistance to high-salinity stress63. All the above changes may indicate that selenium can affect the rigidity and strength of roots. The up-regulation of transcription factor LBD 16, auxin-responsive protein IAA (AUX/IAA), and glycosyl hydrolase family 9 (Cel3) was associated with lateral root initiation and development64,65. The down-regulation of four genes including extensin-2-like and one of chitinases indicated that selenium could affect the growth and development of lateral roots significantly.

Another predominant character is that the degradation of protein occurred in the roots and leaves at the same time but in different tissues and subcellular organelles (Table 4 and Fig. 7G and H). The gene of ubiquitin-conjugating enzyme E2, another key member in the UPP, was also up-regulated in the roots. The gene of V-type H+-transporting ATPase subunit I (VHA-a2), which is located on mature phagosomes, was up-regulated in the leaves. There were more genes responding to the stress from selenium, such as drought tolerance- and pathogen resistance-related genes. These included defensin, pathogenesis-related protein 1, aquaporin PIP, ferritin heavy chain, ARALYDRAFT_483040 (defense response), ATHB-12, transcription factor TGA, ANAC019, RD26, group I late embryogenesis abundant protein (LEA), and protein transport protein SEC. 23 as well as four metal binding proteins, of which only pathogenesis-related protein 1 and aquaporin PIP were down-regulated in the roots and the others were all up-regulated either in the roots or leaves. Surprisingly, the drought tolerance-related genes ATHB-1248,66, ANAC01967,68, RD2669 and group I LEA70 were significantly up-regulated in the leaves, and aquaporin PIP was down-regulated in the roots under the selenium stress. The process of new protein modification was accelerated by up-regulation of Sec. 23, which initiated the COP II coat complex assembly71. The pathogen resistance-related genes showed a puzzling change in expression: pathogenesis-related protein 1 was down-regulated in the roots, and transcription factor TGA, whose members interact with the key components (ankyrin repeat protein and non-expresser of pathogen-related (PR) (NPR1) genes) in the SA defense signaling pathway72, was up-regulated in the leaves.

Regarding the senescence-associated physiology, the RAV-like factor, which can inhibit the growth of plant leaf, root and stem73,74, was up-regulated, and the senescence-associated protein was down-regulated in the leaves.

The SPT2 chromatin protein which was up-regulated in the roots is an important histone chaperone and can facilitate ribosomal DNA transcription through chromatin remodeling75. Together with the up-regulation of histone H2A, these results suggest that selenium could function in the process of gene expression in high concentration of Se in the roots. The up-regulation of CCR4-NOT transcription complex subunit 6 also supported this speculation.

Discussion

Selenate is the initial compound of selenium metabolism

Selenium is chemically similar to sulfur and is assimilated by plants via the same metabolic pathways76,77. Most plants nonspecifically take up selenate from the environment by means of sulfate transporters and assimilate selenate into organic forms of Se via S metabolic pathways7. The conversion of selenate to selenite requires the continuous action of two enzymes (Fig. 1). ATP sulfurylase (APS) mediates the binding of selenate with ATP, forming adenosine phosphoselenate (APSe). This compound is then reduced to selenite through APS reductase (APR)16. However, we found that SOX was up-regulated when selenite was added to the culture solution of the C. hupingshanensis seedlings. Therefore, we can deduce that selenite might be converted to selenate first and then was incorporated into ATP by APS, reduced to selenite by APR, and reduced to selenide before finally being incorporated into SeCys in the root tissue of C. hupingshanensis seedlings (Fig. 8).

Figure 8.

Figure 8

Selenium tolerance mechanisms in hyperaccumulator plant C. hupingshanensis.

The storage function of the vacuole plays an important role in selenium tolerance

After APSe formed, the members of glutathione S-transferase family genes, GST u4 (in leaves) (Figs 8 and 9B,C) were up-regulated to transfer the selenate ion to GSH and to form glutathione-S conjugate (GS-X). ABCC2 (in leaves), belonged to the subfamily C (CFTR/MRP) of ATP-binding cassette superfamily, which proved to be the long-sought and major vacuolar plant PC transporters78, were up-regulated. Here, the expression of ABCC2 was significantly up-regulated in the leaves (5.26 folds at 100 μg Se/L and 5.19 folds as 80,000 μg Se/L) of C. hupingshanensis seedlings when treated with selenite. Additionally, four genes encoding metal ion binding proteins were up-regulated. Therefore, we deduced that partial selenate was first chelated by glutathione-derived peptides with glutathione sulfur transferase (GST) and was then transported into the vacuole by MRP2 of C. hupingshanensis to detoxify and sequester the heavy metal in the roots and leaves. All these results suggest that the storage of the vacuole is an important way to tolerate selenium in C. hupingshanensis seedlings.

Figure 9.

Figure 9

Expression levels of the candidate unigenes coding key enzyme involved in selenium tolerance mechanisms in hyperaccumulator seedling of C. hupingshanensis. The candidate unigenes from root (A) and leaf (B), respectively. Blue and red colors are used to represent low-to-high expression levels, and color scales correspond to the mean centered log2-transformed FPKM values.

Transamination is an important mechanism of selenium detoxification

The fate of SeCys enormously influences the capacity of selenium tolerance in plants. The misincorporation of SeCys was believed to be the main reason for selenium toxicity4,11,13,14. Therefore, the fate of SeCys will determine the toxicity. SeCys can be methylated by SeCys methyltransferase (SMT), or it can be converted into SeMet by CγS, oxidized by SL and specifically broken by CpNifS16. The process of SeCys conversion to SeMet still plays an important role, as demonstrated by the up-regulation of CγS, CBL and MET in the leaves. However, the transamination of SeCys or its oxides, such as L-cysteate and L-cysteine-sulfinate, has not been studied in plants. In this study, we found that the expression of Aat was up-regulated in the roots compared with the control. Furthermore, PLR1 was also up-regulated in the roots. Therefore, we can deduce that SeCys deamination by Aat is an important pathway for detoxification of selenium in the roots of C. hupingshanensis seedlings (Figs 8 and 9A).

Selenation is the more common mechanism for selenium detoxification

Although it is not the only route, selenation, which is similar to sulfation in plants, is another pathway for detoxification of selenium. APR is a key enzyme in both sulfate and selenate reduction49 which was down-regulated with 3.18-fold in the roots. Therefore, the new metabolic pathway to transfer selenate seemed to be more important. Two ways were found for selenate stress: (1) the selenate is chelated by GSH and then transported into the vacuole; (2) the APSe, 3′-phosphoadenosine 5′-phosphoselenate synthase (PAPSeS) and aryl sulfotransferase (SULT1A), which are present in animals and prokaryotes but were found only in Ricinus communis L.28,29, transfer selenate to a phenolic hydroxy group, forming selenocompound substrates28. When the concentration of selenium increased to 80,000 μg Se/L, a stress concentration, the gene of SULT1A, whose product is located in the sulfur and glucosinolates metabolism pathway, increased 4.05-fold in the roots (Table 4). This suggests that selenation also occurred, as selenium increased to a high concentration in the roots of C. hupingshanensis seedlings. The response of selenation to selenium is not the same in the leaves. Whether challenged with a low or high concentration of selenium, the expression of SULT1A increased 4.94 or 7.17-fold (Table 2). That is, the response of selenation was more common in leaves when the C. hupingshanensis seedlings were treated with selenium. Therefore, we can conclude that selenation is the more common method of selenium stress tolerance in C. hupingshanensis seedlings (Fig. 8).

Degradation of selenoproteins is important for selenium detoxification

Both of the Selenomethionine and selenocysteine are seleno-amino acids which can be misincorporated into proteins in plants. Cysteine plays an important role in maintaining the structure and function of proteins, including those involved in catalysis, redox regulation, formation of disulfide bridges and metal binding. The substitution of cysteine with selenocysteine in nonspecific selenoproteins could create either a diselenide bridge or a mixed selenide–sulfide bridge (or selenosulfide bridge) with different properties, and a deformed protein could be formed13. A non-specific selenocysteine incorporated into selenoproteins in other situations and non-specific accumulation of selenomethionine proteins are not considered to be as deleterious as the more reactive selenocysteine, and malformed proteins can be formed13. The formation of deformed or malformed selenoproteins induced by chaperone-mediated processes and the proteolysis of irreparable proteins through the lysosome or the ubiquitin–proteasome pathway (UPP) can also occur. The mechanisms of preventing the formation of selenoproteins are related to elevated selenium tolerance in plants79. The mechanisms of preventing the formation of selenoproteins are associated with increased selenium tolerance in plants4. In this study, the genes of E3 ubiquitin-protein ligase MUL1 and RNF13 (treated with 100 μg Se/L) as well as of ubiquitin- conjugating enzyme E2 7 (treated with 80,000 μg Se/L) were up-regulated with 4.87, 5.55 and 2.82-fold in the roots, respectively. These changes are similar to the observations in Chlamydomonas reinhardtii, Stanleya pinnata and rice4,79,80. However, the puzzling change was that the gene of the 26S proteasome regulatory subunit T5 (Rpt5), an important subunit for assembly of the 26S proteasome, was down-regulated with 9.70-fold in all tissues and at both selenium concentrations. On the other hand, regarding phagosome and phagolysosome, the gene of cysteine-type peptidase was up-regulated with 9.98 fold in the roots (treated with 100 μg Se/L), and the gene of VHA-a2 was up-regulated with 10.24 fold in the leaves (treated with 80,000 μg Se/L). All these results indicate that the degradation of selenoproteins plays an important role in selenium detoxification (Figs 8 and 9A,B).

Methods

Plant materials

The seeds of C. hupingshanensis were harvested from the Yutangba Se mining field, which is located on the Enshi area in western Hubei province, China. Plants were grown in a growth chamber with light illumination (ca. 1600 mol−2 ms−1) over a 16/8 day and night at 20 ± 2 °C. Hoagland solution was sprayed every two days. Five-month-old C. hupingshanensis seedlings were harvested. The roots were washed first with tap water and then with deionized water (≥18 MΩ, Millipore, BedfordTM, USA) to exclude contamination from the surface. The washed seedlings, which were cultured in 100 mL of Hoagland solution, were divided into three experimental groups based on the results of our previous studies: control, supplementation with 100 μg Se L−1 and supplementation with 80,000 μg Se L−1, using sodium selenite (analytical reagent, Sinopharm Chemical Reagent Co., Ltd, Shanghai, China). After 24 hours, the C. hupingshanensis seedlings were harvested.

RNA isolation, library preparation and sequencing

For the transcriptome sequencing, the roots and leaves were separated and analyzed independently. According to the manufacturer’s protocol, total RNA was extracted using a Qiagen total RNA isolation system (RNeasy Plant Mini Kit, 74904, Qiagen). The total RNA samples were treated by the following protocol: DNA degraded by DNase I; the oligo (dT) magnetic beads were used for mRNA enrichment; the mRNA was then fragmented into short fragments by mixing with the fragmentation buffer. Then, the cDNA was synthesized using PrimeScript™ Double Strand cDNA Synthesis Kit (Takara) according to the manufacturer’s protocol. The double-strand cDNA was purified with magnetic beads. And then 3′-end single nucleotide A (adenine) addition was performed. Finally, sequencing adaptors were ligated to the fragments. The fragments were enriched by PCR amplification. During the QC step, the Agilent 2100 Bioanalyzer and ABI StepOne Plus Real-Time PCR System were used to qualify and quantify the sample library. The primer information for the real-time quantitative PCR was shown in Table 5. Actin of C. Hupingshanensis (Chp Actin) served as internal controls to normalize the targets for quantification. The libraries were then sequenced on the Illumina HiSeqTM 2000 platform.

Table 5.

The information of primer for real-time quantitative PCR.

Gene name Abbreviation Primer
ATP-binding cassette, subfamily B (MDR/TAP), member 1 ABCC1 P1 CGACCCACTATGTCCACTGTG
P2 TGCCTTGTGTTTACGTCTGTTC
Adenylyl-sulfate reductase 1 APR1 P1 GCTCTTGAGAAATACGGAAACG
P2 ACGGCAACACTCTTGATGACC
Glutaredoxin C-10 GrxC10 P1 TGTTGGATGGACTCCGACG
P2 AAGACGATGCGAGGTTTACG
Thiol methyltransferase 2 SMT P1 AGTTCTGTCAATTTCACCTACCAC
P2 GGATAACGAACTTGCTCCAGATAC
Aryl sulfotransferase SUL1A P1 GGTTCCGGCATAAGTAGACAATC
P2 CTCGCCACCATACCTAAATCC
Sulfate transporter 2.1 Sultr 2.1 P1 TGGCTGCTTGACTGTCCTG
P2 GATTCGTTGTGGGAGAGGC
Sulfite oxidase SOX P1 GAAGAGGGACGGGAGTGATG
P2 CGATTTCTCCAGCGACGAC
Thioredoxin 1 Trx 1 P1 CACTGAGCATCATTGCGTTATC
P2 CGCCACTTCCTTGACTTCATC
Aspartate aminotransferase AAT P1 CAAAGTCTGTTGGTCGGGTG
P2 TGAAAGCCGCCAATCCC
Cystathionine gamma-synthase CγS P1 TAAATGTCGTGGAACAGCGG
P2 TCCTTACATAGCACCATCTTTCG
Cystathionine beta-lyase CBL P1 GCCACCATATACATCATCTCCAG
P2 GCACTCCACTTTACCAAACAGC
5-methyltetrahydropteroyl- triglutamate-homocysteine methyltransferase MET P1 TTGTGGTTGGCAGGATTGG
P2 TGGCGGGTCAGAAGGATG
Selenocysteine-lyase SL P1 TCTCTCAACTTGTCTATGTCTGGC
P2 TGCTCGTTTCATCAATGCTTC
ATP-binding cassette, subfamily C (CFTR/MRP), member 2 ABCC2 P1 GTCCCAGATTCAAAGATAAACCG
P2 GCAGGAGCAATAACAATAAGAGC
glutathione S-transferase 12 GST-12 P1 GAGTGTTTGGCGACAGTAGAAG
P2 GACGGTTGGTATGTAAGGTTTG
glutathione S-transferase tau 4 GST-u4 P1 CCCTTTCAGTCGTAGAGTGGAG
P2 ACATGGCTTTCTCGTAAGGATC
E3 ubiquitin-protein ligase E3 P1 AGAGAGTAAGAGACGGTGTAGGATG
P2 TCTAAGACGGTTGATACGACGAC
Cysteine protease RD19A P1 GGGAAATGAAGGTGAAGCAAG
P2 ACAAATCGGACAACTCCCATC
ubiquitin-conjugating enzyme E2 E2 P1 GAACTCGTCTCTCTTCTCTCGC
P2 GTCATTCCCGCTAAACTATCC
26 S proteasome regulatory subunit T5 RPT5 P1 CTAATGGCTCGTGCCTGTG
P2 TGTCTCCGCTTACTTCACTGTC
V-type H+-transporting ATPase subunit I VHAA2 P1 GGGAACAATGACCTGAACAAG
P2 GTGGCAGTAACTACACGAGACG
pyridoxine 4-dehydrogenase PLR1 P1 GCAGATGCTTCAGACAGACC
P2 GCTCTCAAGGATGGTGTAAGG
tubulin beta TUB P1 AAACCAATCCTCTTCCCACTC
P2 CCACTTCCCAGAACTTAGCAC
3′-phosphoadenosine 5′-phosphoselenate synthase PAPSeS P1 GGTATCTGGCATTGGTGGAG
P2 CCGGTTAGAGGGTTATTGTCG
adenosine phosphoelenate APSe P1 TGGTTTCGATATTCCCGTCTC
P2 ATCTTGCCTTGCGTCTTGTC

Transcriptome assembly and annotation

The raw data were obtained after deep transcriptome sequencing. After quality analysis using the fastqc program (version 0.10.1), the raw data were processed to clip sequencing adapters and filter low-quality reads using Trimmomatic software (version 0.30). The remaining clean reads were used to assemble transcripts using the Trinity program (http://trinityrnaseq.sourceforge.net/) embedded with three individual modules (Inchworm, Chrysalis and Butterfly) which were run consecutively. The parameters for Trinity included the following: –seq-Type fq, –min_contig_length 100, –min_glue 3, –group_pairs_distance 250, –path_reinforcement_distance 85 and –min_kmer_cov 3. The following parameters were also used in Trinity: min_glue = 1, V = 10, edge-thr = 0.05, min_kmer_cov = 2, path_reinforcement_distance = 150, and group_pairs_distance = 500. The assembled contigs were finally joined together to make scaffolds. The Gene Indices Clustering Tools (TGICL, version 2.1) program was used to form unigenes, and Phrap (http://www.phrap.org/) was used to assemble the scaffolds and cluster them.

To annotate these unigenes, all sequences were subjected to blastx alignment (e-value < 1e-5) with the NR (non-redundant protein sequence database, release 20130408), Swiss-Prot (release 2013_03), KEGG (Kyoto Encyclopedia of Genes and Genomes) and COG (Clusters of Orthologous Groups) databases. The results from these alignments were used to determine the direction of these sequences. Lastly, the sequences that were not aligned to any database were subjected to a ESTScan analysis. For function annotation, a local Blast was used to search against the NT (NCBI nucleotide database), NR, Swiss-Prot, KEGG and COG databases. Blast hits from the NR database was then used to determine gene ontology (GO) terms of unigenes. The Blast2GO (http://www.blast2go.com/b2ghome) program was run to obtain the GO terms.

Differential gene expression analysis

Expression profiling of unigenes was performed. The gene expression levels were quantified using the software package RNASeq by Expectation Maximization (RSEM). The fragments per kilobase per million reads (FPKM) method, which is able to eliminate the influence of different gene lengths and sequencing discrepancy on the calculation of gene expression, was used to estimate the expression level of each gene. Therefore, the gene expression levels normalized as FPKM values can be directly used to assess the differences in gene expression among samples. The FPKM value was calculated according to the length of each unigene and the number of reads mapped to the gene. Statistical analysis was performed to identify differentially expressed genes (DEGs). The false discovery rate (FDR) was calculated to adjust the p-value threshold in the expression analysis. If the FDR was small and the fold change was large, the difference in expression between the two samples was large. The criteria used to detect DEGs were FDR ≤ 0.001 and fold change (Se treated/not treated) ≥1 or ≤−1. In addition, the GO and KEGG pathway analyses were performed for the DEGs similar to the method described above.

Electronic supplementary material

Supplementary Information (180.5KB, doc)

Acknowledgements

This work was supported by the National Natural Science Foundation of China (31360498) to Qiaoyu Tang and Science and Technology Program of Enshi Autonomous Prefecture(D20160055) to Yifeng Zhou. The researches were mainly finished at the Key Laboratory of Biological Resources Protection and Utilization of Hubei Province.

Author Contributions

C.Z., L. Di. and J.L. designed the research. Q.T. and D.M. prepared the plant materials. Y.Z., Q.T., M.W., H.L. and S.W. isolated and sequenced RNA. Y.Z. and H.L. analyzed differential expression of gene. Y.Z. analyzed the transcriptome of C. hupingshanensis, Y.Z. and Q.T. wrote the main manuscript text. All authors reviewed the manuscript.

Competing Interests

The authors declare no competing interests.

Footnotes

Electronic supplementary material

Supplementary information accompanies this paper at 10.1038/s41598-018-21268-2.

Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.White PJ. Selenium accumulation by plants. Annals of botany. 2016;117:217–235. doi: 10.1093/aob/mcv180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Freeman JL, et al. Spatial imaging, speciation, and quantification of selenium in the hyperaccumulator plants Astragalus bisulcatus and Stanleya pinnata. Plant physiology. 2006;142:124–134. doi: 10.1104/pp.106.081158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Freeman JLT, et al. Molecular mechanisms of selenium tolerance and hyperaccumulation in Stanleya pinnata. Plant physiology. 2010;153:1630–1652. doi: 10.1104/pp.110.156570. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Sabbagh M, Van Hoewyk D. Malformed selenoproteins are removed by the ubiquitin -proteasome pathway in Stanleya pinnata. Plant & cell physiology. 2012;53:555–564. doi: 10.1093/pcp/pcs015. [DOI] [PubMed] [Google Scholar]
  • 5.El Mehdawi AF, et al. Analysis of selenium accumulation, speciation and tolerance of potential selenium hyperaccumulator Symphyotrichum ericoides. Physiologia plantarum. 2014;152:70–83. doi: 10.1111/ppl.12149. [DOI] [PubMed] [Google Scholar]
  • 6.Cappa JJ, et al. Evolution of selenium hyperaccumulation in Stanleya (Brassicaceae) as inferred from phylogeny, physiology and X-ray microprobe analysis. The New phytologist. 2015;205:583–595. doi: 10.1111/nph.13071. [DOI] [PubMed] [Google Scholar]
  • 7.Cappa JJ, et al. Characterization of selenium and sulfur accumulation across the genus Stanleya (Brassicaceae): A field survey and common-garden experiment. American journal of botany. 2014;101:830–839. doi: 10.3732/ajb.1400041. [DOI] [PubMed] [Google Scholar]
  • 8.Bai H-F, Chen L-B, Liu K-M, Liu L-H. A New Species of Cardamine (Brassicaceae) from Hunan, China. Novon: A Journal for Botanical Nomenclature. 2008;18:135–137. doi: 10.3417/2006129. [DOI] [Google Scholar]
  • 9.Shao S, et al. Accumulation and speciation of selenium in Cardamine sp. in Yutangba Se Mining Field, Enshi, China. Chinese Journal of Geochemistry. 2014;33:357–364. doi: 10.1007/s11631-014-0698-7. [DOI] [Google Scholar]
  • 10.Yuan, L. et al. A Novel Selenocystine-Accumulating Plant in Selenium-Mine Drainage Area in Enshi, China. PloS one8 (2013). [DOI] [PMC free article] [PubMed]
  • 11.Tamaoki M, Freeman JL, Pilon-Smits EAH. Cooperative Ethylene and Jasmonic Acid Signaling Regulates Selenite Resistance in Arabidopsis. Plant physiology. 2008;146:1219–1230. doi: 10.1104/pp.107.110742. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Zhu YG, Pilon-Smits EA, Zhao FJ, Williams PN, Meharg AA. Selenium in higher plants: understanding mechanisms for biofortification and phytoremediation. Trends in plant science. 2009;14:436–442. doi: 10.1016/j.tplants.2009.06.006. [DOI] [PubMed] [Google Scholar]
  • 13.Van Hoewyk D. A tale of two toxicities: malformed selenoproteins and oxidative stress both contribute to selenium stress in plants. Annals of botany. 2013;112:965–972. doi: 10.1093/aob/mct163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Pilon M, et al. Enhanced selenium tolerance and accumulation in transgenic Arabidopsis expressing a mouse selenocysteine lyase. Plant physiology. 2003;131:1250–1257. doi: 10.1104/pp.102.014639. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.LeDuc DL, et al. Overexpressing both ATP sulfurylase and selenocysteine methyltransferase enhances selenium phytoremediation traits in Indian mustard. Environmental pollution. 2006;144:70–76. doi: 10.1016/j.envpol.2006.01.008. [DOI] [PubMed] [Google Scholar]
  • 16.Pilon-Smits EAH, Colin F. Quinn. Selenium Metabolism in Plants. International urogynecology journal. 2016;27:225–241. [Google Scholar]
  • 17.Aureli, F., et al Identification of selenosugars and other low-molecular weight selenium metabolites in high-selenium cereal crops. Metallomics: integrated biometal science, 968–978 (2012). [DOI] [PubMed]
  • 18.Barickman TC, Kopsell DA, Sams CE. Selenium influences glucosinolate and isothiocyanates and increases sulfur uptake in Arabidopsis thaliana and rapid-cycling Brassica oleracea. Journal of agricultural and food chemistry. 2013;61:202–210. doi: 10.1021/jf3037227. [DOI] [PubMed] [Google Scholar]
  • 19.Matich AJ, McKenzie MJ, Brummell DA, Rowan DD. Organoselenides from Nicotiana tabacum genetically modified to accumulate selenium. Phytochemistry. 2009;70:1098–1106. doi: 10.1016/j.phytochem.2009.06.001. [DOI] [PubMed] [Google Scholar]
  • 20.Matich AJ, et al. Selenoglucosinolates and their metabolites produced in Brassica spp. fertilised with sodium selenate. Phytochemistry. 2012;75:140–152. doi: 10.1016/j.phytochem.2011.11.021. [DOI] [PubMed] [Google Scholar]
  • 21.Ouerdane L, et al. Comprehensive speciation of low-molecular weight selenium metabolites in mustard seeds using HPLC-electrospray linear trap/Orbitrap tandem mass spectrometry. Metallomics: integrated biometal science. 2013;5:1294–1304. doi: 10.1039/c3mt00113j. [DOI] [PubMed] [Google Scholar]
  • 22.Wang JY, et al. Genome-Wide Transcriptional Excavation of Dipsacus asperoides Unmasked both Cryptic Asperosaponin Biosynthetic Genes and SSR Markers. Frontiers in plant science. 2016;7:339. doi: 10.3389/fpls.2016.00339. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Cakir O, Turgut-Kara N, Ari S, Zhang B. De Novo Transcriptome Assembly and Comparative Analysis Elucidate Complicated Mechanism Regulating Astragalus chrysochlorus Response to Selenium Stimuli. PloS one. 2015;10:e0135677. doi: 10.1371/journal.pone.0135677. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Dixit G, et al. Reduced arsenic accumulation in rice (Oryza sativa L.) shoot involves sulfur mediated improved thiol metabolism, antioxidant system and altered arsenic transporters. Plant physiology and biochemistry: PPB/Societe francaise de physiologie vegetale. 2016;99:86–96. doi: 10.1016/j.plaphy.2015.11.005. [DOI] [PubMed] [Google Scholar]
  • 25.Miesak BH, Coruzzi GM. Molecular and physiological analysis of Arabidopsis mutants defective in cytosolic or chloroplastic aspartate aminotransferase. Plant physiology. 2002;129:650–660. doi: 10.1104/pp.005090. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Nagasaki T, et al. Cysteine dioxygenase and cysteine sulfinate decarboxylase genes of the deep-sea mussel Bathymodiolus septemdierum: possible involvement in hypotaurine synthesis and adaptation to hydrogen sulfide. Amino acids. 2015;47:571–578. doi: 10.1007/s00726-014-1891-z. [DOI] [PubMed] [Google Scholar]
  • 27.Okumoto S, et al. Root phloem-specific expression of the plasma membrane amino acid proton co-transporter AAP3. Journal of Experimental Botany. 2004;55:2155–2168. doi: 10.1093/jxb/erh233. [DOI] [PubMed] [Google Scholar]
  • 28.Hirschmann F, Krause F, Papenbrock J. The multi-protein family of sulfotransferases in plants: composition, occurrence, substrate specificity, and functions. Frontiers in plant science. 2014;5:556. doi: 10.3389/fpls.2014.00556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Baek MC, K SK, Kim DH, Kim BK, Choi EC. Cloning and Sequencing the Klebsiella K-36 astA Gene, Encoding an Arylsulfate Sulfotransferase. Microbiol. Immunol. 1996;40:531–536. doi: 10.1111/j.1348-0421.1996.tb01105.x. [DOI] [PubMed] [Google Scholar]
  • 30.Klein M, Papenbrock J. The multi-protein family of Arabidopsis sulphotransferases and their relatives in other plant species. Journal of Experimental Botany. 2004;55:1809–1820. doi: 10.1093/jxb/erh183. [DOI] [PubMed] [Google Scholar]
  • 31.Yang T, Fang GY, He H, Chen J. Genome-Wide Identification, Evolutionary Analysis and Expression Profiles of LATERAL ORGAN BOUNDARIES DOMAIN Gene Family in Lotus japonicus and Medicago truncatula. PloS one. 2016;11:e0161901. doi: 10.1371/journal.pone.0161901. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Taji T, et al. Important roles of drought- and cold-inducible genes for galactinol synthase in stress tolerance in Arabidopsis thaliana. The Plant Journal. 2002;29:417–426. doi: 10.1046/j.0960-7412.2001.01227.x. [DOI] [PubMed] [Google Scholar]
  • 33.Liu Y, et al. Molecular cloning and expression of an encoding galactinol synthase gene (AnGolS1) in seedling of Ammopiptanthus nanus. Scientific reports. 2016;6:36113. doi: 10.1038/srep36113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Oana, C., Michael, L., Wilson, I., Hancock, J. & Pamfil, D. The Arabidopsis thaliana Glycine-rich RNA Binding Proteins ATGRP7 and ATGRP2 Are Involved in Early Development. Pro Environment, 72–76 (2013).
  • 35.Rae GM, David K, Wood M. The Dormancy MarkerDRM1/ARPAssociated with Dormancy but a Broader RoleInPlanta. Developmental Biology Journal. 2013;2013:1–12. doi: 10.1155/2013/632524. [DOI] [Google Scholar]
  • 36.Eklof JM, Brumer H. The XTH gene family: an update on enzyme structure, function, and phylogeny in xyloglucan remodeling. Plant physiology. 2010;153:456–466. doi: 10.1104/pp.110.156844. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Hindupur SK, Gonzalez A, Hall MN. The opposing actions of target of rapamycin and AMP-activated protein kinase in cell growth control. Cold Spring Harbor perspectives in biology. 2015;7:a019141. doi: 10.1101/cshperspect.a019141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Jin X, Cheng H, Chen J, Zhu D. RNF13: an emerging RING finger ubiquitin ligase important in cell proliferation. The FEBS journal. 2011;278:78–84. doi: 10.1111/j.1742-4658.2010.07925.x. [DOI] [PubMed] [Google Scholar]
  • 39.Zhang Q, Meng Y, Zhang L, Chen J, Zhu D. RNF13: a novel RING-type ubiquitin ligase over-expressed in pancreatic cancer. Cell research. 2009;19:348–357. doi: 10.1038/cr.2008.285. [DOI] [PubMed] [Google Scholar]
  • 40.Jenkins K, et al. Mitochondrially localised MUL1 is a novel modulator of antiviral signaling. Immunology and cell biology. 2013;91:321–330. doi: 10.1038/icb.2013.7. [DOI] [PubMed] [Google Scholar]
  • 41.Bernoux M, et al. RD19, an Arabidopsis cysteine protease required for RRS1-R-mediated resistance, is relocalized to the nucleus by the Ralstonia solanacearum PopP2 effector. The Plant cell. 2008;20:2252–2264. doi: 10.1105/tpc.108.058685. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Fowler S, et al. GIGANTEA: a circadian clock-controlled gene that regulates photoperiodic flowering in Arabidopsis and encodes a protein with several possible membrane-spanning domains. The EMBO Journal. 1999;18:4679–4688. doi: 10.1093/emboj/18.17.4679. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Huq E, Tepperman JM, Quail PH. GIGANTEA is a nuclear protein involved in phytochrome signaling in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America. 2000;97:9789–9794. doi: 10.1073/pnas.170283997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Nakamichi N, et al. PSEUDO-RESPONSE REGULATORS 9, 7, and 5 are transcriptional repressors in the Arabidopsis circadian clock. The Plant cell. 2010;22:594–605. doi: 10.1105/tpc.109.072892. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Murakami M, Tago Y, Yamashino T, Mizuno T. Comparative overviews of clock-associated genes of Arabidopsis thaliana and Oryza sativa. Plant & cell physiology. 2007;48:110–121. doi: 10.1093/pcp/pcl043. [DOI] [PubMed] [Google Scholar]
  • 46.Dai S, et al. BROTHER OF LUX ARRHYTHMO is a component of the Arabidopsis circadian clock. The Plant cell. 2011;23:961–972. doi: 10.1105/tpc.111.084293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Shibagaki Nakako RA, et al. Selenate-resistant mutants of Arabidopsis thaliana identify Sultr1;2, a sulfate transporter required for efficient transport of sulfate into roots. The Plant Journal. 2002;29:475–486. doi: 10.1046/j.0960-7412.2001.01232.x. [DOI] [PubMed] [Google Scholar]
  • 48.Olsson SB, Engstrom P, Soderman E. The homeobox genes ATHB12 and ATHB7 encode potential regulators of growth in response to water deficit in Arabidopsis. Plant Molecular Biology. 2004;44:663–677. doi: 10.1007/s11103-004-1581-4. [DOI] [PubMed] [Google Scholar]
  • 49.Chao DY, et al. Variation in sulfur and selenium accumulation is controlled by naturally occurring isoforms of the key sulfur assimilation enzyme ADENOSINE 5′-PHOSPHOSULFATE REDUCTASE2 across the Arabidopsis species range. Plant physiology. 2014;166:1593–1608. doi: 10.1104/pp.114.247825. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Schiavon M, Pilon M, Malagoli M, Pilon-Smits EA. Exploring the importance of sulfate transporters and ATP sulphurylases for selenium hyperaccumulation-a comparison of Stanleya pinnata and Brassica juncea (Brassicaceae) Frontiers in plant science. 2015;6:13. doi: 10.3389/fpls.2015.00002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Bashandy T, et al. Interplay between the NADP-linked thioredoxin and glutathione systems in Arabidopsis auxin signaling. The Plant cell. 2010;22:376–391. doi: 10.1105/tpc.109.071225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Li S, et al. Nuclear Activity of ROXY1, a Glutaredoxin Interacting with TGA Factors, Is Required for Petal Development in Arabidopsis thaliana. The Plant Cell Online. 2009;21:429–441. doi: 10.1105/tpc.108.064477. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Cosio C, Dunand C. Specific functions of individual class III peroxidase genes. J Exp Bot. 2009;60:391–408. doi: 10.1093/jxb/ern318. [DOI] [PubMed] [Google Scholar]
  • 54.Muranaka A, Watanabe S, Sakamoto A, Shimada H. Arabidopsis cotyledon chloroplast biogenesis factor CYO1 uses glutathione as an electron donor and interacts with PSI (A1 and A2) and PSII (CP43 and CP47) subunits. Journal of Plant Physiology. 2012;169:1212–1215. doi: 10.1016/j.jplph.2012.04.001. [DOI] [PubMed] [Google Scholar]
  • 55.Jorg LLaM. The nuclear factor HCF145 affects chloroplast psaA-psaB-rps14 transcript abundance in Arabidopsis thaliana. The Plant Journal. 2004;38:740–753. doi: 10.1111/j.1365-313X.2004.02081.x. [DOI] [PubMed] [Google Scholar]
  • 56.Dalton, J. C., Bätz, U., Liu, J., Curie, G. L. & Quail, P. H. A Modified Reverse One-Hybrid Screen Identifies Transcriptional Activation Domains in PHYTOCHROME-INTERACTING FACTOR 3. Frontiers in plant science7 (2016). [DOI] [PMC free article] [PubMed]
  • 57.Ni W, et al. Multisite light-induced phosphorylation of the transcription factor PIF3 is necessary for both its rapid degradation and concomitant negative feedback modulation of photoreceptor phyB levels in Arabidopsis. The Plant cell. 2013;25:2679–2698. doi: 10.1105/tpc.113.112342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Ni W, et al. A mutually assured destruction mechanism attenuates light signaling in Arabidopsis. Science. 2014;344:1160–1164. doi: 10.1126/science.1250778. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Ohman D, et al. MYB103 is required for FERULATE-5-HYDROXYLASE expression and syringyl lignin biosynthesis in Arabidopsis stems. The Plant journal: for cell and molecular biology. 2013;73:63–76. doi: 10.1111/tpj.12018. [DOI] [PubMed] [Google Scholar]
  • 60.Lim E-K, Jackson RG, Bowles DJ. Identification and characterisation of Arabidopsis glycosyltransferases capable of glucosylating coniferyl aldehyde and sinapyl aldehyde. FEBS letters. 2005;579:2802–2806. doi: 10.1016/j.febslet.2005.04.016. [DOI] [PubMed] [Google Scholar]
  • 61.Müller K, Linkies A, Leubner-Metzger G, Kermode AR. Role of respiratory burst oxidase of Lepidium sativum (cress) seedling in root development and auxin signalling. Journal of Experimental Botany. 2012;63:6325–6334. doi: 10.1093/jxb/ers284. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Zhao XY, et al. Over-expression of the AtGA2ox8 gene decreases the biomass accumulation and lignification in rapeseed (Brassica napus L.). Journal of Zhejiang University. Science. B. 2010;11:471–481. doi: 10.1631/jzus.B1000161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Shan C, et al. OsGA2ox5, a gibberellin metabolism enzyme, is involved in plant growth, the root gravity response and salt stress. PloS one. 2014;9:e87110. doi: 10.1371/journal.pone.0087110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Lewis DR, et al. A kinetic analysis of the auxin transcriptome reveals cell wall remodeling proteins that modulate lateral root development in Arabidopsis. The Plant cell. 2013;25:3329–3346. doi: 10.1105/tpc.113.114868. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Kang B, et al. OsCYP2, a chaperone involved in degradation of auxin-responsive proteins, plays crucial roles in rice lateral root initiation. The Plant journal: for cell and molecular biology. 2013;74:86–97. doi: 10.1111/tpj.12106. [DOI] [PubMed] [Google Scholar]
  • 66.Shin D, et al. Athb-12, a homeobox-leucine zipper domain protein from Arabidopsis thaliana, increases salt tolerance in yeast by regulating sodium exclusion. Biochemical and biophysical research communications. 2004;323:534–540. doi: 10.1016/j.bbrc.2004.08.127. [DOI] [PubMed] [Google Scholar]
  • 67.Bu Q, et al. Role of the Arabidopsis thaliana NAC transcription factors ANAC019 and ANAC055 in regulating jasmonic acid-signaled defense responses. Cell research. 2008;18:756–767. doi: 10.1038/cr.2008.53. [DOI] [PubMed] [Google Scholar]
  • 68.Zhu X, et al. Jasmonic acid promotes degreening via MYC2/3/4- and ANAC019/055/072- mediated regulation of major chlorophyll catabolic genes. The Plant journal: for cell and molecular biology. 2015;84:597–610. doi: 10.1111/tpj.13030. [DOI] [PubMed] [Google Scholar]
  • 69.Fujita M, et al. A dehydration-induced NAC protein, RD26, is involved in a novel ABA- dependent stress-signaling pathway. The Plant journal: for cell and molecular biology. 2004;39:863–876. doi: 10.1111/j.1365-313X.2004.02171.x. [DOI] [PubMed] [Google Scholar]
  • 70.Tolleter D, et al. Structure and function of a mitochondrial late embryogenesis abundant protein are revealed by desiccation. The Plant cell. 2007;19:1580–1589. doi: 10.1105/tpc.107.050104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Cai H, et al. TRAPPI tethers COPII vesicles by binding the coat subunit Sec. 23. Nature. 2007;445:941–944. doi: 10.1038/nature05527. [DOI] [PubMed] [Google Scholar]
  • 72.Alves MS, et al. Plant bZIP transcription factors responsive to pathogens: a review. International journal of molecular sciences. 2013;14:7815–7828. doi: 10.3390/ijms14047815. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Zhao L, et al. Roles for a soybean RAV-like orthologue in shoot regeneration and photoperiodicity inferred from transgenic plants. J Exp Bot. 2012;63:3257–3270. doi: 10.1093/jxb/ers056. [DOI] [PubMed] [Google Scholar]
  • 74.Zhao L, Luo Q, Yang C, Han Y, Li W. A RAV-like transcription factor controls photosynthesis and senescence in soybean. Planta. 2008;227:1389–1399. doi: 10.1007/s00425-008-0711-7. [DOI] [PubMed] [Google Scholar]
  • 75.Osakabe A, et al. Vertebrate Spt2 is a novel nucleolar histone chaperone that assists in ribosomal DNA transcription. Journal of cell science. 2013;126:1323–1332. doi: 10.1242/jcs.112623. [DOI] [PubMed] [Google Scholar]
  • 76.Van Hoewyk D, et al. Transcriptome analyses give insights into selenium-stress responses and selenium tolerance mechanisms in Arabidopsis. Physiologia plantarum. 2008;132:236–253. doi: 10.1111/j.1399-3054.2007.01002.x. [DOI] [PubMed] [Google Scholar]
  • 77.Çakir Ö, Turgut-Kara N, Ari Ş. Selenium induced selenocysteine methyltransferase gene expression and antioxidant enzyme activities in Astragalus chrysochlorus. Acta Botanica Croatica. 2016;75:11–16. doi: 10.1515/botcro-2016-0015. [DOI] [Google Scholar]
  • 78.Song WY, et al. Arsenic tolerance in Arabidopsis is mediated by two ABCC-type phytochelatin transporters. Proceedings of the National Academy of Sciences of the United States of America. 2010;107:21187–21192. doi: 10.1073/pnas.1013964107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Vallentine, P., Hung, C. Y., Xie, J. & Van Hoewyk, D. The ubiquitin-proteasome pathway protects Chlamydomonas reinhardtii against selenite toxicity, but is impaired as reactive oxygen species accumulate. AoB PLANTS6 (2014). [DOI] [PMC free article] [PubMed]
  • 80.Wang YD, Wang X, Wong YS. Proteomics analysis reveals multiple regulatory mechanisms in response to selenium in rice. Journal of proteomics. 2012;75:1849–1866. doi: 10.1016/j.jprot.2011.12.030. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Information (180.5KB, doc)

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES