LETTER
The emergence and spread of multidrug-resistant tuberculosis (MDR-TB) have been a serious threat in the control of TB. This situation has been augmented by the emergence of more-severe extensively drug-resistant tuberculosis (XDR-TB). MDR-TB strains have become resistant to all fluoroquinolones (FQ; specifically, ofloxacin, levofloxacin, moxifloxacin, and gatifloxacin) and all of the second-line injectable drugs (amikacin, capreomycin, and kanamycin). In Myanmar, TB incidence was estimated at 365/100,000 population, and there were 2,793 laboratory-confirmed cases of MDR-TB and rifampin-resistant TB and 11 laboratory-confirmed cases of XDR-TB in 2015 (1).
Pyrazinamide (PZA) is a standard component of short-course anti-TB treatment regimens and also of second-line regimens for MDR-TB and XDR-TB (2, 3). PZA is also one component of new regimens: novel rifampin-sparing anti-TB regimens and a shorter MDR-TB treatment regimen (4). There are limited data on PZA resistance because routine drug susceptibility testing (DST) has rarely been performed due to technical difficulties (5, 6). We identified PZA resistance in 66 clinical MDR-TB isolates which were collected at the Yangon and Mandalay TB Centers during 2015 and 2016. Those isolates were used for phenotypic PZA DST by the BACTEC 960 mycobacterial growth indicator tube (MGIT 960) (Becton, Dickinson, Sparks, MD) system at the concentration of 100 μg/ml, and the Mycobacterium tuberculosis H37Rv strain was used as the reference strain (7). Mutations in the pncA gene and its promoter region (pncA region) were identified using DNA sequencing to determine genotypic resistance to PZA. The 756-bp pncA gene was sequenced with forward (CGGATTTGTCGCTCACTACA) and reverse (TCCGCCGCCGAACAGTTCATCCCGGT) primers using an ABI 3500XL genetic analyzer (Applied Biosystems, USA). The wild-type pncA gene from M. tuberculosis H37Rv (Gene ID 888260) was used as the reference sequence, and sequences were aligned using Bioedit version 7.2.6.1 (http://www.mbio.ncsu.edu/BioEdit/bioedit.html). Analysis of the sequences was performed on the basis of sequences in the available literature and online databases (8, 9, 10).
Of 66 MDR-TB isolates from Myanmar, 40 (60.6%) were PZA resistant and all of them showed mutations in the pncA region. There was good concordance between phenotypic PZA DST and sequencing results (0.968 kappa coefficient). This finding coincides with those of other studies (6, 11). Forty different types of mutations were distributed in the pncA region, and 10 types were first found in this study. We found 10 FQ-resistant pre-XDR and 7 XDR strains among 40 PZA-resistant isolates (Table 1).
TABLE 1.
Correlation between phenotypic pyrazinamide susceptibility and pncA gene-sequencing results
| Wild type or MDR-TB isolates with pncA gene mutationsa | No. of strains that were phenotypically PZAb: |
Total (% agreement) | |
|---|---|---|---|
| Susceptible | Resistant | ||
| Wild type | 25 | 0 | 25 (100) |
| Mutants | 41 (97.6) | ||
| Single mutation | 0 | 32 | |
| Double mutations | 1 | 7 | |
| Triple mutations | 0 | 1 | |
| Total | 26 | 40 | 66 (98.5) |
MDR-TB, multidrug-resistant tuberculosis.
PZA resistance was determined by the BACTEC MGIT 960 system. Kappa coefficient = 0.968.
A recent multicountry survey reported 3.0 to 42.1% PZA resistance among patients with rifampin resistance (12). Our study showed relatively higher PZA resistance (60.6%) among MDR-TB isolates, and some of them were XDR- and pre-XDR-TB strains. This finding supported the recommendation that routine PZA DST be incorporated into the current MDR-TB treatment monitoring scheme. The presence of combined resistance to FQ and PZA suggests the need to evaluate effective treatment regimens for MDR/XDR-TB. The possible synergistic action of PZA with other anti-TB drugs should be assessed in larger studies linking PZA resistance to patient outcomes. MGIT 960 PZA DST is a useful and reliable method, but DNA sequencing can be considered an alternative method to replace phenotypic DST with a long turnaround time.
This study was approved by the Ethics Review Committee, Department of Medical Research, Myanmar.
ACKNOWLEDGMENT
This work was supported by the Korea International Cooperation Agency (KOICA).
REFERENCES
- 1.World Health Organization. 2016. Global tuberculosis report 2016. World Health Organization, Geneva, Switzerland: http://www.who.int/tb/publications/global_report/en/. [Google Scholar]
- 2.World Health Organization. 2016. Guidelines for treatment of drug-susceptible tuberculosis and patient care, 2017 update. World Health Organization, Geneva, Switzerland: http://apps.who.int/iris/bitstream/10665/255052/1/9789241550000-eng.pdf. [Google Scholar]
- 3.World Health Organization. 2016. Treatment guidelines for drug resistant tuberculosis, 2016 update. World Health Organization, Geneva, Switzerland: http://apps.who.int/iris/bitstream/10665/250125/1/9789241549639-eng.pdf. [Google Scholar]
- 4.World Health Organization. 2016. The shorter MDR-TB regimen. World Health Organization, Geneva, Switzerland: http://www.who.int/tb/Short_MDR_regimen_factsheet.pdf. [Google Scholar]
- 5.Zhang Y, Mitchison D. 2003. The curious characteristics of pyrazinamide: a review. Int J Tuberc Lung Dis 7:6–21. [PubMed] [Google Scholar]
- 6.Jureen P, Werngren J, Toro JC, Hoffner S. 2008. Pyrazinamide resistance and pncA gene mutations in Mycobacterium tuberculosis. Antimicrob Agents Chemother 52:1852–1854. doi: 10.1128/AAC.00110-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Pfyffer GE, Palicova F, Rusch Gerdes S. 2002. Testing of susceptibility of Mycobacterium tuberculosis to pyrazinamide with the radiometric BACTEC MGIT 960 system. J Clin Microbiol 40:1670–1674. doi: 10.1128/JCM.40.5.1670-1674.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Sanggren A, Strong M, Muthukrishnan P, Weiner BK, Church GM, Murray MB. 2009. Tuberculosis drug resistant mutation database. PLoS Med 6:e1000002. doi: 10.1371/journal.pmed.1000002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Madden T. 2013. The BLAST sequence analysis tool, 2013 March 15. In The NCBI handbook, 2nd ed National Center for Biotechnology Information, Bethesda, MD: https://www.ncbi.nlm.nih.gov/books/NBK153387/. [Google Scholar]
- 10.Miotto P, Cabibbe AM, Feuerriegel S, Casali N, Drobniewski F, Rodionova Y, Bakonyte D, Stakenas P, Pimkina E, Augustynowicz-Kopeć E, Degano M, Ambrosi A, Hoffner S, Mansjö M, Werngren J, Rüsch-Gerdes S, Niemann S, Cirillo DM. 2014. Mycobacterium tuberculosis pyrazinamide resistance determinants: a multicenter study. mBio 5:e01819-14. doi: 10.1128/mBio.01819-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Shenai S, Rodrigues C, Sadnai M, Sukhadia N, Mehta A. 2009. Comparison of phenotypic and genotypic methods for pyrazinamide susceptibility testing. Indian J Tuberc 6:82–90. [PubMed] [Google Scholar]
- 12.Zignol M, Dean AS, Alikhanova N, Andres S, Cabibbe AM, Cirillo DM, Dada A, Dreyer A, Driesen M, Gilpin C, Hasan R, Hasan Z, Hoffner S, Husan A, Hussain A, Ismail N, Kamal Z, Mansjo M, Myusi L, Niemann S, Omar SV, Qadeer E, Rigouts L, Ruesch-Gerdes S, Schito M, Seyfaddinova M, Skrahina A, Tahseen S, Wells WA, Mukadi YD, Kimerling M, Floyd K, Weyer K, Raviglione MC. 2016. Population based resistance of Mycobacterium tuberculosis isolates to pyrazinamide and fluoroquinolones: results from a multicountry surveillance project. Lancet Infect Dis 16:1185–1192. doi: 10.1016/S1473-3099(16)30190-6. [DOI] [PMC free article] [PubMed] [Google Scholar]