Abstract
The complete genome sequence of Zucchini yellow mosaic virus strain Kurdistan (ZYMV-Kurdistan) infecting squash from Iran was determined from 13 overlapping fragments. Excluding the poly (A) tail, ZYMV-Kurdistan genome consisted of 9593 nucleotides (nt), with 138 and 211 nt at the 5′ and 3′ non-translated regions, respectively. It contained two open-reading frames (ORFs), the large ORF encoding a polyprotein of 3080 amino acids (aa) and the small overlapping ORF encoding a P3N-PIPO protein of 74 aa. This isolate had six unique aa differences compared to other ZYMV isolates and shared 79.6–98.8% identities with other ZYMV genome sequences at the nt level and 90.1–99% identities at the aa level. A phylogenetic tree of ZYMV complete genomic sequences showed that Iranian and Central European isolates are closely related and form a phylogenetically homogenous group. All values in the ratio of substitution rates at non-synonymous and synonymous sites (dN/dS) were below 1, suggestive of strong negative selection forces during ZYMV protein history. This is the first report of complete genome sequence information of the most prevalent virus in the west of Iran. This study helps our understanding of the genetic diversity of ZYMV isolates infecting cucurbit plants in Iran, virus evolution and epidemiology and can assist in designing better diagnostic tools.
Electronic supplementary material
The online version of this article (10.1007/s13205-018-1177-3) contains supplementary material, which is available to authorized users.
Keywords: Genetic diversity, Negative selection, Overlapping fragments, Phylogenetic analysis, ZYMV
Introduction
Zucchini yellow mosaic virus (ZYMV) is a member of the genus Potyvirus in the family Potyviridae which cause mosaic disease on cucurbits (Adams et al. 2005). ZYMV genome contains a single positive-sense ssRNA molecule with 5′VPg and 3′polyA tail which codes for a polyprotein that is proteolytically processed into ten smaller mature proteins; P1 (protease), HC (helper component/protease), P3, 6K1, CI (cylindrical inclusion), 6K2, NIa (nuclear inclusion a), VPg (viral protein linked genome), NIb (nuclear inclusion b) and CP (coat protein) (Riechmann et al. 1992; Lin et al. 2001). In addition, a short ORF embedded within the P3 cistron (pipo) was found which is translated in the +2 reading frame (Chung et al. 2008). This virus is efficiently transmitted in a stylet-borne by aphids such as Myzus persicae, and via seeds (Lisa et al. 1981).
Cucurbit plants are economical crops grown in all parts of Iran because the climate is favorable for their growth. ZYMV is the most common virus infecting cucurbitaceous hosts in Iran and it has been reported from several cucurbits-growing regions (Bananej et al. 2008; Massumi et al. 2011; Mohammadi et al. 2016; Sokhandan-Bashir et al. 2013). So far, the complete genome of three isolates of squash (Cucurbita pepo) from south (Fars) (Acc. No. JN183062), center (IKA) (Acc. No. KU528623), and north (SANRU) (Acc. No. KU198853) of Iran have been sequenced.
The present study aims to determine complete genome sequence of an Iranian ZYMV isolate from a different geographic region of Iran where cucurbit fields are mainly affected by ZYMV (Mohammadi et al. 2016). Accordingly, we determined the complete genome sequence of an Iranian ZYMV isolate (ZYMV-Kurdistan) in the west of Iran from a squash host with mild symptoms. We amplified overlapping fragments and compared with the available full-length genome of the other ZYMV strains to determine their genetic diversity, evolutionary relationship and recombination events. More information about the whole genome sequence of a ZYMV isolate will further reveal molecular variation of this virus, thus facilitating its management and prevention of the disease.
Materials and methods
The source of the ZVMV isolate used in this research was a field-grown squash (Cucurbita pepo) with typical symptoms including leaf deformation and mosaic. The host was collected in August 2016 from the west part of Iran (Nashour, Sanandaj, Kurdistan province). To obtain complete genome of ZYMV-Kurdistan, total nucleic acid was extracted by silica-capture method (Foissac et al. 2000) and then used as a template for first-strand cDNA synthesis with random hexamer primers, and a HyperScript™ Reverse Transcriptase kit (GeneAll, Seoul, Korea). PCR reactions were done with 13 primer pairs (Table 1) and amplicons of the expected size were eluted from agarose gel by Squeeze DNA Gel Extraction Spin Columns (Bio-Rad Laboratories, Hercules, CA, USA), directly ligated into pTG-19 (SinaClon, Tehran, Iran) and transformed into Escherichia coli DH5α. Recombinant plasmids were sequenced in both directions and the obtained sequences were assembled and the complete genome of ZYMV-Kurdistan was obtained from 13 overlapping fragments. The 5′ and 3′ proximal ends of the ZYMV-Kurdistan genome were directly amplified by specific designed primers.
Table 1.
Primers designed in this study for determining complete sequence of ZYMV-Kurdistan
| Primer name | Sequence (5–3) | Genome positionsa | Expected DNA (bp)b |
|---|---|---|---|
| ZY5UTF ZY253R |
AAAATTGAAACAAATCACAAAGACTAC ATGTTGCCATGTGGCCAG |
5′-UTR + pP1 | 253 |
| ZY140F ZY1084R |
ATGGCCTCCATTATGATTGGTTC TCCGGTTGCGACGAATAGTG |
P1 | 944 |
| ZY1019F ZY1899R |
GATTGTGAACGCGCTGGAAC GCTGATGTGAGTGGCTTCTTCTC |
pHC-Pro | 882 |
| ZY1811F ZY2760R |
CATAGGCTCATTGATTGTACCAC GACAACCCTTCATGATTTCAAG |
pHC-Pro + P3 | 953 |
| ZY2715F ZY3432R |
TGATAAGCGAAGCTTCACCAC TTCCTCAAGATCTGGTCTCAC |
pP3 + PIPO | 719 |
| ZY3389F ZY4206R |
CGCCCATATACAATGACTTTC ATTGAAAGCTATGGTCGCAC |
pP3 + 6K1 + pCI | 818 |
| ZY4162F ZY5024R |
ATAGACGAATGCCATGTCAC ACCTTGTTGAGCACCATTTC |
pCI | 863 |
| ZY4986F ZY5692R |
GTTCAAACTCAGGGATTCAG GTTCATTGATCTTTTTCGTG |
pCI + p6K2 | 707 |
| ZY5617F ZY6411R |
TGATATTGGCGATTATGACAC TCCATTAGTGATGATTATCGG |
P6K2 + NIa-VPg + pNIa-Pro | 794 |
| ZY6341F ZY7260R |
GATTCTGATGGCCTCAAGG CCAATTGATTAACAGTGACGG |
pNIa-Pro + pNIb | 916 |
| ZY7134F ZY8004R |
AACACACGCAGAAGCGAG TTTCATGCACGCATAGTAAATAG |
pNIb | 871 |
| ZY7945F ZY8844R |
ACACACTAATGGTTGTGATCTC GAATTGCTGATGAGACGCTCG |
pNIb + pCP | 899 |
| ZY8830F ZY-UTR3R |
TCTCATCAGCAATTCGCCTC T(14)AGGCTTGCAAACGGAG |
pCP + 3′-UTR | 762 |
ap partial
b Corresponded to TW-TN3 isolate (NC-003224)
Genetic distances between the newly sequenced isolate and other ZYMV isolates were estimated using Kimura two-parameter method (Kimura 1980) implemented in MEGA6 software (Tamura et al. 2013). A phylogenetic unrooted tree was constructed by the maximum likelihood (ML) method implemented in MEGA6 software and the branch support was computed using the bootstrap method based on 1000 replicates. The direction and degree of selective pressure operating in coding regions were estimated by calculating dN/dS values (the ratio between nucleotide diversity values in non-synonymous and synonymous positions) (Boulila 2011) using DnaSP v.5.10.01 (Rozas 2009).
To detect recombination event(s) in the Kurdistan isolate, 23 aligned complete genome sequences of ZYMV using several methods (Chimaera, Geneconv, MaxChi, RDP, Siscan, LARD and 3Seq) implemented in the Recombination Detection Program (RDP4) (Martin et al. 2015) were assessed. These analyses were done using default settings for the different methods. Only those recombination event detected by at least three out of the seven methods were accepted.
Results and discussion
The complete genome of ZYMV-Kurdistan was deposited in GenBank under accession number MF684760. The genome of this isolate was 9593 nt in length excluding the poly(A) tail, which is two and four nucleotides longer than Fars and IKA isolates, respectively, and the same as that in SANRU. These insertions and deletions were found in 3′ and 5′-UTR regions. It contained two open-reading frames (ORFs), the large ORF encoding a polyprotein of 3080 amino acids (aa) and the small ORF encoding a PIPO protein of 74 aa, which overlapped the large ORF. As predicted by Pirone and Blonc (1996) and Choi et al. (2007) for other ZYMV variants, nine putative cleavage sites at amino acid positions 310, 766, 1112, 1164, 1798, 1851, 2041, 2284 and 2801 were also found in the polyprotein of ZYMV-Kurdistan that give rise to ten mature proteins: P1, HC-Pro, P3, 6K1, CI, 6K2, VPg, NIa-Pro, NIb and CP (Fig. 1a). All conserved potyvirus motifs were identified in amino acid sequences of ZYMV-Kurdistan. In HC-Pro protein, PTK (Phe-Thr-Lys) (Glasa and Pittnerová 2006) and KLSC (Lys-Leu-Ser-Cys) (Desbiez et al. 2003) motifs were identified that could play an important role in aphid-transmission. In comparison to other Iranian isolates of ZYMV, KITC (Lys-Ile-Thr-Cys) motif is generally found in potyviruses (Desbiez et al. 2003) including majority of ZYMV isolates but in the newly studied isolate, the motif KLSC was present instead. Glasa and Pittnerová (2006) have reported that KLSC instead of KITC in ZYMV-Kuchyna was permissive for transmission and efficient aphid transmissibility to zucchini and cucumber. Collectively, ZYMV-Kurdistan had six unique aa differences in comparison to other ZYMV isolates (Supplementary Table 1). In P3 of the new isolates, we found that it had an Arginine at position 917 of the polyprotein (corresponded to position 151 of P3), encoded by an AGG, while all aggressive variants of ZYMV had different amino acids at this position (Glasa et al. 2007).
Fig. 1.
Organization of the genome, the lengths of amino acids consisting of mature proteins and predicted cleavage sites of the polyprotein of ZYMV-Kurdistan. Each cleavage site is indicated by a slash symbol (a). Unrooted phylogenetic tree of whole genome sequences of 20 ZYMV strains obtained from GenBank database and isolate ZYMV-Kurdistan sequenced in this study. Each strain is represented by strain name followed by country of isolation and its accession number in bracket. The phylogenetic analysis was constructed in MEGA6 software using Maximum likelihood algorithm. Bootstrap values are shown next to the branches (b)
The complete genome of isolate Kurdistan was compared with the available 20 whole genome sequences of ZYMV worldwide (Table 2). This isolate shared 79.6–98.8% identities with the other reported ZYMV isolates at the nt level and 90.1–99% at the aa level. Furthermore, the identity percentage between isolate Kurdistan with other isolates for each of the ORFs (P1, HC-Pro, P3, PIPO, 6K1, CI, 6K2, NIa, VPg, NIb, CP) at the nt and aa levels were determined. In addition, the highest genetic distance was obtained for 5΄UTR (0.136 ± 0.016), followed by P1 (0.105 ± 0.006), HC-Pro (0.067 ± 0.004), NIb (0.067 ± 0.004), CP (0.066 ± 0.005), 6K1 (0.065 ± 0.012), CI (0.060 ± 0.003), VPg (0.059 ± 0.005), 6K2 (0.057 ± 0.010), NIa (0.056 ± 0.005), 3΄UTR (0.036 ± 0.006) and PIPO (0.035 ± 0.008). The greatest variability between potyvirus genomes has been reported in the P1 gene (Adams et al. 2005; Lin et al. 2001) and likewise, we also found that P1 gene to be the most variable region in the ZYMV strains genome. Therefore, it is useful for investigation on the evolutionary relationship and differentiation between strains of potyviruses.
Table 2.
Sequence identity comparisons between the ZYMV-Kurdistan isolate and the corresponding genome regions of other ZYMV isolates at the nucleotides and amino acid (in parentheses) level
| Isolates | Accession numbers | Genome regions | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 5´UTR | P1 | HC-Pro | P3 | P3N-PIPO | 6K1 | CI | 6k2 | VPg | NIa | NIb | CP | 3´UTR | Poly protein | ||
| 10itSDE | KT59822 | 87.5 | 87.7 (85.3) |
91.7 (97) |
92.3 (96.2) |
93.2 (96.4) |
90.8 (100) |
93.6 (98.5) |
91 (95.9) |
94.8 (98.8) |
92 (98.2) |
94.8 (97.4) |
93.8 (98.5) |
95.4 | 92 (96.6) |
| Kuchyna | DG124239 | 97.1 | 97.2 (96.5) |
98.2 (97.9) |
98.7 (98.5) |
98.4 (98.7) |
99.3 (100) |
98.8 (98.6) |
98.7 (100) |
98.5 (98.8) |
98.7 (99.1) |
99.3 (99.2) |
98.5 (97.8) |
98.5 | 98.5 (98.4) |
| SE04T | KF976713 | 97.1 | 97.5 (97.2) |
98 (97.7) |
98.9 (98.5) |
98.7 (98.7) |
99.3 (100) |
99 (99.2) |
98.7 (100) |
98.7 (99.4) |
99.2 (100) |
99.4 (99.2) |
98.7 (98.2) |
99 | 98.6 (98.7) |
| H | KF976712 | 96.3 | 97.3 (97.2) |
98.2 (98.1) |
98.8 (98.5) |
98.4 (98.2) |
99.3 (100) |
98.9 (99.2) |
98.7 (100) |
98.7 (99.4) |
99 (100) |
99.4 (99.4) |
98.7 (98.2) |
98.5 | 98.6 (98.8) |
| B* | AY188994 | 98.5 | 98 (97.9) |
98.9 (98.8) |
98.8 (98.5) |
98.5 (98.2) |
97.1 (97.5) |
99 (99.2) |
98.1 (100) |
98.7 (99.4) |
99.3 (100) |
99.4 (99.4) |
98.8 (98.5) |
98.5 | 98.8 (99) |
| IKA | KU528623 | 93.4 | 98.7 (97.2) |
97.6 (97) |
97.8 (96.6) |
97.3 (94.5) |
98.6 (100) |
95.7 (98.3) |
98.7 (98) |
95.8 (94) |
98.4 (97.8) |
99 (98.6) |
91.3 (87.7) |
99 | 96.9 (96.6) |
| SANRU | KU198853 | 94.9 | 96.4 (95.1) |
98.5 (98.6) |
97.6 (97) |
98.5 (99.1) |
97.8 (95) |
98.5 (97.6) |
99.4 (100) |
97 (97.6) |
98.4 (99.1) |
98.9 (98.8) |
99 (99.3) |
96.4 | 98.1 (98) |
| AP Gherkin | KT778297 | 93.4 | 96 (94.7) |
97.9 (98.4) |
98.4 (98.1) |
98.7 (98.7) |
97.8 (100) |
98.4 (98.6) |
98.7 (100) |
97.4 (99.4) |
98.6 (99.6) |
98.9 (99) |
98.1 (98.9) |
97.5 | 97.9 (98.4) |
| Fars | JN183062 | 96.3 | 95.7 (92.9) |
98.2 (99.1) |
98.3 (98.5) |
98.7 (99.1) |
97.1 (97.5) |
98.8 (99) |
99.4 (100) |
98.5 (98.8) |
98.2 (100) |
98.9 (98.8) |
99.3 (99.6) |
98 | 98.2 (98.5) |
| PA_2006 | JQ716413 | ND | 97 (95.5) |
97.9 (98.6) |
97.6 (97.4) |
97.2 (96.8) |
96.4 (92.4) |
98.1 (98.8) |
98.7 (100) |
97 (99.4) |
94.7 (99.1) |
96.2 (97.8) |
94.5 (98.9) |
ND | 96.4 (98.1) |
| TW-TN3 | AF127929 | 83.1 | 94.2 (94.7) |
93.3 (97.7) |
91.7 (97) |
93.2 (95.5) |
94.1 (100) |
92.6 (98.1) |
94 (98) |
95.8 (98.2) |
96.1 (100) |
96.2 (98) |
93.2 (97.8) |
95.4 | 93.5 (97.7) |
| KR-PS | AY279000 | 85.3 | 90.9 (91.1) |
93.5 (98.1) |
92 (95) |
91.9 (93.1) |
91.6 (100) |
91.7 (97.3) |
93.2 (95.9) |
92.7 (99.4) |
93 (100) |
95 (98) |
93 (97.1) |
95.5 | 92.2 (97.1) |
| KR-PE | AY278999 | 86 | 91.3 (90.7) |
93.6 (98.1) |
91.9 (95) |
91.6 (92.6) |
92.4 (100) |
91.4 (96.9) |
93.2 (95.9) |
92.7 (99.4) |
93 (100) |
95.1 (98.2) |
93 (97.1) |
95.5 | 92.2 (97) |
| KR-PA | AY278998 | 83.1 | 91.8 (90.3) |
93.4 (98.6) |
91.9 (97) |
92.8 (95.5) |
91.6 (100) |
90.5 (97.1) |
92.5 (95.9) |
90.7 (98.8) |
93.5 (99.6) |
95.3 (97.4) |
92.5 (96.7) |
97.5 | 91.9 (97) |
| AG | EF062583 | 98.5 | 97.9 (97.6) |
98.7 (98.6) |
98.9 (98.5) |
98.7 (98.7) |
97.1 (97.5) |
99 (99.2) |
98.1 (100) |
98.7 (99.4) |
99.4 (100) |
99.2 (99.8) |
99 (98.5) |
98.5 | 98.7 (98.9) |
| NAT | EF062582 | 98.5 | 97.9 (97.6) |
98.8 (98.8) |
98.9 (98.5) |
98.7 (98.7) |
97.1 (97.5) |
99 (99.2) |
98.1 (100) |
98.7 (99.4) |
99.4 (100) |
99.3 (99.8) |
99 (98.5) |
98.5 | 98.8 (98.9) |
| 2002 | AB188116 | 87.5 | 89.4 (87.3) |
91.5 (97.2) |
92.4 (96.6) |
93.5 (95.9) |
93.3 (100) |
97.1 (98.8) |
97.4 (98) |
98.5 (98.8) |
97.2 (99.6) |
96.2 (98.6) |
95.3 (98.9) |
97 | 94.6 (97.3) |
| Z5-1 | AB188115 | 87.5 | 89.4 (87.3) |
92.1 (98.1) |
92.7 (96.6) |
93.5 (95.9) |
93.3 (100) |
97.1 (98.6) |
97.4 (98) |
98.5 (98.8) |
97.2 (99.6) |
96.9 (98.8) |
95.1 (98.9) |
97 | 94.6 (97.4) |
| RDA | AB369279 | 85.3 | 92 (91.1) |
93.6 (98.4) |
90.6 (95) |
92 (93.1) |
90 (97.5) |
91.2 (97.4) |
93.2 (95.9) |
90.5 (97.6) |
93.1 (99.1) |
95.1 (97.8) |
89.9 (95.6) |
95.9 | 91.7 (96.7) |
| Singapore | AF014811 | 76.9 | 44.3 (48.5) |
76 (88.5) |
88.4 (92.6) |
92.2 (92.7) |
86.3 (97.5) |
84 (95.9) |
80.6 (93.8) |
82.4 (96.4) |
84.8 (96.9) |
89.2 (95.3) |
85 (91.7) |
97 | 79.6 (90.1) |
These comparisons were obtained in MEGA6 program using p-distance method
Nd not determined
The phylogenetic tree was constructed by the maximum likelihood (ML) method implemented in MEGA6 (Tamura et al. 2013) with 1000 replicates (bootstrap). ZYMV isolates clustered into three groups (Fig. 1b). A single isolate from Singapore (Singapore) was in Group III, whereas collectively 15 isolates from Israel, India, Slovakia, Czech Republic, Iran, Japan and the USA were in Group I, and 6 isolates from Taiwan, Argentina and South Korea in Group II. A correlation appeared to exist between the phylogeny and geographic origin of the isolates being in agreement with the report by Glasa et al. (2007), where a close genetic relationship linking the ZYMV isolates from the central European region (Slovakia and Czech Republic) and here was found. We suggest that the Iranian isolates of ZYMV have a common ancestor with ZYMV isolates from central Europe or have been spread from unique infection focus.
dN/dS ratio differed greatly among different ORFs as follows: 0.255 (P1), 0.061 (HC-Pro), 0.064 (P3), 0.114 (P3N-PIPO), 0.067 (6K1), 0.039 (CI), 0.057 (6K2), 0.036 (VPg), 0.024 (NIa), 0.033 (NIb) and 0.089 (CP). All the ZYMV-encoded proteins were under negative selection (dN/dS > 1), while this value for NIa was the lowest (0.024) suggesting that this protein is under strong negative (purifying) selection pressure. NIa protein plays many roles during infection (Martínez et al. 2016), therefore, the rate of synonymous substitution is much larger than the non-synonymous rate in this protein, reflecting that the majority of non-synonymous mutations were removed by strong purifying selection over the course of evolution. Vice versa, in consistent with previous studies of other potyviruses such as Soybean mosaic virus (Ahangaran et al. 2013), Watermelon mosaic virus (Moreno et al. 2004), dN/dS ratio was the highest (0.255) for P1 protein due to high sequence variability among ZYMV isolates (0.105 ± 0.006), reflecting different evolutionary dynamics acting on the various potyviral genes.
No recombination event was found in ZYMV-Kurdistan, but this isolate has been identified as the major parent of another Iranian isolate, IKA (Acc. No. KU528623) (data not shown). Recombination in IKA isolate was confirmed by the phylogenetic tree wherein this isolate was separate from the remaining Iranian isolates including those from Fars, SANRU and Kurdistan (Fig. 1b). Each recombination event was usually parented by the isolates from the same geographical region as the recombinant.
In conclusion, this is the first report of complete genome sequence information of the most prevalent virus in west of Iran. This study helps us to further understand the genetic diversity, evolution and epidemiology of ZYMV isolates infecting cucurbit plants in Iran and assists in implementing better diagnostic tools and virus control strategies.
Electronic supplementary material
Below is the link to the electronic supplementary material.
Acknowledgements
We thank Dr. Nemat Sokhandan Bashir for critical review of the manuscript.
Compliance with ethical standards
Conflict of interest
On behalf of all authors, the corresponding author states that there is no conflict of interest.
Footnotes
Electronic supplementary material
The online version of this article (10.1007/s13205-018-1177-3) contains supplementary material, which is available to authorized users.
References
- Adams MJ, Antoniw JF, Fauquet CM. Molecular criteria for genus and species discrimination within the family Potyviridae. Adv Virol. 2005;150:459–479. doi: 10.1007/s00705-004-0440-6. [DOI] [PubMed] [Google Scholar]
- Ahangaran A, Habibi MK, Mohammadi GHM, Winter S, Garcıa-Arenal F. Analysis of Soybean mosaic virus genetic diversity in Iran allows the characterization of a new mutation resulting in overcoming Rsv4-resistance. J Gen Virol. 2013;94:2557–2568. doi: 10.1099/vir.0.055434-0. [DOI] [PubMed] [Google Scholar]
- Bananej K, Keshavarz T, Vahdat A, Hosseini Salekdeh G, Glasa M. Biological and molecular variability of Zucchini yellow mosaic virus in Iran. J Phytopathol. 2008;156:654–659. doi: 10.1111/j.1439-0434.2008.01430.x. [DOI] [Google Scholar]
- Boulila M. Positive selection, molecular recombination structure and phylogenetic reconstruction of members of the family Tombusviridae: implication in virus taxonomy. Genet Mol Biol. 2011;34:647–660. doi: 10.1590/S1415-47572011005000046. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Choi SK, Yoon JY, Sohn SH. Analysis of the complete genome sequence of Zucchini yellow mosaic virus strain an isolated from Hollyhock. Plant Pathol J. 2007;23:145–250. [Google Scholar]
- Chung BYW, Miller WA, Atkins JF, Firth AE. An overlapping essential gene in the Potyviridae. Proc Natl Acad Sci. 2008;105:5897–5902. doi: 10.1073/pnas.0800468105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Desbiez C, Gal-On A, Girard M, Wipf-Scheibel C, Lecoq H. Increase in Zucchini yellow mosaic virus symptom severity in tolerant zucchini cultivars is related to a point mutation in P3 protein and is associated with a loss of relative fitness on susceptible plants. Phytopathology. 2003;93:1478–1484. doi: 10.1094/PHYTO.2003.93.12.1478. [DOI] [PubMed] [Google Scholar]
- Foissac X, Savalle-Dumas L, Gentit P, Dulucq MJ, Candresse T. Polyvalent detection of fruit tree Tricho, Chapillo and Faveaviruses by nested RT-PCR using degenerated and inosine containing primers (PDO RT-PCR) Acta Hortic. 2000;357:52–59. [Google Scholar]
- Glasa M, Pittnerová S. Complete genome sequence of a Slovak isolate of Zucchini yellow mosaic virus (ZYMV) provides further evidence of a close molecular relationship among central European ZYMV isolates. J Phytopathol. 2006;154:436–440. doi: 10.1111/j.1439-0434.2006.01124.x. [DOI] [Google Scholar]
- Glasa M, Svoboda J, Novakova S. Analysis of the molecular and biological variability of Zucchini yellow mosaic virus isolates from Slovakia and Czech Republic. Virus Genes. 2007;35:415–421. doi: 10.1007/s11262-007-0101-4. [DOI] [PubMed] [Google Scholar]
- Kimura M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol. 1980;16:111–120. doi: 10.1007/BF01731581. [DOI] [PubMed] [Google Scholar]
- Lin SS, Hou RF, Yeh SD. Complete genome sequence and genetic organization of a Taiwan isolate of Zucchini yellow mosaic virus. Botanical Bull Acad Sin. 2001;42:243–250. [Google Scholar]
- Lisa V, Boccardo G, D’ Agostino G, D’ Aquilio M. Characterization of a potyvirus that causes zucchini yellow mosaic. Phytopathology. 1981;71:667–672. doi: 10.1094/Phyto-71-667. [DOI] [Google Scholar]
- Martin DP, Murrell B, Golden M, Khoosal A, Muhire B. RDP4: detection and analysis of recombination patterns in virus genomes. Virus Evol. 2015;1(1):vev003. doi: 10.1093/ve/vev003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Martínez F, Rodrigo G, Aragonés V, Ruiz M, Lodewijk I, Fernández U, Elena SF, Daròs JA. Interaction network of tobacco etch potyvirus NIa protein with the host proteome during infection. BMC Genomics. 2016;17:87. doi: 10.1186/s12864-016-2394-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Massumi H, Shaabanian M, Heydarnejad J, Hosseini Pour AH, Rahimian H. Host range and phylogenetic analysis of Iranian isolates of Zucchini yellow mosaic virus. J Plant Pathol. 2011;93:187–193. [Google Scholar]
- Mohammadi K, Hajizadeh M, Koolivand D. Detection and identification of four vegetable fruit viruses in west and northwest of Iran. Iran J Plant Pathol. 2016;52:279–288. [Google Scholar]
- Moreno IM, Malpica JM, Diaz-Pendon JA, Moriones E, Fraile A, Garcia-Arenal F. Variability and genomic structure of the population of watermelon mosaic virus infecting melon in Spain. Virology. 2004;318:451–460. doi: 10.1016/j.virol.2003.10.002. [DOI] [PubMed] [Google Scholar]
- Pirone TP, Blonc S. Helper-dependent vector transmission of plant viruses. Annu Rev Phytopathol. 1996;34:227–342. doi: 10.1146/annurev.phyto.34.1.227. [DOI] [PubMed] [Google Scholar]
- Riechmann JL, Lain S, Garcia JA. Highlights and prospects of potyvirus molecular biology. J Gen Virol. 1992;73:1–16. doi: 10.1099/0022-1317-73-1-1. [DOI] [PubMed] [Google Scholar]
- Rozas J. DNA Sequence Polymorphism Analysis using DnaSP. In: Posada D, editor. Bioinformatics for DNA sequence analysis; methods in molecular biology. NJ: Humana Press; 2009. pp. 337–350. [DOI] [PubMed] [Google Scholar]
- Sokhandan-Bashir N, Ghasemzadeh A, Masoudi N, Khakvar R, Farajzadeh D. Degenerate primers facilitate the detection and identification of potyviruses from the Northwest Region of Iran. Iran J Biotechnol. 2013;11:115–122. doi: 10.5812/ijb.11213. [DOI] [Google Scholar]
- Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol. 2013;30:2725–2729. doi: 10.1093/molbev/mst197. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.