Skip to main content
PLOS One logoLink to PLOS One
. 2018 Feb 14;13(2):e0192979. doi: 10.1371/journal.pone.0192979

Development of a recombinase polymerase amplification assay for rapid detection of Francisella noatunensis subsp. orientalis

Khalid Shahin 1,2,*, Jose Gustavo Ramirez-Paredes 1, Graham Harold 1, Benjamin Lopez-Jimena 1, Alexandra Adams 1, Manfred Weidmann 1
Editor: Ulrich Melcher3
PMCID: PMC5812721  PMID: 29444148

Abstract

Francisella noatunensis subsp. orientalis (Fno) is the causative agent of piscine francisellosis in warm water fish including tilapia. The disease induces chronic granulomatous inflammation with high morbidity and can result in high mortality. Early and accurate detection of Fno is crucial to set appropriate outbreak control measures in tilapia farms. Laboratory detection of Fno mainly depends on bacterial culture and molecular techniques. Recombinase polymerase amplification (RPA) is a novel isothermal technology that has been widely used for the molecular diagnosis of various infectious diseases. In this study, a recombinase polymerase amplification (RPA) assay for rapid detection of Fno was developed and validated. The RPA reaction was performed at a constant temperature of 42°C for 20 min. The RPA assay was performed using a quantitative plasmid standard containing a unique Fno gene sequence. Validation of the assay was performed not only by using DNA from Fno, closely related Francisella species and other common bacterial pathogens in tilapia farms, but also by screening 78 Nile tilapia and 5 water samples. All results were compared with those obtained by previously established real-time qPCR. The developed RPA showed high specificity in detection of Fno with no cross-detection of either the closely related Francisella spp. or the other tested bacteria. The Fno-RPA performance was highly comparable to the published qPCR with detection limits at 15 and 11 DNA molecules detected, respectively. The RPA gave quicker results in approximately 6 min in contrast to the qPCR that needed about 90 min to reach the same detection limit, taking only 2.7–3 min to determine Fno in clinical samples. Moreover, RPA was more tolerant to reaction inhibitors than qPCR when tested with field samples. The fast reaction, simplicity, cost-effectiveness, sensitivity and specificity make the RPA an attractive diagnostic tool that will contribute to controlling the infection through prompt on-site detection of Fno.

Introduction

Francisellosis is an emergent systemic bacterial disease affecting the global production of tilapia. It is caused by Francisella noatunensis subsp. orientalis (Fno), which is a Gram negative facultative intracellular pathogen. The disease has been described in various geographical regions in warm water fish species including tilapia Oreochromis spp. [16], hybrid striped bass, Morone chrysops x M. saxatilis [7], three-line grunt Parapristipoma trilineatum [8] and ornamental fish [9, 10]. Fno is closely related to Francisella noatunensis subsp. noatunensis (Fnn) that affects commercially important cold-water fish including Atlantic cod, Gadus morhua L. [11, 12] and Atlantic salmon, Salmo salar L. [13, 14] and F. philomiragia which is an aquatic opportunistic bacterium that infects immunosuppressed mammals including humans [1519]. Multiple-organ granuloma with high morbidity and variable mortalities are the main characteristics of Francisellosis in fish [20].

Diagnosis of Fno is a challenging issue due to its nature as a fastidious intracellular bacterium and the insufficient availability of sensitive and specific detection methods for this pathogenic aquatic microorganism [21]. Conventional diagnosis of Fno via bacterial isolation in culture media has many constrains as it takes several days to grow and is often overgrown by concomitant bacteria [22, 23]. Furthermore, affected tissue samples need homogenisation for maximum bacterial recovery and isolation by culturing can give false negative results [24]. Antibody-based immunological assays such as enzyme-linked immunosorbent assay (ELISA) and immunohistochemistry (IHC), have also been used for Fno diagnosis, but they were reported to have low sensitivity and limited throughput [25, 26].

Nucleic acid-based methods have been applied for Fno detection, including conventional polymerase chain reaction (PCR) [4, 5, 2729], quantitative real time PCR (qPCR) [5, 21, 22, 30, 31], duplex PCR, in situ hybridisation [32] and loop mediated isothermal amplification (LAMP) [33]. Despite the fact that, these techniques have their own points of interest, downsides, for instance, time consuming [22, 33], labour intensive, prerequisite for skilled staff, liability to give false negative or false positive results due to low sensitivity or specificity [21], high influence with reaction inhibitors [34, 35] and requirement of complex design [33] make them more challenging to use for pond-site diagnosis.

The isothermal amplification technology recombinase polymerase amplification (RPA) is an alternative molecular technique that has been successfully used for field diagnosis of various pathogens. The technique has been widely used recently due to its affordable price (~4.5 USD per test), high sensitivity (limits of detection as low as 1 genome copy), short reaction time (results can be obtained in less than 10 min), robustness and simplicity (minimum equipment and hands-on manipulation required) [36] and has been used in a suitcase laboratory [37].

Since its first introduction in 2006, it has been widely adopted for the detection of pathogens of clinical importance in human medicine [3845], veterinary medicine [4653] and agriculture [54, 55]. In the aquatic veterinary field, the RPA has recently been developed for viral diseases for various fish and shell fish hosts including Penaeus stylirostris denso virus [56], shrimp white spot syndrome virus [57], infectious hypodermal and hematopoietic necrosis virus [58], Cyprinid Herpes virus-3 [59], abalone herpes-like virus and red-spotted grouper nervous necrosis virus [60]. There are no reported RPA assays developed for bacterial diseases affecting aquaculture until now.

The aim of the current study was to develop and validate a real-time RPA for a rapid and specific detection of Fno to be applied as a point-of-care diagnostic tool for monitoring and preventing the spread of francisellosis in tilapia aquaculture.

Materials and methods

Bacterial isolates and DNA extraction

In this study isolates of Fno and other bacteria including, closely related Francisella species and other non-related bacteria, were used for testing the specificity of the RPA. Bacterial isolates used are listed in Table 1. All Francisella strains including Francisella noatunensis subsp. orientalis (Fno), F. noatunensis subsp. noatunensis (Fnn) and F. philomiragia (Fp) were cultured from stock cultures on cysteine heart agar with 2% bovine haemoglobin (CHAH; BD, Oxford, UK). The agar plates were incubated at 28°C for 3 days for Fno, 22°C for 5 days for Fnn and 28°C for 24 h for Fp isolates respectively. After incubation, growth and purity confirmation, a loop-full of bacteria from each plate was inoculated into modified Mueller Hinton broth (MMHB) with 2% isovitalex and 0.1% glucose (BD, Difco, USA) and incubated in a shaking incubator (Kühner, Switzerland) at 28°C at 150 rpm for 20 h. Colonies of Aeromonas hydrophila, Streptococcus agalactiae, S. iniae, Escherchia coli, Yersinia ruckeri and Pseudomonas sp. were grown on Tryptic Soy agar (Sigma-Aldrich, UK) at 28°C for 48 h at 150 rpm, then inoculated into tryptic soy broth (Sigma-Aldrich, UK) and incubated for 24 h at 28°C at 150 rpm. Strains of Vibrio anguillarum and Photobacterium damselae were cultured on marine agar at 28°C for 48 hrs (Difco, USA) then inoculated into tryptic soy broth (Sigma-Aldrich, UK) with 2% NaCl (Sigma-Aldrich, UK) and incubated for 24 h at 28°C at 150 rpm.

Table 1. Bacterial strains tested in the study.

Bacterial species Strain ID Source
F. noatunensis subsp. orientalis* STIR-GUS F2f7 Tilapia (UK)
F. noatunensis subsp. orientalis# NVI-PQ1104 Tilapia (Costa Rica)
F. noatunensis subsp. orientalis # DSMZ21254T Three-line grunt (Japan)
F. noatunensis subsp. orientalis NVI-9449 Malawi cichlids (Austria)
F. noatunensis subsp. orientalis* AVU-Fran-Cos1 Tilapia (Mexico)
F. noatunensis subsp. orientalis# AVU-STIR-HON1 Tilapia (Central America)
F. noatunensis subsp. noatunensis# NCIMB 14265 T Atlantic, Cod (Norway)
F. noatunensis subsp. noatunensis # NVI-7601 Atlantic Cod (Ireland)
F. noatunensis subsp. noatunensis# PQ1106 Atlantic Salmon (Chile)
F. philomiragia# ATCC® 25015T Muskrat (USA)
F. philomiragia# ATCC® 25017T Water (USA)
F. philomiragia# CCUG 12603T Human abscess (Sweden)
Aeromonas hydrophila§ ATCC® 7966T Milk with fish odour (USA)
Streptococcus agalactiae§ ATCC® 51487T Tilapia (Israel)
Streptococcus iniae§ ATCC® 29178T Amazon fresh water dolphin
Vibrio anguillarum§ ATCC® 19264T Atlantic Cod (UK)
Photobacterium damselae§ ATCC® 51736 T Yellow tail fish (Japan)
Escherichia coli* ATCC® 11775T Urine (Sweden)
Yersinia ruckeri§ ATCC® 29473T Rainbow trout (USA)
Pseudomonas species* AVU-STIR-Ps17 Lump sucker (UK)

(T) Type strains

AVU: Aquatic Vaccine Unit bacterial culture collection, DSMZ: The German Collection of Microorganisms and Cell Cultures, NVI: The Norwegian Veterinary Institute, NCIMB: The National Collection of Industrial Food and Marine Bacteria, ATCC: American Type Culture Collection.

(*strains provided by aquatic vaccine unit, Stirling University

§ bacterial strains kindly provided by Dr. Kim Thompson, Aquatic Research Group, Moredun Research institute, UK

# bacterial strain kindly donated by Dr. Duncan Colquhoun, Norwegian Veterinary Institute

bacterial strain kindly provided by Professor El-Matbouli, University of Veterinary Medicine, Austria)

The genomic DNA from the different bacterial cultures was extracted using a real pure genomic DNA extraction kit (Real Laboratory, Valencia, Spain) following the manufacturer’s protocol for genomic DNA extraction from bacterial cells. The concentration of the DNA samples was measured using a nanodrop (Nanodrop 1000, ThermoFisher Scientific, UK). Each DNA sample was standardised to 100 ng/μL and stored at -20°C until use.

Field samples

Samples of spleen (n = 78), head kidney (n = 78) and water (n = 5) were used in the current study. The tissue samples were obtained from 78 moribund and clinically healthy Nile tilapia, Oreochromis niloticus (L.) that were randomly collected from two different geographical locations including 38 fish from three tilapia farms in the UK (Farm one (Lincolnshire): 10 fish / 40±3 gm; Farm two (Lincolnshire): 10 fish /45±2 gm; Farm three (London): 18 fish / 12±5 gm) and 40 fish from a commercial tilapia farm in Prachinburi province, Thailand (10±2gm). The first and second UK farms and the Thai farm had a history of natural outbreaks of francisellosis during 2011–2012 and 2008, 2013–2014 respectively with granulomatous lesions in the affected fish and variable mortalities [4,29,33]. The third UK farm had no history of francisellosis, but it supplied red tilapia fry to an aquaponics farm in London, UK, where a natural outbreak of francisellosis occurred during spring 2017. Five water samples of 500 mL were collected from different sections at the infected aquaponics farm that received fish from the third UK farm including 1 sample from UV filter unit, 2 samples from bio-filter tanks and 2 samples from 2 separate tanks holding diseased fish.

Isolation of Fno from spleen samples from the first and second UK farms and the Thai farm was attempted using CHAH following the recommended protocol [28, 29]. DNA from 20 mg of the collected spleen and head kidney samples was extracted using the same kit used for bacterial gDNA extraction following the manufacturer’s instruction for tissues. DNA from 350 mL of each water sample was extracted using DNeasy Blood and Tissue Kit (QIAGEN, Germany) as described previously [61]. All the extracted DNA samples were standardised to 100 ng/μL and stored at -20°C until use.

Preparation of plasmid DNA standard containing the FSC771 gene

Plasmid DNA cloning

A specific gene sequence unique to Fno [24] representing the FSC771 hypothetical protein gene (Genbank accession no. JQ780323.1) was synthesized and ligated into vector backbone pENTR221 (Geneart, Life Technologies Ltd, Paisely, United Kingdom). The resulting standard Fno-plasmid “pFNO STD”, (S1 Fig in supporting files) was transformed into an E. coli vector (OmniMAX™ 2 T1R) and purified from transformed bacteria using QIAprep8 Miniprep Kit (QIAGEN, UK). The final construct was verified by sequencing and the sequence congruence with in the insertion sites was 100%.

Restriction, concentration and quantification of the plasmid standard

The plasmid was linearized with Eco-RV (R01955 NEB, New England laboratories, UK), and the restricted plasmid band was extracted from a 1% agarose gel using a sterile scalpel and purified using the QIAEX® II Gel extraction kit (QIAGEN, UK) following the manufacturer`s protocol. The concentration of the purified plasmid DNA was quantified using the Quant-iT™ PicoGreen® dsDNA kit (Molecular Probes, ThermoScientific, UK) following the kit protocol. The fluorescence (excitation = 480 nm and emission = 520 nm) was measured by plate reader (BioTek, Synergy HT, USA). Using the molecular weight of DNA, the copy numbers of the plasmid was determined and a quantitative plasmid standard ranging from 107 to 101 DNA molecules/μL was prepared.

Real-time qPCR for the plasmid standard

Real-time qPCR was performed according to a previously established protocol [22] using the primers listed in Table 2. The assay was performed on a LightCycler® 2.0 (ROCHE, Germany) in a 20 μL reaction volume that consisted of 0.3 μM from each primer (Eurofins Genomics, UK), 1x Luminaris color HiGreen™ qPCR master mix (ThermoFisher Scientific, UK), 1 μL DNA template and up to 20 μL of nuclease free water (ThermoFisher Scientific, UK). The qPCR cycling conditions were adopted from the published qPCR [22] as following, 50°C for 2 min for uracil-DNA glycosylase enzyme activation, 95°C for 10 min to start denaturing the UNG enzyme and activate the DNA polymerase enzyme followed by 45 cycles at 95°C for 15 sec and 60°C for 1 min. Melting curve analysis formed of 1 cycle at 95°C for 30 sec, 55°C for 30 sec and 95°C for 30 sec. All samples were run in duplicates and each run included non-template control (Milli-Q water only). A standard curve was created from the data of three runs (n = 3).

Table 2. List of primers and probes used in the experiment.

Name Sequence (5’– 3’) Ampliconsize Source
RPA (F1) ATGAGATATGTGTTAATTTGGCTGTTCCTGTACGA 153 bP This study
RPA (R2) TAGTTGTATCAGTAATAGGCGTAACTCCTTTTAGC
RPA (P) GTATAATCTTTTCGTTCTAACTGAGATTGAXTXFTTCTAGGAAGCTAA-PH
qPCR (F) CATGGGAAACAAATTCAAAAGGA 85 bP [22]
qPCR (R) GGAGAGATTTCTTTTTTAGAGGAGCT
PCR (F5) CCTTTTTGAGTTTCGCTCC 1140 bP [62]
PCR (F11) TACCAGTTGGAAACGACTG

(F) Forward primers, (R) Reverse primer, (P) probe, (PH) Phosphate group to block elongation.

Real-time RPA primers and probe

Two primers and an exo-probe for RPA were designed following the manufacturer instructions [63] using the Fno FSC771 hypothetical protein gene sequence (456 pb; GenBank accession no. JQ780323.1). All existing similar sequences in fish pathogenic Fno, Fnn, as well as the human pathogenic and environmental Fp strains [6467] were included in the alignment to exclude cross detection (Fig 1).

Fig 1. Alignment of RPA target region in unique Fno FSC771 hypothetical gene region.

Fig 1

Fno sequences at the top, followed by primer sequences and F. philomiragia sequences at the bottom. The Fno target region is 100% conserved and present in JQ780323 (shown), CP006875, CP011921-23, CP012153, CP018051, NC_023029, LTDO01000001, CP003402, NC_017909. Positions are given in relation to Fno sequence CP006875. The nucleotide underlined at the 3’-end of forward primer (FNO RPA FP) is mismatched to F. philomiragia sequences following the ARMS concept. NNN represents the tetrahydrofuran bridge of the probe.

The probe contained a tetrahydrofuran spacer (THF) with a 5’ quencher (BHQ1-dT; thymidine nucleotide carrying Blackhole quencher) and 3’ fluorescence reporter (FAM-dT; thymidine nucleotide carrying 6 carboxy-flourescein). The sequences of the final primers and probe used in this study are listed in Table 2. The primers and the probe for RPA were synthesised by TIB Molbiol (Berlin, Germany).

RPA reaction

The RPA reaction was performed in a 50 μL volume using a TwistAmp™ exo lyophilized kit (TwistDX, Cambridge, United Kingdom). The reaction mixture included 420 nM of each primer, 120 nM FAM-tagged RPA probe, 14 mM magnesium acetate, 1x rehydration buffer and 1 μl of template. All the reagents except the template and Mg acetate were prepared in a master mix which was distributed into 0.2 mL tubes (Eppendorf, Germany). Four μL of Mg acetate was pipetted into the lid of the reaction tubes containing the dried reaction-pellet. One μL of the template was added to the mixture aliquots and quickly centrifuged using a mini-spin centrifuge (MCF 2360, LMS Co., Ltd., South Korea) then transferred to the reaction tubes and lids were closed carefully. The tubes were vigorously mixed by inversion 10 times and centrifuged for 20 sec. The tubes were immediately placed in an ESE Quant Tube Scanner device (QIAGEN, Germany). The tubes were incubated at 42°C for 20 min where the fluorescence measurement including excitation at 470 nm and detection at 520 nm for FAM channel was performed. After 4 min, the tubes were taken out of the ESE Quant Tube Scanner device for a quick spin then returned to complete the scanning. The ESE Quant scanner software enabled threshold validation including evaluation of fluorescence by increasing the fluorescence above three standard deviations over the background detected in the first minute of the reaction. In addition, the curve slope represented in mV/time can be utilized (slope adaptable) and a second derivative window for calculation of the turning point of the upward fluorescence development can be used for verifying curves with a very low slope.

Analytical sensitivity and specificity of RPA detection

The quantitative Fno-plasmid DNA standard was used to evaluate the sensitivity of the RPA and qPCR reactions using 1 μL of a dilution range of 107 to 101 molecules/μL. Both RPA and qPCR were repeated 10 times using individual master mixes. Each run included duplicate reactions and non-template control (Milli-Q water only). To evaluate the specificity of the RPA reaction, the assay was tested using 1 μL of gDNA (100 ng/μL) from the different bacterial strains listed in Table 1.

Clinical validation of Fno RPA

DNA extracted from fish tissues (78 spleen and 78 head kidney samples) and water samples (n = 5) were used to test the developed RPA. The tissue and water samples were firstly tested by both conventional PCR using previously published Francisella genus-specific primers [62] (Table 2) and qPCR using Fno-specific primers [22] targeting a region slightly downstream from the region used for RPA amplicon design. One μL from the total DNA (100 ng/μL) was amplified using RPA and results were compared with data obtained from qPCR. All positive RPA results were additionally verified by secondary derivative analysis as implemented in the analysis software. Samples tested negative by qPCR and positive by RPA were further diluted to 1:10 and 1:100 dilutions and re-tested to investigate potential inhibition of qPCR. The diagnostic performance of the developed RPA was evaluated by calculation of sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) using free statistical calculators “Diagnostic Test Evaluation Calculator” (https://www.medcalc.org/calc/diagnostic_test.php) [68] and results were presented as a percentage.

Statistics

Microsoft Excel 2016 was used to arrange the data for analysis. GraphPad® prism v.6 (GraphPad, San Diego, CA, USA) was used to calculate a semi-log regression of the data set of 10 runs of Fno-RPA and qPCR by blotting the threshold time in minutes (Tt) for RPA or the cycle threshold (Ct) for qPCR against the molecules detected of the Fno-plasmid standard DNA dilutions (107:101 copies/μL). A probit regression analysis was performed by Minitab® v.17 (Minitab Ltd., UK) to calculate limits of detection (LOD) in 95% of the cases following both assays.

Results and discussion

Francisellosis is one of the most serious bacterial diseases affecting the tilapia industry worldwide. Mortality rates of up to 95% were documented in cultured tilapia in Taiwan [69, 70] and more recently mortalities up to 40% in broodstock in Mexico [5] and 5–50% in fingerlings and juveniles in Brazil [31]. Application of rapid, sensitive and robust monitoring represents the most reliable strategy for early identification of outbreaks and initiation of control measures to prevent the spread of the disease.

In the current study, we developed an isothermal RPA assay for rapid and specific detection of Fno. The analytical sensitivity of the developed RPA in our study was highly comparable to the published qPCR [22] which had a reported sensitivity of 10 DNA molecules of Fno gDNA [22]. We used a quantitative Fno-plasmid DNA dilutions range from 107 to 101 DNA molecules/μL (Figs 2 and 3) in 10 independent runs for probit analysis which calculated detection limits of 15 and 11 DNA molecules for RPA (Fig 4A) and qPCR (Fig 4B), respectively. However, there was a contrast in the time required to reach the limits of detection in both assays, where RPA (Fig 2A) could achieve that in 6 min (6.2±0.6 min), needing only ~ 2.7–3 min to determine Fno in clinical samples, while qPCR (Fig 2B) required 90 min (Ct 35.2±0.6) to achieve its detection limit. The short time of detection in RPA makes it an attractive tool for an on-site detection and monitoring strategy for francisellosis especially on large farms. Also, the quick turnaround of RPA would likewise be of advantage in a standard research facility set-up empowering high-throughput testing.

Fig 2. Performance of RPA and qPCR using dilutions of Fno-plasmid DNA standard.

Fig 2

Representatives amplification curves from three runs of both RPA (A) and qPCR (B) (n = 3) showing the fluorescence development over time in both assays using a dilution range of 107 to 101 copies /μL of the Fno-plasmid standard DNA. After 4 minutes, the tubes were mixed and centrifuged, therefore, a gap appears in the graph.

Fig 3. Reproducibility of RPA and qPCR assays.

Fig 3

The semi-log regression generated by 10 data sets of RPA (A) and qPCR (B) on a dilution range of the molecular standard (107−101 DNA molecules/reaction).Threshold time (Tt in RPA) and cycle threshold (Ct in qPCR) were represented as a mean ± standard deviation (±SD). The highest detection sensitivity of both assay were 10 DNA molecules detected. These data were used for the probit regression analysis showed in Fig 4.

Fig 4. Probit regression analysis of data set of 10 runs of Fno-RPA and qPCR using Minitab®.

Fig 4

The black triangle indicates limits of detection at 95% probability which were 15 and 11 molecules detected of Fno-plasmid standard DNA in RPA (A) and qPCR (B) respectively.

The Fno-RPA developed in our study targeting the unique FSC771 hypothetical protein gene presents in Fno, but not in the closely related Fnn [22] showed high specificity, and only detected gDNA of Fno isolates, while all gDNA from other tested bacterial panel were negative (Table 3 and S2 Fig in supporting files).

Table 3. Analytical specificity of Fno RPA.

Bacterial species Strain Detection by RPA
F. noatunensis subsp. orientalis STIR-GUS F2f7 +
F. noatunensis subsp. orientalis NVI-PQ1104 +
F. noatunensis subsp. orientalis DSMZ21254T +
F. noatunensis subsp. orientalis NVI-9449 +
F. noatunensis subsp. orientalis AVU- Fran-Cos1 +
F. noatunensis subsp. orientalis AVU- STIR-HON1 +
F. noatunensis subsp. noatunensis NCIMB 14265 T -
F. noatunensis subsp. noatunensis NVI-7601 -
F. noatunensis subsp. noatunensis PQ1106 -
F. philomiragia ATCC® 25015 T -
F. philomiragia ATCC® 25017 T -
F. philomiragia CCUG 12603 T -
Aeromonas hydrophila ATCC® 7966 T -
Streptococcus agalactiae ATCC® 51487 T -
Streptococcus iniae ATCC® 29178 T -
Vibrio anguillarum ATCC® 19264 T -
Photobacterium damselae ATCC® 51736 T -
Escherichia coli ATCC® 11775 T -
Yersinia ruckeri ATCC® 29473 T -
Pseudomonas species Clinical isolate -

(T) Type strains

(+) Positive, (-) Negative.

We included three recently published alignments of Fp sequences [64] belonging to isolates recovered from water and human patients (accession no. CP009444; CP009442; CP009440) containing similar sequence of the FSC771 hypothetical protein gene in our analysis. In a previous cross detection experiment, the published qPCR did not pick up any Fp strains tested [22]. Sequences alignment now confirms that, this is due to 3 mismatches in the Fp target region for the qPCR probe.

Additionally, the cold-water fish pathogen Francisella noatunensis subsp. noatunensis used in the current cross-detection study, was found to be genetically, biochemically and morphologically distinct sub species from Fno [71]. Alignments of the available genome sequences [6366] showed that Fnn was lacking the FSC771 hypothetical protein gene sequence. This finding is now confirmed as neither the developed RPA assay (Table 3) nor the previously published qPCR [22] could detect it. By using the principles of the ARMS concept [72] and including a mismatch at position 3 from the 3’-end of the RPA forward primer (Fig 1), detection of Fp was avoided as confirmed by our cross-detection assays (Table 3). Thus, even in the case of environmental contamination, false positive results due to pick up of Fp are excluded.

Testing the clinical samples by bacteriological tests, conventional PCR, qPCR and RPA showed a higher performance of RPA (Table 4). Fno was successfully recovered using CHAH from 7/10, 3/10 and 14/40 spleen samples from first and second UK and Thai tilapia, respectively. Also, Fno-positive tissues were detected by PCR (38/78 spleens, 33/78 head kidneys) (S3 Fig in supporting files), qPCR (46/78 spleens, 42/78 head kidneys) and RPA (47/78, 47/78). Interestingly, all water samples tested positive by RPA, while they were negative by PCR and qPCR (Table 4). The clinical sensitivity and specificity of the developed RPA assay were 100% and 84.93%, respectively (Table 5).

Table 4. Screening of tilapia tissues and water samples for Fno.

Sample ID. Sample type Fno isolation by bacteriology Conventional PCR qPCR Cycles threshold (Ct) RPA threshold time (Tt) in minutes
Fish 1 Spleen - + 30.06 + 3.7 +
Head Kidney + 36.97 + 5.7 +
Fish 2 Spleen - - - - - -
Head Kidney - - - 5.7 +
Fish 3 Spleen + + 30.8 + 5.7 +
Head Kidney + 25.1 + 3.3 +
Fish 4 Spleen + + 29.44 + 5.7 +
Head Kidney + 32.3 + 3.7 +
Fish 5 Spleen + + 27.45 + 3.3 +
Head Kidney + (w) 31.07 + 5.7 +
Fish 6 Spleen + + - - 5.7 +
Head Kidney + 27.68 + 3.7 +
Fish 7 Spleen + + 32.38 + 5.7 +
Head Kidney - - - 5.7 +
Fish 8 Spleen - - - - - -
Head Kidney - 34.86 + 5.7 +
Fish 9 Spleen + + 38.82 + 5.7 +
Head Kidney + 30.16 + 5.7 +
Fish 10 Spleen + + 28.1 + 3.3 +
Head Kidney - - - 5.7 +
Fish 11 Spleen - - - - - -
Head Kidney - - - 6.0 +
Fish 12 Spleen - + 30.83 + 3.7 +
Head Kidney - - - - -
Fish 13 Spleen - - - - - -
Head Kidney - - - - -
Fish 14 Spleen + 23.42 + 3.0 +
Head Kidney - - - - -
Fish 15 Spleen + + 27.98 + 2.7 +
Head Kidney + 25.14 + 3.3 +
Fish 16 Spleen - - 32.53 + 5.7 +
Head Kidney - - - 5.7 +
Fish 17 Spleen + + 28.19 + 3.0 +
Head Kidney - - - - -
Fish 18 Spleen + + 23.66 + 3.0 +
Head Kidney + (w) 35.21 + 5.7 +
Fish 19 Spleen - - - - - -
Head Kidney - - - - -
Fish 20 Spleen - - - - - -
Head Kidney - - - - -
Fish 21 Spleen + + 23.94 + 5.7 +
Head Kidney + 21.24 + 4 +
Fish 22 Spleen - - 23.49 + 5.7 +
Head Kidney - 23.30 + 3.7 +
Fish 23 Spleen + + 23.57 + 5.7 +
Head Kidney + 20.51 + 3.3 +
Fish 24 Spleen - + 21.88 + 5.7 +
Head Kidney + (w) 23.67 + 5.7 +
Fish 25 Spleen + + 22.19 + 5.7 +
Head Kidney + 22.34 + 3.7 +
Fish 26 Spleen + + 21.67 + 5.7 +
Head Kidney + 21.28 + 3.3 +
Fish 27 Spleen - + 22.91 + 5.7 +
Head Kidney + 19.49 + 5.7 +
Fish 28 Spleen - + 18.04 + 3.3 +
Head Kidney + 21.01 + 3.7 +
Fish 29 Spleen - - 19.99 + 5.7 +
Head Kidney - 22.33 + 3.7 +
Fish 30 Spleen + + 23.71 + 5.7 +
Head Kidney + 25.76 + 5.7 +
Fish 31 Spleen + + 21.81 + 3.7 +
Head Kidney + (w) 30.94 + 5.7 +
Fish 32 Spleen - + 22.04 + 5.7 +
Head Kidney + (w) 23.70 + 3.7 +
Fish 33 Spleen + + 24.41 + 3.7 +
Head Kidney + 21.85 + 3 +
Fish 34 Spleen - - 22.09 + 3.7 +
Head Kidney - 25.93 + 3.7 +
Fish 35 Spleen + + 24.66 + 3.7 +
Head Kidney + 20.32 + 3 +
Fish 36 Spleen - + 20.84 + 4 +
Head Kidney + 20.56 + 3 +
Fish 37 Spleen - - 21.78 + 3 +
Head Kidney - 26.36 + 5.7 +
Fish 38 Spleen - - 18.15 + 3 +
Head Kidney - 21.60 + 3.3 +
Fish 39 Spleen + + 24.65 + 5.7 +
Head Kidney + 22.90 + 4.7 +
Fish 40 Spleen + + 24 + 5.3 +
Head Kidney + 20.72 + 3.3 +
Fish 41 Spleen + + 20.81 + 3.3 +
Head Kidney + 21.14 + 3.7 +
Fish 42 Spleen - + 24.74 + 5.7 +
Head Kidney + 20.58 + 3 +
Fish 43 Spleen - - 29.67 + 5.7 +
Head Kidney - 22.37 + 3.3 +
Fish 44 Spleen + + 23.05 + 3.7 +
Head Kidney + 35.20 + 6 +
Fish 45 Spleen - + 29.06 + 5.7 +
Head Kidney + 21.52 + 3.3 +
Fish 46 Spleen - + 23.97 + 3.7 +
Head Kidney + 23.32 + 3.3 +
Fish 47 Spleen + + 20.32 + 3 +
Head Kidney + 22.73 + 3.3 +
Fish 48 Spleen - - 26.20 + 5.7 +
Head Kidney - 24.67 + 3.7 +
Fish 49 Spleen - + 22.54 + 3.7 +
Head Kidney + 21.96 + 3.3 +
Fish 50 Spleen - + 20.1 + 3 +
Head Kidney + 21.29 + 3 +
Fish 51 Spleen - + 21.59 + 3.3 +
Head Kidney + 18.75 + 3 +
Fish 52 Spleen + + 28.09 + 5.7 +
Head Kidney + 23.85 + 3.7 +
Fish 53 Spleen - - - - - -
Head Kidney - - - - -
Fish 54 Spleen - - - - - -
Head Kidney - - - - -
Fish 55 Spleen - - 34.53 + 5.7 +
Head Kidney - 33.9 + 5.7 +
Fish 56 Spleen - - - - - -
Head Kidney - - - - -
Fish 57 Spleen - - - - - -
Head Kidney - - - - -
Fish 58 Spleen - - - - - -
Head Kidney - - - - -
Fish 59 Spleen - - - - - -
Head Kidney - - - - -
Fish 60 Spleen - - - - - -
Head Kidney - - - - -
Fish 61 Spleen N/A - - - - -
Head Kidney - - - - -
Fish 62 Spleen N/A - - - - -
Head Kidney - - - - -
Fish 63 Spleen N/A - - - - -
Head Kidney - - - - -
Fish 64 Spleen N/A - - - - -
Head Kidney - - - - -
Fish 65 Spleen N/A - - - - -
Head Kidney - - - - -
Fish 66 Spleen N/A - - - - -
Head Kidney - - - - -
Fish 67 Spleen N/A - - - - -
Head Kidney - - - - -
Fish 68 Spleen N/A - - - - -
Head Kidney - - - - -
Fish 69 Spleen N/A - - - - -
Head Kidney - - - - -
Fish 70 Spleen N/A - - - - -
Head Kidney - - - - -
Fish 71 Spleen N/A - - - - -
Head Kidney - - - - -
Fish 72 Spleen N/A - - - - -
Head Kidney - - - - -
Fish 73 Spleen N/A - - - - -
Head Kidney - - - - -
Fish 74 Spleen N/A - - - - -
Head Kidney - - - - -
Fish 75 Spleen N/A - - - - -
Head Kidney - - - - -
Fish 76 Spleen N/A - - - - -
Head Kidney - - - - -
Fish 77 Spleen N/A - - - - -
Head Kidney - - - - -
Fish 78 Spleen N/A - - - - -
Head Kidney - - - - -
Water Samples UV filter N/A - - - 5.7 +
Bio-filter 1 N/A - - - 5.7 +
Bio-filter 2 N/A - - - 3.7 +
Tank 1 N/A - - - 6 +
Tank 2 N/A - - - 5.7 +

(+) Positive, (-) Negative, (w) Weak positive/negative, (N/A) Not done

Table 5. The diagnostic performance of the Fno RPA using field samples.

Real-time qPCR Performance characteristics (%)
Method True positive True Negative False Positive False negative Sensitivity % (95% CI) Specificity % (95% CI) PPV% (95% CI) NPV% (95% CI)
RPA 88 62 11 0 100% (95.89 to 100) 84.89% (74.64 to 92.23) 88.89% (82.27 to 93.24) 100% (100)

(PPV: Positive predictive value, NPV: Negative predictive value)

The robustness of the RPA to crude clinical specimens is often featured as a favourable benefit. The developed RPA in our study was found to be more robust than qPCR in detection of Fno when clinical/field samples were used. The RPA scored more positive results than qPCR which failed to detect Fno in 11 crude DNA samples (1 spleen, 5 head kidney and 5 water samples) and only showed positive reactions after their dilution (S1 Table in supporting files). This is due to the fact that, RPA is more tolerant to common PCR reaction inhibitors [36]. This advantage was highlighted in various studies, which showed that RPA can work in presence of agents with inhibitory effect on PCR including 15–25% of milk, 50 g/L haemoglobin, 4% V/V ethanol and 0.5 U of heparin [36]. Also, detection of 103 molecules of gDNA of S. agalactiae in presence of up to 5 μL of stool sample and 5x106 molecules of Crimean-Congo haemorrhagic fever viral RNA in preparations contained 1:10 dilutions of crude human serum, urine and tick pool homogenate was previously reported [75, 76]. This finding highlights the robustness of the developed Fno RPA for detection of nucleic acids in different crude biological samples if the appropriate extraction protocol is carried out.

Moreover, other isothermal assays were adopted for diagnosis of francisellosis in tilapia including LAMP that was successfully used for detection of Fno with LOD at 1 fg [33]. However, LAMP has many drawbacks in comparison with RPA, as it depends on turbidity index measurement with a Loopamp® Realtime Turbidimeter that weighs ~ 5 Kg, uses a complex-design of 6 oligonucleotides targeting four target sequences, requires a high temperature of 60°C, and has a longer reaction time (45 min) [33]. Thus, these findings ultimately favour the usage of RPA instead of LAMP for mobile isothermal detection of Fno.

The Fno-RPA was performed at a relatively low temperature with isothermal conditions (42°C) and real-time monitoring was performed using an ESE-Quant tube scanner which is less expensive than a mobile cycler. This tube scanner is convenient with a footprint of 17.5 x 19 cm and an approximate weight of 2 Kg including the attached laptop. Other readers are commercially available such as the Axxin TSO-ISO reader [73] or the Genie III [74]. These devices or others currently being developed such as hand-held detection devices can contribute to the development of mobile pond-side or point-of-care diagnosis of Fno in tilapia farms.

One of the main benefits of the RPA is the convenience of the assay, as the kit used (TwistAmp Exo kit) is commercially available in the form of dried pellets accompanied with the rehydration buffer and reagents required for the reaction mixture. The only step required is the addition of primers, probe and template DNA. Also, the detection is performed with an ESE-Quant tube scanner that is very compact. Nevertheless, a major constraint of using the RPA in field is ability to extract good quality nucleic acids to perform the test. However, there are many commercially available DNA extraction methods at the moment which are simple, cheap and suitable for field application including magnetic bead-based technology, heated NaOH method [77] and mobile extraction devices like QuickGene-Mini80 (Autogen®, USA) [78, 79]. Using any of these methods will make a considerable decrease in the cost of the RPA assay and provide more flexibility to its use in the field conditions and in the poor-setting diagnostic labs.

Recently, RPA assays were used in combination with other tools including lateral flow dip sticks (LFD) [77, 8082], enzyme-linked immunosorbent assays [83], aptamer-based bio-barcodes (ABC) [84], and hybridization in microarray format [85]. These tools enhanced the performance of the RPA assay and elucidated its significance as a versatile next-generation molecular diagnostic test. Overall, the Fno-RPA developed in the current study can be considered a potential user-friendly method for the simple, accurate and rapid detection of Fno that can be applied for field screening of tilapia for francisellosis.

Conclusions

A novel real-time Fno-RPA was developed for the rapid and accurate detection of Fno that showed high analytical sensitivity and specificity with robust performance when applied in clinical samples. The sensitivity, specificity and reproducibility were highly comparable to the published qPCR with better tolerance to amplification inhibitors. Using the RPA assay with a mobile tube scanner and a fast and affordable DNA extraction protocol could be used as a powerful “pond-side test” to be applied on fish farms in poor settings infrastructure for the detection of Fno. Future studies need to be conducted to test different DNA extraction methods for further improvement of the assay application.

Supporting information

S1 Fig. Fno standard plasmid map.

(TIF)

S2 Fig. Analytical specificity of the Fno RPA.

Positive amplification only with Fno isolates [A], while negative results were obtained with Fnn, Fp and non-Francisella isolates [B and C]. A1 (violet line), B1 (Blue line) and C1 (blue line): Positive control, A2: Negative control (dark green line), A3: A8: Fno isolates (A3: Fno UK isolate (black line), A4: Fno Costa Rican isolate (red line), A5: Fno Japanese isolate (green line), A6: Fno Austrian isolate (orange line), A7: Fno Mexican isolate (pink line), A8: Fno Central American isolate (brown line), B2: B7: Fnn isolates (B2: Fnn Norwegian isolate (black line), B3: Fnn Irish isolate (red line), B4: Fnn Swedish isolate (green line), Fp isolates (B5: Fp from muskrat (orange line), B6: Fp from water (pink line), B7: Fp human (brown line) and B8: A. hydrophila (dark green line). C2: S. agalactiae (black line), C3: S. iniae (red line), C4: V. anguilarum (green line), C5: P. damselae (orange line), C6: E.coli (pink line), C7: Y. ruckeri (brown line), C8: Pseudomonas spp. (dark green line).

(TIF)

S3 Fig. PCR results for 156 tissue samples from tilapia and 5 water samples collected from UK and Thailand farms after electrophoresis on 1% agarose gel.

M: 100Pb DNA marker, S: spleen, K: Head kidney, UV: ultraviolet filter, B1: Bio-filter tank 1, B2: Bio-filter tank 2, T1: Fish tank 1, T2: Fish tank2, PC: Positive control (Fno gDNA), NTC: Negative control (Milli-Q water).

(TIF)

S1 Table. Results of testing diluted crude DNA preparations from fish tissues and water samples by qPCR.

(DOCX)

Acknowledgments

We would like to thank Dr. Kim Thompson (Aquatic Research Group, Moredun Research Institute, Edinburgh, UK), Professor Mansour El-Matbouli (Clinical Division of Fish Medicine, University of Veterinary Medicine, Vienna, Austria), Dr. Duncan Colquhoun (Section of Bacteriology, Norwegian Veterinary Institute, Oslo, Norway) for providing bacterial isolates used for the cross-detection studies. We would like also to thank Dr. Sean Monaghan (Institute of Aquaculture, University of Stirling) for proof reading this manuscript, Dr. Wanna Sirimanapong (Faculty of Veterinary Sciences, Mahidol University, Thailand), Dr. Andy Shinn (Fish Vet Group Asia Ltd, Thailand) and Dr. Matthis Metselaar (Benchmark Animal Health, UK) for their help in supplying and sampling the fish in Thailand.

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

This work was supported by the PhD research grant from the Egyptian Ministry of Higher Education and Scientific Research (Grant no. 1582014) and Benchmark Animal Health Ltd. (Grant no. 0306-064-2325290) to KS. The funding agencies have no role in the design of the study; collection, analysis and interpretation of data; writing the manuscript or submitting the article for publication.

References

  • 1.Soto E, Hawke JP. Francisella sp., an emergent pathogen of tilapia, Oreochromis niloticus in Costa Rica. J Fish Dis. 2009; 32: 713–722. doi: 10.1111/j.1365-2761.2009.01070.x [DOI] [PubMed] [Google Scholar]
  • 2.Jeffery KR, Stone D, Feist SW, Verner-Jeffreys DW. An outbreak of disease caused by Francisella sp. in Nile Tilapia Oreochromis niloticus at a recirculation fish farm in U.K. Dis Aquat Org. 2010; 91: 161–165. doi: 10.3354/dao02260 [DOI] [PubMed] [Google Scholar]
  • 3.Leal CAG, Tavares GC, Figueiredo HCP. Outbreaks and genetic diversity of Francisella noatunensis subsp. orientalis isolated from farm-raised Nile tilapia (Oreochromis niloticus) in Brazil. Genet Mol Res. 2014; 13: 5704–5712. doi: 10.4238/2014.July.25.26 [DOI] [PubMed] [Google Scholar]
  • 4.Nguyen V, Dong HT, Senapin S, Pirarat N, Rodkhum C. Francisella noatunensis subsp. orientalis, an emerging bacterial pathogen affecting cultured red tilapia (Oreochromis sp.) in Thailand. Aquacult Res. 2015; 1–6. doi: 10.1111/are.12802 [Google Scholar]
  • 5.Ortega C, Mancera G, Enriquez R, Vargas A, Martinez S, Fajardi R, et al. First identification of Francisella noatunensis subsp. orientalis causing mortality in Mexican tilapia Oreochromis spp. Dis Aquat Org. 2016; 120: 205–215. doi: 10.3354/dao02999 [DOI] [PubMed] [Google Scholar]
  • 6.Qiang L, Ningqiu L, Xiaozhe F, Qiandong H, Chang O, Lihui L, et al. An outbreak or granulomatous inflammation associated with Francisella noatunensis subsp. orientalis in farmed tilapia (Oreochromis niloticus x O. aureus) in China. Chin J Ocean and Limnol. 2015; 34: 460–466. doi: 10.1007/s00343-016-4311-2 [Google Scholar]
  • 7.Ostland VE, Stannard JA, Creek JJ. Aquatic Francisella-like bacterium associated with mortality of intensively cultured hybrid striped bass Morone chrysops x M. saxatilis. Dis Aquat Org. 2006; 72: 135–145. doi: 10.3354/dao072135 [DOI] [PubMed] [Google Scholar]
  • 8.Fukuda Y, Okamura A, Nishiyama M, Kawakami H, Kamaishi T, Yoshinaga T. Granulomatosis of cultured three-line grunt Parapristipoma trilineatum caused by an intracellular bacterium. Fish Pathol. 2002; 37: 119–124. doi: 10.3147/jsfp.37.119 [Google Scholar]
  • 9.Camus AC, Dill JA, McDermott AJ, Clauss TM, Berliner AL, Boylan SM, et al. Francisella noatunensis subsp. orientalis infection in Indo-Pacific reef fish entering the United States through the ornamental fish trade. J Fish Dis. 2013; 36: 681–684. doi: 10.1111/jfd.12071 [DOI] [PubMed] [Google Scholar]
  • 10.Lewisch E, Dressler A, Menanteau-Ledouble S, Saleh M, El-Matbouli M. Francisellosis in ornamental African cichlids in Austria. Bull Eur Ass Fish Pathol. 2014; 34: 63–70. [Google Scholar]
  • 11.Nylund A, Ottem KF, Watanabe K, Karlsbakk E, Krossøy B. Francisella Sp. (Family Francisellacea) causing mortality in Norwegian Cod Gadus Morhua L. farming. Arch Microbiol. 2006; 185: 383–392. doi: 10.1007/s00203-006-0109-5 [DOI] [PubMed] [Google Scholar]
  • 12.Olsen AB, Mikalsen J, Rode M, Alfjorden A, Hoel E, Straum-Lie K, et al. A novel Systematic granulomatous inflammatory disease in farmed Atlantic cod, Gadus Morhua L., associated with a bacterium belonging to the genus Francisella. J Fish Dis. 2006; 29: 307–311. doi: 10.1111/j.1365-2761.2006.00714.x [DOI] [PubMed] [Google Scholar]
  • 13.Birkbeck TH, Feist SW, Verner-Jeffreys DW. Francisella infection in fish and shellfish. J Fish Dis. 2011; 34:173–178. doi: 10.1111/j.1365-2761.2010.01226.x [DOI] [PubMed] [Google Scholar]
  • 14.Bohle H, Tapia E, Martinez A, Rozas M, Figueroa A, Bustos P. Francisella philomiragia, bacteria associated with high mortalities in Atlantic Salmon (Salmo Salar) cultured in cages in the lake Llanquihue. Arch Med Vet. 2009; 41: 237–244. doi: 10.4067/S0301-732X2009000300008 [Google Scholar]
  • 15.Ender PT, Dolan MJ. Pneumonia associated with near-drowning. Clin. Infect. Dis., 1997; 25: 896–907. [DOI] [PubMed] [Google Scholar]
  • 16.Berrada ZL, Telford SR. Diversity of Francisella species in environmental samples from Martha’s Vineyard, Massachusetts. Microb. Ecol. 2010; 59: 277–283. doi: 10.1007/s00248-009-9568-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Cora MC, Neel JA, Tarigo J, Post K, Barnes J. Francisella philomiragia septicaemia in a dog. J. Vet. Intern. Med., 2010; 24, 969–972. doi: 10.1111/j.1939-1676.2010.0545.x [DOI] [PubMed] [Google Scholar]
  • 18.Whitehouse CA, Kesterson KE, Duncan DD, Eshoo MW, Wolcott M. Identification and characterization of Francisella species from natural warm springs in Utah, USA. Lett. Appl. Microbiol. 2012; 54: 313–324. doi: 10.1111/j.1472-765X.2012.03214.x [DOI] [PubMed] [Google Scholar]
  • 19.Relich RF, Humphries RM, Mattison HR, Miles JE, Simpson ER, Corbett IJ, et al. Francisella philomiragia Bacteremia in a Patient with Acute Respiratory Insufficiency and Acute-on-Chronic Kidney Disease. J Clinical Microbiol, 2015; 12: 3947–3950. doi: 10.1128/JCM.01762-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Colquhoun DJ, Duodu S. Francisella infection in farmed and wild aquatic organisms. Vet Res. 2011; 42–47. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Soto E, Bowles K, Fernandez D, Hawke JP. Development of a real-time PCR assay for identification and quantification of the fish pathogen Francisella noatunensis subsp. orientalis. Dis Aquat Org. 2010; 89: 199–207. doi: 10.3354/dao02204 [DOI] [PubMed] [Google Scholar]
  • 22.Duodu S, Larsson P, Sjödin A, Soto E, Forsman M, Colquhoun DJ. Real-time PCR assays targeting unique DNA sequences of fish-pathogenic Francisella noatunensis subspecies noatunensis and orientalis. Dis Aquat Org. 2012; 101: 225–234. doi: 10.3354/dao02514 [DOI] [PubMed] [Google Scholar]
  • 23.Assis G, Oliveira T, Gardner I, Figueiredo H, Leal C. Sensitivity and specificity of real-time PCR and bacteriological culture for francisellosis in farm-raised Nile tilapia (Oreochromis niloticus L.). J Fish Dis. 2016; doi: 10.1111/jfd.12559 [DOI] [PubMed] [Google Scholar]
  • 24.Fujita O, Tatsumi M, Tanabayashi K, Yamada A. Development of a real time PCR assay for detection and quantification of Francisella tularensis. Jpn J Infect Dis. 2006; 59: 46–51 [PubMed] [Google Scholar]
  • 25.Soto E, Illanes O, Hilchie D, Morales JA, Sunyakumthorn P, Hawke JP, et al. Molecular and immunohistochemical diagnosis of Francisella noatunensis subsp. orientalis from formalin-fixed, paraffin-embedded tissues. J Vet Diagn Invest. 2012; 24: 840–845. doi: 10.1177/1040638712452108 [DOI] [PubMed] [Google Scholar]
  • 26.Ottem KF, Nylund A, Isaksen T E, Karlsbakk E, Bergh Ø. Occurrence of Francisella piscicida in farmed and wild Atlantic cod Gadus Morhua, L. in Norway. J Fish Dis. 2008; 31: 525–534. doi: 10.1111/j.1365-2761.2008.00930.x [DOI] [PubMed] [Google Scholar]
  • 27.Hsieh CY, Tung MC, Tu C, Chang CD, Tsai SS. Enzootics of visceral granulomas associated with Francisella-like organism infection in tilapia (Oreochromis spp.). Aquaculture, 2006; 254: 129–138. doi: 10.1016/j.aquaculture.2006.03.044 [Google Scholar]
  • 28.Soto E, Hawke JP, Fernandez D, Morales JA. Francisella sp., an emerging pathogen of tilapia, Oreochromis niloticus (L.) in Costa Rica. J Fish Dis. 2009; 32: 713–22. doi: 10.1111/j.1365-2761.2009.01070.x [DOI] [PubMed] [Google Scholar]
  • 29.Ramirez-Paredes JG, Thompson KD, Metselaar M, Shahin K, Soto E, Richard RH, et al. A polyphasic approach for phenotypic and genetic characterisation of the fastidious aquatic pathogen Francisella noatunensis subsp. orientalis. Front. Microbiol. 2017. doi: 10.3389/fmicb.2017.02324 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Rodrigues MV, David GS, Francisco Cj, Da Silva RJ, Falcone-Dias MF, Junior JPA. Monitoring of Francisella noatunensis subsp. orientalis in farmed Nile tilapia (Oreochromis niloticus) in Brazil. Aquat Int. 2017. doi: 10.1007/s10499-017-0204-4 [Google Scholar]
  • 31.Sebastião FA, Pilarski F, Kearney MT, Soto E. Molecular detection of Francisella noatunensis subsp. orientalis in cultured Nile tilapia (Oreochromis niloticus L.) in three Brazilian states. J Fish Dis. 2016. doi: 10.1111/jfd.12636 [DOI] [PubMed] [Google Scholar]
  • 32.Dong HT, Gangnonngiw W, Phiwsaiya K, Charoensapsri W, Nguyen V, Nilsen P, et al. Duplex PCR assay and in situ hybridization for detection of Francisella spp. and Francisella noatunensis subsp. orientalis in red tilapia. Dis Aquat Org. 2016; 120: 39–74. doi: 10.3354/dao03021 [DOI] [PubMed] [Google Scholar]
  • 33.Pradeep PJ, Suebsing R, Sirithammajak RS, Kampeera J, Turner W, Jeffs A, et al. Vertical transmission and concurrent infection of multiple bacterial pathogens in naturally infected red tilapia (Oreochromis spp.). Aquacult Res. 2016; 1–12. doi: 10.1111/are.13102 [Google Scholar]
  • 34.Hall AT, Zovanyi AM, Christensen DR, Koehler JW, Minogue TD. Evaluation of Inhibitor-Resistant Real-Time PCR Methods for Diagnostics in Clinical and Environmental Samples. PLoS One. 2013; 8: e73845 doi: 10.1371/journal.pone.0073845 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Rodrigues RA, Thie L, Gibbons CD, Sobsey MD. Reducing the effects of environmental inhibition in quantitative real-time PCR detection of adenovirus and norovirus in recreational seawaters. J Virol Meth. 2012; 181: 43–50. doi: 10.1016/j.jviromet.2012.01.009 [DOI] [PubMed] [Google Scholar]
  • 36.Daher RK, Stewart G, Boissiont M, Bergeron MG. Recombinase Polymerase Amplification for diagnostic applications. Clin Chem. 2016; 62:7 doi: 10.1373/245829 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Faye O, Faye O, Soropogui B, Patel P, Abd El wahed A, Loucoubar C et al. Development and deployment of a rapid recombinase polymerase amplification Ebola virus detection assay in Guinea in 2015. Euro Surveill. 2015; 20 (44): pii = 30053. doi: 10.2807/1560-7917.ES.2015.20.44.30053 [DOI] [PubMed] [Google Scholar]
  • 38.Abd El Wahed A, Sanabani SS, Faye O, Pessôa R, Patriota JV, Giorgi RR, et al. Rapid molecular detection of Zika virus in acute phase urine samples using Recombinase Polymerase Amplification Assay. PLoS Curr. 2017; 1: doi: 10.1371/a7f1db2c7d66c3fc0 ea0a774305d319e [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Moore MD, Jaykus LA. Development of a Recombinase Polymerase Amplification Assay for Detection of Epidemic Human Noroviruses. Sci. Repo. 2017; 7: 40244 doi: 10.1038/srep40244 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Piepenburg O, Williams CH, Armes NA. DNA detection using recombination proteins. PLoS Biol. 2006; 4: e204 doi: 10.1371/journal.pbio.0040204 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Euler M, Wang YJ, Otto P, Tomaso H, Escudero R, Anda P, et al. Recombinase Polymerase Amplification Assay for rapid detection of Francisella tularensis. J Clin Microbiol. 2012; 50: 2234–2238. doi: 10.1128/JCM.06504-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Euler M, Wang Y, Heidenreich D, Patel P, Strohmeier O, Hakenberg S, et al. Development of a Panel of Recombinase Polymerase Amplification Assays for Detection of Biothreat Agents. J Clin Microbiol. 2013; 51: 1110–7. doi: 10.1128/JCM.02704-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Krolov K, Frolova J, Tudoran O, Suhorutsenko J, Lehto T, Sibul H, et al. Sensitive and rapid detection of Chlamydia trachomatis by recombinase polymerase amplification directly from urine samples. J Mol Diagn. 2014; 16: 127–35. doi: 10.1016/j.jmoldx.2013.08.003 [DOI] [PubMed] [Google Scholar]
  • 44.Kersting S, Rausch V, Bier FF, von Nickisch-Rosenegk M. Rapid detection of Plasmodium falciparum with isothermal recombinase polymerase amplification and lateral flow analysis. Malar J. 2014; 13:99 doi: 10.1186/1475-2875-13-99 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Qinglin M, Liu H, Ye F, Xiang G, Shan W, Xing W. Rapid and visual detection of Mycobacterium tuberculosis complex using recombinase polymerase amplification combined with lateral flow strips. Mol Cell probe. 2017. Article in Press. [DOI] [PubMed] [Google Scholar]
  • 46.Euler M, Wang YJ, Nentwich O, Piepenburg O, Hufert FT, Weidmann M. Recombinase Polymerase Amplification Assay for rapid detection of Rift Valley Fever virus. J Clin Virol. 2012; 54: 308–12. doi: 10.1016/j.jcv.2012.05.006 [DOI] [PubMed] [Google Scholar]
  • 47.Abd El Wahed A, El-Deeb A, El-Tholoth M, Abd El Kader H, Ahmed A, Hassan S, et al. A portable reverse transcription recombinase polymerase amplification assay for rapid detection of foo-and-mouth disease virus. PLoS One. 2013; 8: e71642 doi: 10.1371/journal.pone.0071642 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Aebischer A, Wernike K, Hoffmann B, Beer M. Rapid genome detection of Schmallenberg virus and bovine viral diarrhoea by use isothermal amplification methods and high-speed real time reverse transcriptase PCR. J Clin Microbiol. 2014; 52: 1883–92. doi: 10.1128/JCM.00167-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Abd El Wahed A, Weidmann M, Hufert FT. Diagnostics-in-a-suitcase: development of a portable and rapid assay for the detection of the emerging avian influenza A (H7N9) virus. J Clin Virol. 2015; 69: 16–21. doi: 10.1016/j.jcv.2015.05.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Shalaby MA, El-Deeb A, El-Tholoth, Hoffmann D, Czerny CP, Hufert FT, et al. Recombinase polymerase amplification assay for rapid detection of lumpy skin disease virus. BMC Vet Res. 2016; 12: 244 doi: 10.1186/s12917-016-0875-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Wang J, Liu L, Wang J, Sun X, Yuan W. Recombinase Polymerase Amplification Assay- a simple, fast and cost-effective alternative to real time PCR for specific detection of Feline Herpesvirus-1. PLoS One. 2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Yang Y, Qin X, Zhang X, Zhao Z, Zhang W, Zhu X, et al. Development of real-time and lateral flow dipstick recombinase polymerase amplification assays for rapid detection of goat-pox virus and sheep-pox virus. Virol. J. 2017; 14: 131 doi: 10.1186/s12985-017-0792-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Yang Y, Qin X, Song Y, Zhang W, Hu G, Dou Y, et al. Development of real-time and lateral flow strip reverse transcription recombinase polymerase Amplification assays for rapid detection of peste des petits ruminants virus. Virol. J. 2017; 14–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Mekuria TA, Zhang S, Eastwell KC. Rapid and sensitive detection of little cherry virus-2 using isothermal reverse transcription-recombinase polymerase amplification. J Virol Meth. 2014; 205 C: 24–30. doi: 10.1016/j.jviromet.2014.04.015 [DOI] [PubMed] [Google Scholar]
  • 55.Zhang S, Ravelonandro M, Russel P, McOwen N, Briard P, Bohannon S, et al. Rapid diagnostic detection of plum pox virus in Prunus plants by isothermal Ampli-fyRP® using reverse transcription-recombinase polymerase amplification. J Virol Meth. 2014; 207C: 114–20. doi: 10.1016/j.jviromet.2014.06.026 [DOI] [PubMed] [Google Scholar]
  • 56.Jaroenram W, Owens L. Recombinase polymerase amplification combined with a lateral flow dipstick for discriminating between infectious Penaeus stylirostris densovirus and virus-related sequences in shrimp genome. J Virol Meth. 2014; 208: 144–51. doi: 10.1016/j.jviromet.2014.08.006 [DOI] [PubMed] [Google Scholar]
  • 57.Xia X, Yu Y, Weidmann M, Pan Y, Yan S, Wang Y. Rapid detection of shrimp white spot syndrome virus by real time, isothermal recombinase polymerase amplification assay. PLoS One. 2014; 9: e104667 doi: 10.1371/journal.pone.0104667 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Xia X, Yu Y, Weidmann M, Pan Y, Yan S, Wang Y. Rapid detection of infectious hypodermal and hematopoietic necrosis virus (IHHNV) by real-time, isothermal recombinase polymerase amplification assay. Arch Virol. 2015; 160: 987–94. doi: 10.1007/s00705-015-2357-7 [DOI] [PubMed] [Google Scholar]
  • 59.Prescot MA, Reed AN, Jin L, Pastey MK. Rapid detection of Cyprinid Herpesvirus-3 in latently infected Koi by Recombinase Polymerase Amplification. J Aquat Anim Health. 2016; 28: 173–180. doi: 10.1080/08997659.2016.1185048 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Gao F, Jianga ZJ, Wanga JY, Weia HY. Real-time isothermal detection of Abalone herpes-like virus and red-spotted grouper nervous necrosis virus using recombinase polymerase amplification. J. Virol. Methods. 2017; 251; 92–98. doi: 10.1016/j.jviromet.2017.09.024 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Renshaw MA, Olds BP, Jerde CL, Mcveigh MM, Lodge DM. The room temperature preservation of filtered environmental DNA samples and assimilation into a phenol–chloroform–isoamyl alcohol DNA extraction. Mol. Ecol. Resour. 2015; 15: 168–176. doi: 10.1111/1755-0998.12281 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Forsman M, Sandstrom G, Sjostedt A. Analysis of 16S ribosomal DNA sequences of Francisella strains and utilization for determination of the phylogeny of the genus and for identification of strains by PCR. Int J Sys Bacteriol. 1994; 44: 38–46. doi: 10.1099/00207713-44-1-38 [DOI] [PubMed] [Google Scholar]
  • 63.TwistDx L. Available from: http://twistdx.co.uk/images/uploads/docs/Appendix.pdf
  • 64.Sjodin A, Svensson K, Ohrman C, Ahlinder J, Lindgren P, Duodu S, et al. Genome characterisation of the genus Francisella reveals insights into similar evolutionary paths in pathogens of mammals and fish. BMS Genomics, 2012; 13:268 doi: 10.1186/1471-2164-13-268 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Gonçalves LA., Soares SDC, Pereira FL, Dorella FA, Carvalho De, Magno G, et al. Complete genome sequences of Francisella noatunensis subsp orientalis strains FNO12, FNO24 and FNO 190: a fish pathogen with genomic clonal behaviour. Stand. Genomic Sci. 2016; 1–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Ramírez-paredes JG, Larsson P, Wehner S, Thompson KD, Richards H, Penman J, et al. Cross Draft Genome Sequence of Francisella F2f7, a Highly Virulent Strain Recovered from Diseased Red Nile Tilapia Farmed in Europe. Genome Announc. 2017; 5:e01555–16. doi: 10.1128/genomeA.01555-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Johnson SL, Daligault HE, Davenport KW, Coyne SR, Frey KG, Koroleva GI, et al. Genome Sequencing of 18 Francisella Strains To Aid in Assay Development and Testing. Genome Announc. 2015; 3 (2). doi: 10.1128/genomeA.00147-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Medicalc®: Diagnostic Test Evaluation Calculator. Available from: https://www.medcalc.org/calc/diagnostic_test.php.
  • 69.Chen SC, Tung MC, Chen SP, Tsai JF, Wang PC, Chen RS, et al. Systematic granulomas caused by a rickettsia-like organism in Nile tilapia, Oreochromis niloticus (L.), from southern Taiwan. J Fish Dis. 1994; 17: 591–599. doi: 10.1111/j.1365-2761.1994.tb00257.x [Google Scholar]
  • 70.Chern RS, Chao CB. Outbreak of a disease caused by rickettsia-like organism in cultured tilapias in Taiwan. J Fish Pathol. 1994; 29: 61–71. doi: 10.3147/jsfp.29.61 [Google Scholar]
  • 71.Ottem KF, Nylund A, Karlsbakk E, Friis-Møller A, Kamaishi T. Elevation of Francisella philomiragia subsp. noatunensis Mikalsen et al. (2007) to Francisella noatunensis comb. nov. [syn. Francisella piscicida Ottem et al. (2008) syn. nov.] and characterization of Francisella noatunensis subsp. orientalis subsp. nov., two important fish pathogens. J Appl Microbiol. 2009; 4: 1231–43. doi: 10.1111/j.1365-2672.2008.04092.x [DOI] [PubMed] [Google Scholar]
  • 72.Newton CR, Graham A, Heptinstall LE, Powell SJ, Summers C, Kalsheker N, et al. Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Res. 1989; 17: 2503–2516. PMCID: PMC317639. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Axxin. Available from: http://www.axxin.com/Molecular-T8.php
  • 74.Optigene. Available from: http://www.optigene.co.uk/instruments/instrument-genie-iii/
  • 75.Daher RK, Stewart G, Boissinot M, Bergeron MG. Isothermal recombinase polymerase amplification assay applied to the detection of group B streptococci in vaginal/anal samples. Clin Chem. 2014; 60: 660–6. doi: 10.1373/clinchem.2013.213504 [DOI] [PubMed] [Google Scholar]
  • 76.Bonney LC, Watson RJ, Afrough B, Mullojonova M, Dzhuraeva V, Tishkova F, et al. A recombinase polymerase amplification assay for rapid detection of Crimean-Congo Haemorrhagic Fever Virus infection. PLOS Negl. Trop. Dis.2017. doi: 10.1371/journal.pntd.0006013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Xing W, Yu X, Feng J, Sun K, Fu W, Wang Y et al. Field evaluation of a recombinase polymerase amplification assay for the diagnosis of Schistosoma japonicum infection in Hunan province of China. BMC Infect Dis. 2017; 17:164 doi: 10.1186/s12879-017-2182-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Pereira JC, Chaves R, Bastos E, Leitão A, Guedes-Pinto H. An efficient method for genomic DNA extraction from different molluscs species. Int J Mol Sci. 2011; 12 (11):8086–95. doi: 10.3390/ijms12118086 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Shipley MA, Koehler JW, Kulesh DA, Minogue TD. Comparison of nucleic acid extraction platforms for detection of select biothreat agents for use in clinical resource limited settings. J Microbiol Meth. 2012; 91(1):179–83. doi: 10.1016/j.mimet.2012.06.008 [DOI] [PubMed] [Google Scholar]
  • 80.Guimin Z, Hongmei W, Pilli H, Chengqiang H, Hongbin H. Rapid and visual detection of Mycobacterium avium subsp. paratuberculosis by recombinase polymerase amplification combined with a lateral flow dipstick. J Vet Sci. 2017. [Epub ahead of print]. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Hou P, Zhao G, Wang H, He C, Huan Y, He H. Development of a recombinase polymerase amplification combined with lateral-flow dipstick assay for detection of bovine ephemeral fever virus. Mol Cell Probes. 2017. doi: 10.1016/j.mcp.2017.12.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Tu P, Shiu JS, Lee SH, Pang VF, Wang DC, Wang PH. Development of a recombinase polymerase amplification lateral flow dipstick (RPA-LFD) for the field diagnosis of caprine arthritis-encephalitis virus (CAEV) infection. J Virol Methods. 2017; 243: 98–104. doi: 10.1016/j.jviromet.2017.01.023 Epub 2017 [DOI] [PubMed] [Google Scholar]
  • 83.Santiago-Felipe S, Tortajada-Genaro LA, Puchades R, Maquieira A. Recombinase polymerase and enzyme-linked immunosorbent assay as a DNA amplification-detection strategy for food analysis. Anal chim acta. 2014; 811: 81–7. doi: 10.1016/j.aca.2013.12.017 [DOI] [PubMed] [Google Scholar]
  • 84.Loo JF, Lau PM, Ho HP, Kong SH. An aptamer-based bio-barcode assay with isothermal recombinase polymerase amplification for cytochrome-c detection and anti-cancer drug screening. Talanta. 2013; 115: 159–165. doi: 10.1016/j.talanta.2013.04.051 [DOI] [PubMed] [Google Scholar]
  • 85.Kersting S, Rausch V, Bier FF, von Nickisch-Rosenegk M. Multiplex isothermal solid-phase recombinase polymerase amplification for the specific and fast DNA based detection of three bacterial pathogens. Mikrochim acta, 2014; 181: 1715–1723. doi: 10.1007/s00604-014-1198-5 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Fno standard plasmid map.

(TIF)

S2 Fig. Analytical specificity of the Fno RPA.

Positive amplification only with Fno isolates [A], while negative results were obtained with Fnn, Fp and non-Francisella isolates [B and C]. A1 (violet line), B1 (Blue line) and C1 (blue line): Positive control, A2: Negative control (dark green line), A3: A8: Fno isolates (A3: Fno UK isolate (black line), A4: Fno Costa Rican isolate (red line), A5: Fno Japanese isolate (green line), A6: Fno Austrian isolate (orange line), A7: Fno Mexican isolate (pink line), A8: Fno Central American isolate (brown line), B2: B7: Fnn isolates (B2: Fnn Norwegian isolate (black line), B3: Fnn Irish isolate (red line), B4: Fnn Swedish isolate (green line), Fp isolates (B5: Fp from muskrat (orange line), B6: Fp from water (pink line), B7: Fp human (brown line) and B8: A. hydrophila (dark green line). C2: S. agalactiae (black line), C3: S. iniae (red line), C4: V. anguilarum (green line), C5: P. damselae (orange line), C6: E.coli (pink line), C7: Y. ruckeri (brown line), C8: Pseudomonas spp. (dark green line).

(TIF)

S3 Fig. PCR results for 156 tissue samples from tilapia and 5 water samples collected from UK and Thailand farms after electrophoresis on 1% agarose gel.

M: 100Pb DNA marker, S: spleen, K: Head kidney, UV: ultraviolet filter, B1: Bio-filter tank 1, B2: Bio-filter tank 2, T1: Fish tank 1, T2: Fish tank2, PC: Positive control (Fno gDNA), NTC: Negative control (Milli-Q water).

(TIF)

S1 Table. Results of testing diluted crude DNA preparations from fish tissues and water samples by qPCR.

(DOCX)

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES