CerR, a Single-Domain Regulatory Protein of the LuxR Family, Promotes Cerecidin Production and Immunity in Bacillus cereus

ABSTRACT

Cerecidins are small lantibiotics from Bacillus cereus that were obtained using a semi-in vitro biosynthesis strategy and showed prominent antimicrobial activities against certain Gram-positive bacteria. However, the parental strain B. cereus As 1.1846 is incapable of producing cerecidins, most probably due to the transcriptional repression of the cerecidin gene cluster. Located in the cerecidin gene cluster, cerR encodes a putative response regulator protein that belongs to the LuxR family transcriptional regulators. CerR (84 amino acids) contains only a conserved DNA binding domain and lacks a conventional phosphorylation domain, which is rarely found in lantibiotic gene clusters. To investigate its function in cerecidin biosynthesis, cerR was constitutively expressed in B. cereus As 1.1846. Surprisingly, Constitutive expression of cerR enabled the production of cerecidins and enhanced self-immunity of B. cereus toward cerecidins. Reverse transcription-PCR analysis and electrophoresis mobility shift assays indicated, respectively, that the cer cluster was transcribed in two transcripts (cerAM and cerRTPFE) and that CerR regulated the cerecidin gene cluster directly by binding to the two predicted promoter regions of cerA and cerR. DNase I footprinting experiments further confirmed that CerR specifically bound to the two promoter regions at a conserved inverted repeat sequence that was designated a CerR binding motif (cerR box). The present study demonstrated that CerR, as the first single-domain LuxR family transcriptional regulator, serves as a transcriptional activator in cerecidin biosynthesis and activates the cerecidin gene cluster, which was otherwise cryptic in B. cereus.

IMPORTANCE Lantibiotics with intriguing and prominent bioactivities are potential peptide antibiotics that could be applied in many areas, including food and pharmaceutical industries. The biosynthesis of lantibiotics is generally controlled by two-component regulatory systems consisting of histidine kinases and response regulators, while some unique and interesting regulatory systems are also revealed with the ever-increasing discovery of lantibiotic gene clusters among diverse microorganisms. Dissection of diverse lantibiotic regulation machineries would permit deep understanding of the biological functions of lantibiotics in different niches and even enable genetic activation of lantibiotic gene clusters that are otherwise cryptic. The significance of our study is to illuminate the regulatory mechanism of a special single-domain protein, CerR, in regulating cerecidin biosynthesis in Bacillus cereus, providing a possible novel approach to activate cryptic lantibiotic clusters.

INTRODUCTION

Lanthipeptides are a class of ribosomally synthesized and posttranslationally modified peptides (RiPPs) produced by a wide range of Gram-positive bacteria. Most of them, known as lantibiotics, are of particular interest because of their antibiotic activities against Gram-positive bacteria, including some pathogenic bacteria (1). Lantibiotics contain characteristic lanthionine and/or methyl lanthionine bridges, which make them proteolytically resistant, structurally rigid, and target specific (2, 3). Lantibiotics are gene-encoded antibiotic peptides, and their biosynthetic genes are assembled in gene clusters. The precursor peptides with N-terminal leader peptides and C-terminal core peptides are encoded by precursor genes (generically named lanA). The precursor peptides undergo posttranslational modifications, including first dehydration and subsequent thioether-forming reactions in the core peptides catalyzed by LanB/C or LanM. The modified precursor peptides are exported outside the cell through an ABC transporter (LanT), while the leader peptides are cleaved by the protease domain of LanT during transport and/or the peptidase LanP after export (4). The immunity proteins that protect the producer strains against lantibiotics can be orphan lipoproteins (termed the LanI proteins) and/or immunity protein complexes, generically termed LanEF(G) (5, 6).

In most cases, the production of and immunity to lantibiotics, such as nisin (7), subtilin (8), bovicin HJ50 (9, 10), pneumolancidin (11), and suicin (12), are autoregulated by a typical two-component regulation system that consists of a receptor histidine kinase (LanK) and its cognate transcriptional response regulator (LanR). Briefly, upon autoinduction, the histidine kinase LanK is autophosphorylated, and then the phosphoryl group is transferred to the response regulator (LanR). Thereafter, the phosphorylated LanR binds to the promoters of the biosynthetic genes to initiate the production of lantibiotics (4). However, in certain cases, orphan regulatory proteins such as EpiQ, MrsR1, MutR, LasX, RamR, and LtnR are involved in regulation of lantibiotic biosynthesis (13). All these single regulatory proteins except LtnR consist of two functional domains, including a receiver domain and a DNA binding domain (14–18). LtnR possesses only a functional DNA binding domain and regulates the immunity genes but not the biosynthetic genes in lacticin 3147 producers (19). In fact, this kind of single-domain regulatory protein responsible for lantibiotic biosynthesis is rarely reported, and its detailed function mechanism is unclear.

Cerecidins, including cerecidin A1 and A7, are class II lantibiotics from Bacillus cereus As 1.1846 that are obtained using a semi-in vitro biosynthesis strategy (20). They exert antimicrobial activity against a broad spectrum of Gram-positive bacteria and exhibit high efficacy against some drug-resistant pathogens, implying potential applications as peptide antibiotics in food preservation or pharmaceuticals (1). The 15.7-kb biosynthetic gene cluster of cerecidins consists of 13 genes, i.e., cerA1 to -A7, -M, -R, -T, -P, -F, and -E, and the cluster is disrupted by the quorum-sensing genes comQXPA. The gene cluster possesses seven tandem precursor genes encoding precursor peptides corresponding to either cerecidin A1 or A7. Cerecidin was not detected in B. cereus As 1.1846, which was most probably due to the transcriptional repression of biosynthetic genes, especially cerM (20). Interestingly, an orphan regulator gene cerR encodes an 84-amino-acid (aa) protein that is predicted to be a LuxR family regulator. Sequence analysis indicates that CerR is a rare single-domain protein that contains only a helix-turn-helix (HTH)-LuxR DNA binding domain. This indicated that CerR might be an orphan regulator associated with regulation of cerecidin biosynthesis.

Here, to elucidate the relationship between CerR and cerecidin biosynthesis, we investigated the in vitro DNA binding activities and in vivo regulation activities of CerR. Especially, biosynthesis of active cerecidins was obtained by constitutive expression of cerR in B. cereus As 1.1846, demonstrating that CerR serves as a transcriptional activator for cerecidin biosynthesis. This work reveals the function of a single-domain regulator, CerR. In addition, we provide a way to activate the expression of a cryptic lantibiotic gene cluster and determine the molecular mechanism of this kind of single-domain regulator in activating gene expression.

RESULTS

Constitutive expression of cerR results in successful production of cerecidin.

Cerecidin production in B. cereus As 1.1846 was not detected in our previous study (Fig. 1A), which was thought to be caused by the undetectable transcription of the modification gene cerM. When cerM was constitutively expressed, cerecidin was produced, albeit at a low titer (20). cerR, located in the cerecidin gene cluster (accession number KJ000001) in B. cereus As 1.1846, was predicted to encode a putative LuxR family transcriptional regulatory protein and contained a single LuxR_C-like domain (see Fig. S1A in the supplemental material). It was speculated that CerR might participate in the production of cerecidin. As cerecidin was not detected in B. cereus As 1.1846, we thought that CerR might act as a repressor of cerecidin production. To examine whether CerR inhibits cerecidin biosynthesis, a cerR disruption mutant (strain BceΔR) was constructed via double-crossover recombination. However, cerecidin production was not detected in BceΔR (data not shown). We then tried to express CerR under the control of the constitutive promoter P_aprN in the wild type (WT; strain BceR). The culture supernatant was collected from the cell culture in the stationary phase and used in an antimicrobial assay against the sensitive indicator strain Micrococcus luteus NCIB 8166. Surprisingly, M. luteus NCIB 8166 was inhibited by the culture supernatant. Further mass spectrometry (MS) analysis confirmed the presence of cerecidin A1 and/or A2 to A6 with a [M + H]⁺ of 1,988.17 Da, which corresponded to the molecular mass of mature cerecidin A1 (Fig. 1B). In addition, cerecidin A1 and/or A2 to A6 were also detected in BceΔR complemented with P_aprN-cerR (strain BceΔR-R) (Fig. 1C). In order to examine whether cerR was essential for cerecidin biosynthesis, cerM was expressed in the WT strain and in strain BceΔR (yielding strains designated BceM and BceΔR-M, respectively). Constitutive expression of cerM in the WT strain resulted in production of cerecidin (Fig. 1D), whereas constitutive expression of cerM in strain BceΔR did not result in any production of cerecidins (Fig. 1E). These results suggest that CerR might activate the expression of the cerecidin biosynthetic gene cluster and is indispensable for cerecidin production.

FIG 1.

Antimicrobial activity and MS analysis of cerecidins extracted from culture medium of B. cereus As 1.1846 and its derivatives after 14 h of growth. (A) B. subtilis As 1.1846; (B) BceR; (C) BceΔR-R; (D) BceM; (E) BceΔR-M.

Analysis of cer locus transcripts.

To determine whether CerR regulates the expression of cerecidin biosynthetic genes (the organization of cerecidin biosynthetic genes is shown in Fig. 2A), the transcriptional units of the cer locus were analyzed. Total RNAs of the B. cereus As 1.1846 WT strain and strain BceR at the mid-log phase (8 h) were isolated and reverse transcribed to cDNA. Reverse transcription-PCR (RT-PCR) showed that cerAM and cerRT transcripts could not be detected in the WT strain but were present in BceR (Fig. 2B). Furthermore, the intergenic regions between cerP and -F as well as cerF and -E rendered PCR products of the expected sizes in both the WT strain and BceR (Fig. 2B). These results indicated that cerA and cerM on one hand and cerR, cerT, cerP, cerF, and cerE on the other hand are cotranscribed as separate transcriptional units and that the upstream sequences of the two units are predicted to contain promoter and operator sequences and regulate transcription of cerAM and cerR to -E (Fig. 2A). In addition, there is a putative promoter upstream of cerFE predicted by the program Softberry (Fig. 2A).

FIG 2.

Genetic organization of the cer cluster with predicted promoters and RT-PCR analysis of cer locus. (A) cer genes are indicated by differently colored arrows: the precursor genes cerA1 to -A7 are indicated by green arrows, the modification enzyme gene cerM in blue, the orphan regulator gene cerR in yellow, the protease and transporter genes cerT and cerP in purple, and the immunity genes cerF and cerE in dark red. The gray arrows indicate quorum-sensing component genes comQXPA. P_cerA is the predicted promoter of cerA, P_cerR is the predicted promoter of cerR, and P_cerF is the predicted promoter of cerF. (B) RT-PCR analysis of the cer locus. RNA was extracted from the WT strain and the BceR strain at 8 h after inoculation. RT-PCR amplification of 16S rRNA and intergenic regions between cerA and cerM, cerR and cerT, cerP and cerF, and cerF and cerE. M, molecular standard; G, positive controls with genomic DNA; S, cDNA from the RNA sample; CK, negative controls consisting of DNase I-treated RNA sample.

CerR binds specifically to the promoters of the cer locus.

To determine whether CerR modulates cerecidin production by binding to the promoters of each transcriptional unit, the recombinant CerR with a His₆ tag (His₆-CerR) (see Fig. S2A in the supplemental material) was expressed in and purified from Escherichia coli BL21(DE3). The activity of recombinant His₆-CerR was verified (Fig. S2B). Electrophoretic mobility shift assays (EMSAs) were conducted to detect the interaction between His₆-CerR and promoters of cerA, cerF, and cerR with poly(dI-dC) as competitive agents. Shift bands were observed upon incubation of increasing amounts of His₆-CerR with probes P_cerA and P_cerR (Fig. 3) but not P_cerF (results with P_cerF are not shown), indicating that His₆-CerR binds to the upstream regions of cerA and cerR in a concentration-dependent manner but does not bind to P_cerF. These results demonstrate that CerR regulates cerecidin biosynthesis by binding to the promoter sequences of cerA and cerR specifically. Specifically, the shift bands appeared at a CerR concentration of 50 nM for P_cerA, whereas the CerR concentration increased to 250 nM for P_cerR. Thus, CerR seems to have a higher affinity toward P_cerA than toward P_cerR.

FIG 3.

EMSA analysis of CerR with the promoter regions of cerA and cerR. Gradient concentrations of His₆-CerR were incubated with the promoter regions of P_cerA (upper panel) and P_cerR (lower panel). Each lane contained 20 ng of DNA probe and 1 μg poly(dI-dC).

To further characterize the specific CerR binding sequence, DNase I footprinting experiments with cerA and cerR promoters in the presence or absence of CerR were performed. As shown in Fig. 4A and B, CerR bound to the promoter regions of cerA and cerR to protect them from being degraded by DNase I. For P_cerA, the protected sequence was 26 nucleotides (nt) long terminal repeat and was located at nucleotide positions −100 to −75 with respect to the cerA start codon ATG (Fig. 4C). For P_cerR, the protected sequence was 30 bp long, spanning from position −257 to −299 relative to the cerR start codon (Fig. 4D).

FIG 4.

Binding site analysis of CerR on different target regions. (A and B) DNase I footprinting for determination of CerR binding sites on P_cerA (A) and P_cerR (B). Each line represents 200 ng DNA probes and corresponding gradient concentrations of His₆-CerR (0, 0.1, 0.5, and 1.0 μM). The traces indicate the signal strengths of different length of DNA sequences. The nucleotide sequences corresponding to the protected fragments are listed at the bottom. (C) The predicted binding site (site I) of CerR on P_cerA. (D) The predicted binding site (site II) of CerR on P_cerR. The translation start codons are marked by red, and the sequences protected by CerR are underlined and in bold italics.

The two binding sequences were further analyzed with the MEME program (21), and a highly conserved inverted repeat sequence that covered 10 bases [GSAA(TW)TTSC, where S = C or G and W = A or T] displayed dyad symmetry (Fig. 5A). These findings indicate that CerR specifically binds to the promoters of the cer locus at a conserved inverted repeat site. In order to validate the consensus binding site, site-directed mutagenesis of probes P_cerA and P_cerR was conducted on the sequence GSAA(TW)TTSC (S = C or G; W = A or T) to generate ATCG(TW)CGAT (W = A or T) (Fig. 5B), and the resulting probes were designated P_cerAm and P_cerRm, respectively. The binding of CerR to different probes was then tested by EMSAs. Compared to its binding to P_cerA and P_cerR, CerR showed almost no binding to P_cerAm and P_cerRm (Fig. 5C and D). These results validate the proposed CerR binding box within P_cerA and P_cerR.

FIG 5.

Identification and validation of CerR binding sites. (A) Sequence logo of the nucleotide sequences that constitute the CerR binding site, which was produced by the MEME program. The height of the letter is proportional to the frequency of the base, and the height of the letter stack shows the conservation in bits at that position. The conserved inverted repeats within binding sites are indicated by black arrows. (B) Site-directed mutagenesis of probes P_cerA and P_cerR. The inverted sequences of P_cerA and P_cerR were changed by site-directed mutagenesis to ATCG(TW)CGAT (W = A or T) and then designated P_cerAm and P_cerRm, respectively. (C) EMSA analysis of His₆-CerR with the promoters P_cerA and P_cerAm. (D) EMSA analysis of His₆-CerR with the promoters P_cerR and P_cerRm. Each lane contained 20 ng of DNA probes.

CerR promotes transcription of each gene in the cer operon.

To further verify whether CerR could bind to the promoter sequences of the cer locus to activate cerecidin biosynthesis, quantitative RT-PCR (qRT-PCR) was performed to evaluate the transcription of cerecidin biosynthetic genes. In strain BceΔR, the cerR gene in the genome was replaced by the crm (chloromycin resistance) gene, whose expression is controlled by P_cerR. Total RNAs were isolated at mid-logarithmic growth phase from BceΔR and BceΔR-R, and qRT-PCR was used to analyze the transcriptional profiles of the cer locus. Compared with those in BceΔR, the transcription levels of genes in the cer locus in strain BceΔR-R increased significantly (Fig. 6A). In detail, the transcript level of cerA increase nearly 680-fold, while the transcript level of cerM, also transcribed from the cerA promoter, increased nearly 88-fold. The relatively low transcript level of cerM in comparison to cerA may be attributed to the existence of an intragenic stem-loop between cerA and cerM which may somewhat repress cerM transcription (Fig. 6B). This putative transcriptional attenuator might allow limited readthrough to the downstream cerM. The transcript level of cerR significantly increased under the control of a strong promoter P_aprN. The high expression of CerR significantly promoted the transcription of downstream genes, including crm, cerT, and cerP as well as the immunity genes cerF and cerE, compared to that in BceΔR (Fig. 6A). Taken together, these results demonstrated that CerR acts as an activator and promotes the transcription of cerecidin biosynthetic genes. In addition, the transcript level of crm in BceΔR-R was higher than that in BceΔR, and the EMSA also indicated that CerR was capable of binding to its own promoter (Fig. 6), suggesting that CerR is an autoactivator able to bind to its own promoter. Furthermore, the transcript level of cerA was higher than that of crm, which was in line with higher affinity of CerR toward P_cerA than toward P_cerR in vitro in EMSA.

FIG 6.

Transcriptional analysis of cerecidin biosynthetic genes by qRT-PCR. (A) Error bars represent standard errors, and the asterisks above data bars indicate a significant difference between BceΔR and BceΔR-R (*, P < 0.05; **, P < 0.01). (B) Stem-loop structure of the intergenic region between cerA7 and cerM. Its secondary structure was predicted by the DNAMAN program.

Constitutive expression of cerR enhances the immunity of B. cereus As 1.1846 to cerecidins A1 and A7.

The qRT-PCR showed that constitutive expression of cerR increased the transcription level of immunity genes cerFE (Fig. 6A). The resistance of the WT strain and strain BceR to cerecidins A1 and A7 was tested. Gradient concentrations (1 to 8 or 18 μg/ml) of cerecidins were added to the fresh cell cultures, and the cell densities were measured. Cerecidin A1 at up to 18 μg/ml did not affect the growth of BceR, but it started inhibiting growth of the WTp strain (WT strain with an empty vector) at 4 μg/ml (Fig. 7A). The two strains were much more sensitive to cerecidin A7. Growth of WTp and BceR was completely inhibited by 4 μg/ml and 8 μg/ml cerecidinA7, respectively (Fig. 7B). The lower resistance to cerecidin A7 is most likely due to the higher antimicrobial activity of cerecidin A7 than of cerecidin A1 (20). These results indicate that B. cereus As 1.1846 harboring pHY-P_aprN-cerR exhibits greater immunity to cerecidins than the WTp strain. Taken together, these findings strongly suggest that CerR enhances the immunity of B. cereus As 1.1846 by enhancing the expression of immunity genes.

FIG 7.

Growth profiles of WTp and BceR in LB medium containing different concentrations of cerecidins A1 (A) and A7 (B). Error bars represent standard errors.

Possible regulators ComA and SigH have no effect on production of cerecidins in B. cereus As 1.1846.

In order to detect whether there are other regulators involved in regulating the biosynthesis of cerecidins, two possible regulators, the competence factor ComA and the sigma factor SigH, were investigated. The competence quorum-sensing system genes comQXPA were located between cerM and cerR, and ComA was predicted to be a regulator. EMSAs were conducted to check the binding of CerR to P_comP and of ComA to P_cerA and P_cerR. The results show that CerR and ComA cannot bind to each other's promoters and demonstrate that ComA might not be involved in cerecidin production (see Fig. S3A to C in the supplemental material). Further, we analyzed the nucleotide sequence of cerR, and no motif was found to be likely to bind other regulator. In addition, in Bacillus subtilis ATCC 6633, subtilin production is also regulated by the sigma factor SigH (22). In order to check whether SigH is involved in cerecidin production, sigH was constitutively expressed in B. cereus As 1.1846 (strain BceH), and the results show that the production of cerecidin could not be detected (Fig. S3D). Taking the data together, we speculate that the competence quorum-sensing system and sigma factor may not influence the production of cerecidin.

DISCUSSION

Most of the reported orphan response regulators controlling lantibiotic biosynthesis are composed of both an N-terminal signal receiver domain and a C-terminal DNA binding domain (4). Interestingly, even though the orphan regulator CerR encoded in the cerecidin gene cluster lacks a receiver domain, it is responsible for activating the cer genes and promotes the synthesis of cerecidins. The other reported single-domain lantibiotic regulator is LtnR, which is involved in regulation of immunity genes related to lantibiotic lacticin 3147 biosynthesis and its own transcription (19). In contrast to CerR, though, LtnR is a transcriptional repressor of the PBSX (Xre) family, and the DNA binding motif for LtnR has not been reported (6). Here, we experimentally validated that CerR acts as an activator to promote the transcription of both biosynthetic genes and immunity genes of cerecidins. Our results further reveal the binding motif of the single-domain response regulator CerR, which provides more information regarding this kind of orphan regulators.

No production of cerecidins by the wild-type B. cereus As 1.1846 was detected. However, when cerR was constitutively expressed in B. cereus As 1.1846, active cerecidin A1 was obtained. Subsequent cerR deletion and complementation experiments confirmed that cerR activates cerecidin biosynthesis. EMSAs and qRT-PCR assays further validated that CerR could bind to cer promoters and promote cerecidin production. Moreover, the two possible regulators ComA and SigH are not involved in the regulation of cerecidin production, and it seems that CerR is the primary factor that regulates the biosynthesis of cerecidin.

Although cerR is an autoactivator in B. cereus As 1.1846, transcription levels of cer genes, including cerR were extremely low in the WT strain, leading to no production of cerecidin. In addition, the putative transcriptional attenuator between the cerA and cerM genes possibly further decreased the transcription of the cer cluster and thus production of cerecidins in the B. cereus As 1.1846 wild-type strain (20).

We here demonstrated that CerR, with just a DNA binding domain, was able to bind to the P_cerA and P_cerR promoters and promoted the transcription of cerecidin biosynthetic genes. This result is similar to that observed with the B. subtilis spore formation-related regulator GerE (LuxR-FixJ family). GerE, containing only a DNA binding region of 74 amino acids, was able to stimulate the transcription of several downstream genes in B. subtilis (23). These findings suggest that the C-terminal HTH domains of LuxR family proteins can act as DNA binding transcriptional activators independent of the N-terminal regulatory domain.

The following footprinting analyses revealed binding sequences of CerR in target promoters, and a dyad symmetry structure spanning 10 nucleotides of the consensus GSAAWATTSC was discovered (Fig. 4). The binding sites of regulators of the LuxR type, such as those of LuxR (24), PimM (a positive regulator of pimaricin biosynthesis) (25), and AguR (a transmembrane transcription activator of the putrescine biosynthesis operon in Lactococcus lactis), usually display dyad symmetry (26). Comparing these binding sites with the CerR binding box (GSAATWTTSC [S = C or G; W = A or T]), we found that the inverted repeated sequence of CerR shows an 8-bp match with PimM binding sites (TAGGGAATTCCCPA) but has no sequence similarity with those of the other two transcription regulators. The subtilin biosynthetic gene cluster has a well-studied regulatory binding site, called the spa box, for its regulator protein, SpaR. SpaR belongs to the OmpR family, and the spa box characteristics are different from those of the CerR binding sequence (27).

cerF and cerE were predicted to be immunity genes within the cerecidin gene cluster in B. cereus As 1.1846. However, lantibiotic immunity driven by only LanF and LanE proteins is uncommon within the Bacillus genus (28). For most of the lantibiotics from Bacillus spp. described so far, immunity is conferred by LanI and/or LanFEG proteins, with exception of entianin and lacticin 3147, whose immunity seems to be supported by EntG/EntI and LtnEF/LtnI proteins (29, 30). Recently it has been reported that AmlF and AmlE are likely to be involved in immunity against amylolysin in Bacillus amyloliquefaciens GA1, with AmlF being the ATP binding subunit and AmlE the efflux protein of an ABC transporter (28). These two proteins resemble CerF and CerE, which were predicted to be an ATP binding protein and an ABC transporter permease, respectively. When constitutively expressing cerR in the WT strain, the transcript levels of cerF and cerE were increased significantly, concomitant with the notably enhanced immunity of strain BceR toward cerecidins A1 and A7. Therefore, it is suggested that CerF and CerE might be involved in the immunity of B. cereus As 1.1846 to cerecidins.

The Bacillus group has been considered an arsenal of antimicrobial agents, and Bacillus was recently revealed to be an excellent reservoir of novel lantibiotics. Numerous lantibiotic gene clusters, including cryptic ones such as cerecidin gene clusters, were identified by genome mining in this group (31). In this study, we demonstrated that CerR acts as a transcriptional activator and can promote the biosynthesis of cerecidins. Expressing CerR in B. cereus As 1.1846 might be a novel approach to produce more lantibiotics. LuxR family response regulators are common in lantibiotic two-component regulatory systems, but single-component regulatory systems and even single-domain regulatory proteins have rarely been reported in lantibiotic biosynthesis. Meanwhile, the stimuli that regulate lantibiotic production through single-domain regulators are still unknown (14, 16). Further studies are needed to determine the precise regulation mechanism and biological function of this kind of single-domain regulatory protein in controlling lantibiotic production or even other possible biological processes.

MATERIALS AND METHODS

Bacterial strains, growth conditions, and plasmids.

Bacterial strains and plasmids used in this study are listed in Table 1. B. cereus As 1.1846, isolated from spoiled soybean milk, was purchased from China General Microbiological Culture Collection Centre (CGMCC) (32). E. coli DH5α was used for construction and preservation of plasmids, and E. coli BL21(DE3) was used for cerR expression. E. coli cells were all cultivated in Luria-Bertani (LB) broth with vigorous shaking or on agar at 37°C. pET28a was used for construction of expression vectors in E. coli, and pHY300PLK with the constitutive promoter P_aprN was used to construct expression vectors in B. cereus As 1.1846. pRN5101 (33), a thermosensitive vector, was used for gene disruption in B. cereus. pEASY-Blunt (Transgene, China) was used as an intermediate cloning vector. Antibiotic concentrations used for bacterial selection were as follows: ampicillin (100 μg/ml) and kanamycin (50 μg/ml) for E. coli; chloramphenicol (2.5 μg/ml), erythromycin (2.5 μg/ml), and tetracycline (15 μg/ml) for B. cereus. The indicator strain Micrococcus luteus NCIB 8166 was cultured in S1 medium (0.8% tryptone, 0.5% yeast extract, 0.5% glucose, 0.2% Na₂HPO₄, 0.5% NaCl, and 0.1% Tween 20) at 30°C.

TABLE 1.

Strains and plasmids

Strain or plasmid	Characteristicsa	Reference or source
Strains
E. coli
DH5α	F− ϕ80lacZΔM15 Δ(lacZYA-argF)U169 recA1 endA1 hsdR17 (rK− mK+) pho A supE44 λ− thi-1 gyrA96 relA1	Invitrogen
BL21(DE3)	F− ompT hsdSB(rB− mB−) gal(λ cI857 ind1 Sam7 nin5 lacUV5 T7 gene 1) dcm(DE3)	Novagen
B. cereus As 1.1846
WT	Isolated from spoiled soybean milk and obtained from CGMCC (Beijing, China)	27
BceΔR	WT strain lacking cerR	This work
BceR	WT strain with constitutive expression of cerR	This work
BceΔR-R	BceΔR complemented with cerR	This work
BceM	WT strain with constitutive expression of cerM	This work
BceMR	BceM with constitutive expression of His6-cerR
WTp	WT strain with empty vector pHY300-PaprN	This work
Micrococcus luteus NCIB 8166	Indicator strain	This work
Plasmids
pET28a	Overexpression vector; Kanr	Novagen
pET28a-cerR	pET28a derivative with insertion of cerR coding region; Kanr	This work
pET28a-comA	pET28a derivative with insertion of comA coding region; Kanr	This work
pEASY-Blunt	Cloning vector; Ampr	TransGene
pEASY-Blunt-mutR	pEASY-Blunt derivative with Cmr cassette flanked by cerR upstream and downstream regions; Ampr	This work
pEASY-PcerA	pEASY-Blunt derivative with 293-bp DNA fragment of cerA promoter region containing the intact conserved DNA binding site; Ampr	This work
pEASY-PcerR	pEASY-Blunt derivative with 285-bp DNA fragment of cerR promoter region containing the intact conserved DNA binding site; Ampr	This work
pEASY-PcerF	pEASY-Blunt derivative with 153-bp DNA fragment of cerF promoter region; Ampr	This work
pEASY-PcomP	pEASY-Blunt derivative with 250-bp DNA fragment of comP promoter region; Ampr	This work
pEASY-PcerAm	pEASY-Blunt derivative with 293-bp DNA fragment of cerA promoter region containing mutated conserved site; Ampr	This work
pEASY-PcerRm	pEASY-Blunt derivative with 285-bp DNA fragment of cerR promoter region containing mutated conserved site; Ampr	This work
pRN5101	Thermosensitive vector used for gene disruption in Bacillus; Ermr Ampr	28
pRN5101-mutR	pRN5101 derivative with Cmr cassette flanked by cerR upstream and downstream regions; Ermr Ampr	This work
pHY300-PaprN	Shuttle vector with constitutive promoter PaprN; Tetr	1
pHY-PaprN-cerR	pHY300-PaprN derivative with insertion of cerR coding region; Tetr	This work
pHY-PaprN-sigH	pHY300-PaprN derivative with insertion of sigH coding region; Tetr	This work

^aKan^r, kanamycin resistance; Amp^r, ampicillin resistance; Erm^r, erythromycin resistance; Cm^r, chloramphenicol resistance; Tet^r, tetracycline resistance; P_cerA, cerA promoter; P_cerR, cerR promoter.

General genetic techniques.

All the molecular manipulations were carried out according to standard protocols (34). Genomic DNA was prepared using the Bacteria Genomic DNA kit according to the instructions from the supplier (CWBIO, China). PCR was performed with Phusion high-fidelity DNA polymerase (Thermo Scientific, Lithuania). Plasmids, amplified products, or DNA fragments were purified with the Axygen nucleic acid purification kit (Axygen, USA). The concentration of nucleic acid was determined with a NanoVue Plus spectrophotometer (GE Healthcare Life Science). E. coli transformation was carried out following standard procedures, and B. cereus cells were transformed by electroporation as previously described by Wu et al. (35). The method was conducted with minor modifications, including that component cells were placed in a prechilled sterile electroporation cuvette (1-mm electrode gap) and pulsed immediately with a Bio-Rad Gene Pulser (1.5 kV, 200 Ω, 25 mF).

RNA extraction, RT-PCR, and quantitative real-time RT-PCR.

B. cereus As 1.1846 WT and its knockout mutant were cultivated in LB broth, and 1.5 ml of culture was harvested after 8 h by centrifugation at 10,000 rpm for 5 min. Bacterial cell walls were removed by incubating with lysozyme (20 mg/ml) in Tris-EDTA buffer for 45 min at 37°C. Further procedures were conducted according to Omega bacterial RNA kit product manual (Omega, USA). The genomic DNA removal and cDNA synthesis were conducted as described in the Thermo Scientific Maxima H Minus first-strand cDNA synthesis kit with DNase I (Thermo Scientific, Lithuania). This cDNA was diluted 100-fold and used as the template. PCR amplification was performed using primer pairs described in Table 2 to detect the transcription units, and DNase I-treated total RNA was used as the negative control. Subsequent quantitative real-time RT-PCR was performed in a Roche LC480 with the Kapa SYBR Fast universal qPCR kit (Kapa, USA) according to the manufacturer's instructions (primer pairs are listed in Table 2). Technical triplicates were performed for each treatment. Statistical comparisons were made using the Student t test, and significance was set at a P value of <0.01. The gatB_Yqey gene (gatB_Yqey domain-containing protein gene) was chosen as a reference gene according to previous reports (36).

TABLE 2.

Primers

Primer	Functiona	Nucleotide sequence (5′ to 3′)
gatB-F	qRT-PCR analysis of gatB-Yqey (F)	TCATTAGTAGACTACAATCG
gatB-R	qRT-PCR analysis of gatB-Yqey (F)	GTGTATTGAATAATTGATTT
qcerA-F	qRT-PCR analysis of cerA (F)	GAAAGATCCACAAGTAAGAGAGAAG
qcerA-R	qRT-PCR analysis of cerA (R)	CTGGTTGTACATCTGATGCCCCTTG
qcerM-F	qRT-PCR analysis of cerM (F)	ATGAGATTTTATCAGAAAGAGGACC
qcerM-R	qRT-PCR analysis of cerM (R)	TCTCTCATATAGTCTGGATGTGTAG
qcerR-F	qRT-PCR analysis of cerR (F)	GAAGGATGTTGAAATAGCAAGGGAG
qcerR-R	qRT-PCR analysis of cerR (R)	ATATGCAGCTATTCCAATTTGGACC
qcerT-F	qRT-PCR analysis of cerT (F)	AGGATTTTGTCTGAGAGTATTAATG
qcerT-R	qRT-PCR analysis of cerT (R)	GTCCATATAGATCTCTTCTCTGCAT
qcerP-F	qRT-PCR analysis of cerP (F)	TTGAAGATAATATTGGTCATGGAAC
qcerP-R	qRT-PCR analysis of cerP (R)	AATCTGCAGAACTACCTTGAAATAC
qcerF-F	qRT-PCR analysis of cerF (F)	GTCAAAGGGAAATCAACAAAAAATC
qcerF-R	qRT-PCR analysis of cerF (R)	GTACAACATTTTTTAACATCTCTGC
qcerE-F	qRT-PCR analysis of cerE (F)	AAATCACTGACGATGAACGTGCAAG
qcerE-R	qRT-PCR analysis of cerE (R)	ATTTCCATATGAAGTGATCGCTAAG
q16S-F	Control of qRT-PCR analysis (F)	TACCCTGGTAGTCCACGCCGTAAAC
q16S-R	Control of qRT-PCR analysis (R)	TTGAGTTTCAGCCTTGCGGCCGTAC
28acerR-F	Construction of pET28a-cerR (F)	CGGGATCCATGAAGAAAGTTTTAAG
28acerR-R	Construction of pET28a-cerR (R)	CCCTCGAGTTAACTATTAATCATAG
28acomA-F	Construction of pET28a-comA (F)	CGGGATCCATGATACACGTTTTGATTGTAG
28acomA-R	Construction of pET28a-comA (R)	CCCTCGAGTTATACATTTACATTTATTATAC
HYcerR-F	Construction of pHY-PaprN-cerR (F)	CGGGATCCATGAAGAAAGTTTTAAGTGATC
HYcerR-R	Construction of pHY-PaprN-cerR (R)	GCTCTAGATTAACTATTAATCATAGCAACAC
HYsigH-F	Construction of pHY-PaprN-sigH (F)	CGGGATCCGTGGAAGCAGGCTTCGTAAG
HYsigH-R	Construction of pHY-PaprN-sigH (R)	AACTGCAGTTAATTTGAAGTGGTACTCTC
Δup-F	Construction of pRN5101-mutR (F)	TAGATACCCAGATTTGTGAG
Δup-R	Construction of pRN5101-mutR (R)	TCAATTTTATTAAAGTTCATCATTCTCCTCCTTTATTC
cat-F	Construction of pRN5101-mutR (F)	GAGAATAAAGGAGGAGAATGATGAACTTTAATAAAAT
cat-R	Construction of pRN5101-mutR (R)	TTTTATTCCCCCCTATCTCTTTATAAAAGCCAGTCATTA
Δdown-F	Construction of pRN5101-mutR (F)	CTAATGACTGGCTTTTATAAAGAGATAGGGGGGAATA
Δdown-R	Construction of pRN5101-mutR (R)	AGACATATCAATTGCCGTTTG
UP-F	Checking the mutation (F)	GTAGTTTTCAATTAAAGAACG
DOWN-R	Checking the mutation (R)	TAGAAACAGTCGTGCTCATGAC
PA-F-FAM	Cloning of PcerA for footprinting (F)	5′FAM-TTATATAAACTTTAATATTATTTTGTG
PA-R-HEX	Cloning of PcerA for footprinting (R)	5′HEX-TTCATTCATCCTCTCGTTTTTTTTA
PR-F-HEX	Cloning of PcerR for footprinting (F)	5′HEX-TGTAATGAATAAATCACTCG
PR-R-FAM	Cloning of PcerR for footprinting (R)	5′FAM-CATTCTCCTCCTTTATTCTC
PcerA-F	Cloning of PcerA for EMSA (F)	TTATATAAACTTTAATATTATTTTGTG
PcerA-R	Cloning of PcerA for EMSA (R)	TTCATTCATCCTCTCGTTTTTTTTA
PcerR-F	Cloning of PcerR for EMSA (F)	TGTAATGAATAAATCACTCG
PcerR-R	Cloning of PcerR for EMSA (R)	CATTCTCCTCCTTTATTCTC
PcerF-F	Cloning of PcerF for EMSA (F)	GTAAATGCGAAGGGTGCACTTG
PcerF-R	Cloning of PcerF for EMSA (R)	ATATAACATCCCCTTTTACTG
PcomP-F	Cloning of PcomP for EMSA (F)	TAAGGATAGGTTAATTGATAC
PcomP-R	Cloning of PcomP for EMSA (R)	AAGAATATGTAATAATATAAAAC
PcerAm-L1F	SLIM of PcerAm for EMSA (F)	GTTAAAAATATATCGTTCGATGAAGTTATCTAAAAAG
PcerAm-S2R	SLIM of PcerAm for EMSA (R)	ATTTTTAAAATAAAAAAATTCCTAACC
PcerAm-L2F	SLIM of PcerAm for EMSA (F)	TAGATAACTTCATCGAACGATATATTTTTAACATTTTTAA
PcerAm-S1R	SLIM of PcerAm for EMSA (R)	AAAAGTTTAAATCTTGTAAATTTATAACTG
PcerRm-L1F	SLIM of PcerRm for EMSA (F)	GTAAAAATTCATCGTACGATAATTGTAACATAAGAGGGAG
PcerRm-S2R	SLIM of PcerRm for EMSA (R)	AAAAGGGGAGCTGCGAGTGATTTATTC
PcerRm-L2F	SLIM of PcerRm for EMSA (F)	ATGTTACAATTATCGTACGATGAATTTTTACAAAAGGGGAGC
PcerRm-S1R	SLIM of PcerRm for EMSA (R)	AAGAGGGAGATCTTCACAATTAAGC

^aF, forward; R, reverse; P_cerA, cerA promoter; P_cerR, cerR promoter; P_cerAm, cerA promoter with mutation; P_cerRm, cerR promoter with mutation; SLIM, site-specific ligase-independent mutagenesis.

Protein expression and purification.

The protein expression and purification methods were as described by Ma et al. (37). The expression plasmid pET28a-cerR was transferred into E. coli BL21(DE3), and the positive clones were inoculated in 10 ml LB medium with shaking at 37°C overnight. A 5-ml culture was then added to 500 ml LB broth with kanamycin (50 μg/ml) at 37°C, and IPTG (isopropyl-d-1-thiogalactopyranoside) was added to the cell culture to a final concentration of 0.5 mM when the optical density at 600 nm (OD₆₀₀) reached 0.6 to 0.8. Cultures were incubated at 18°C for 20 h at a stirring speed of 180 rpm. Cell pellets were obtained by centrifugation at 5, 000 × g for 20 min and resuspended in 40 ml binding buffer (50 mM Na₂HPO₄, 500 mM NaCl, pH 7.4) plus 20 mM imidazole. After sonication, the cell debris was centrifuged at 10, 000 × g for 40 min to remove the inclusion bodies, and the supernatants were filtered with a 0.22-μm filter. The supernatant was loaded onto a 1-ml immobilized metal affinity chromatography (IMAC) Ni²⁺column (GE Healthcare Life Science) that had been preequilibrated with binding buffer, with subsequent stepwise washes (binding buffer plus 40 mM imidazole). The target protein was eluted with binding buffer plus 500 mM imidazole. The protein purity was detected using SDS-PAGE with standard protocols (34), and the concentration of proteins was quantified by the use of a standard bicinchoninic acid assay kit (Thermo Scientific, USA).

EMSAs and DNase I footprinting.

The electrophoresis mobility shift assays (EMSAs) were performed as described previously (38). Four fragments corresponding to the upstream regions of cerA1, cerR, cerF, and comP were amplified by PCR using the genomic DNA of B. cereus As 1.1846 as the template and corresponding primer pairs (Table 2). The DNA probes P_cerA (293 bp), P_cerR (285 bp), P_cerF (153 bp), and P_comP (250 bp) were incubated with various concentrations of His₆-CerR, and P_cerA and P_cerR were also incubated with various concentrations of His₆-ComA. The reaction system volume was 20 μl and contained 20 mM Tris-HCl (pH 7.5), 1 mM dithiothreitol, 10 mM MgCl₂, 0.5 mg/ml bovine serum albumin, 5% glycerol, and 1 μg competing DNA sequence poly [poly(dI-dC)]. The reaction was performed at 25°C for 30 min, and then the mixtures were loaded on 4% (wt/vol) nondenaturing polyacrylamide gels with a running buffer containing 45 mM Tris-HCl (pH 8.0), 45 mM boric acid, and 1 mM EDTA. After electrophoresis, DNA in the gel was stained with SYBR Gold nucleic acid gel stain (Thermo Scientific, USA) for 1 h and photographed under UV transillumination.

DNase I footprinting assays were conducted according to the fluorescent labeling procedure (39). Briefly, DNA fragments were prepared by PCR using fluorescently labeled primers 6-carboxyfluorescein (FAM)/6-carboxy-2,4,4,5,7,7-hexachlorofluorescein (HEX) (Table 2), so the DNA products were labeled with FAM and HEX at the 5′-terminal or 3′-terminal end. After being purified from the agarose gel, the probes (200 ng) and proteins at different concentrations were added to a final reaction volume of 50 μl and incubated at 25°C for 30 min. DNase I (Thermo Scientific, USA) digestions were carried out for 30 s at 37°C and stopped with EDTA. The DNA fragments were purified using the GeneJET gel extraction kit (Thermo Scientific, USA), and then the samples were added to 9.5 μl of HiDi formamide and 0.5 μl of GeneScan-LIZ500 size standard; finally, the mixture was analyzed with a 3730XL DNA analyzer. The results were further processed with GeneMarker v 2.2.0.

Site-directed mutagenesis of P_cerA and P_cerR.

The mutations were introduced into P_cerA and P_cerR using the site-specific ligase-independent mutagenesis (SLIM) method (40). The primers that contain corresponding mutations are listed in Table 2. All the resulting plasmids were confirmed by sequencing analysis (Ruibiotech China).

Construction of cerR mutants.

Gene disruption was performed using homologous recombination as previously described (41). The upstream sequence (778 bp) and downstream sequence (707 bp) of cerR were amplified from B. cereus As 1.1846 chromosomal DNA by PCR using the primer pairs listed in Table 2. The two purified fragments were ligated with a cat resistance cassette amplified from pMG36c using overlapping PCR and then cloned into pEASY-Blunt. Finally, the resulting cassette containing three fragments was digested with HindIII/BamHI and inserted into the corresponding sites of pRN5101 to generate pRN5101-mutR for cerR disruption. The resulting plasmid was introduced into B. cereus As 1.1846 for double-crossover events by electroporation. Primers mutR-F/R were used to confirm the cerR disruption. The plasmid pRN5101-mutR was eliminated by cultivating cells at 37°C, and chloramphenicol-resistant colonies were further confirmed by PCR analysis. The correct mutant strain was defined as BceΔR (WT with disruption of cerR).

Determination of immunity of B. cereus As 1.1846 WTp and BceR to cerecidins.

The procedures for constructing plasmids using pHY-P_aprN to constitutively express cerR were performed as previously described (20). pHY-P_aprN is a shuttle plasmid between E. coli and B. subtilis. cerR was amplified by PCR from the B. cereus As 1.1846 genome DNA with primers (Table 2) containing recognition sites for BamHI and XbaI and was cloned into pHY-P_aprN to obtain pHY-P_aprN-cerR. Transformation of B. cereus As 1.1846 was performed with an electroporation method, and the resulting strain was defined as BceR (WT with cerR).

To determine the immunity of the B. cereus As 1.1846 WTp (WT with pHY-P_aprN) and BceR (WT with cerR) strains to cerecidins A1 and A7, microtiter plates were used as described by Oman and van der Donk (42). Briefly, when the indicator strains were grown to an OD₆₀₀ of ca. 1.0, the cultures were diluted to an OD₆₀₀ of ca. 0.1 to 0.15 using fresh culture medium. Serial dilutions of cerecidins A1 and A7 were prepared in sterile deionized water (SDW), and 150 μl of diluted culture and a 50-μl gradient concentration of cerecidins were added to each well of a 96-well plate. The final concentration in each well was from 18 μg/ml to 1.0 μg/ml. Each plate contained several blank (150 μl fresh medium and 50 μl SDW) and control (150 μl diluted indicator strain culture and 50 μl SDW) wells. The plates were incubated at 37°C and 200 rpm. OD₆₀₀ values were recorded after 24 h of incubation with a Synergy microplate reader (BioTek, USA). Independent biological triplicates were used for each treatment.

Isolation, quantification, and MS analysis of cerecidin from medium.

For cerecidin purification and quantification, methods were as previously described (43). Culture were grown at 37°C for 14 h and then centrifuged at 12,000 × g for 10 min to remove the cells. The supernatants were mixed with ethyl acetate at a ratio of 1 to 3, and the solvent was removed in vacuo. The extract was resuspended in methanol, and the organic soluble material was defatted with hexane, mixed with one part methanol and one part water, and subjected to dichloromethane. The solvent was removed under vacuum, and the final product was dissolved in sterile deionized water. Mass spectrometry (MS) analysis of cerecidins was performed as described previously (20).

Antimicrobial activity assay.

Agar diffusion assays were performed to detect the active cerecidins produced by B. cereus As 1.1846 WT, its mutants, and the WT strain constitutively overexpressing sigH. The samples were added into holes 0.7 cm in diameter in S1 agar medium containing M. luteus NCIB 8166 and cultivated at 30°C for 24 h. The antimicrobial activity was estimated by measuring the diameter of the inhibition zones.