High expression of WWP1 predicts poor prognosis and associates with tumor progression in human colorectal cancer

Abstract

WWP1 (WW domain-containing E3 ubiquitin protein ligase 1), which is frequently up-regulated in multiple human malignancies, has been demonstrated to play a critical function in cell proliferation, apoptosis and invasion. However, limited knowledge is known about the expression pattern and prognostic value of WWP1 in colorectal cancer (CRC). In this study, we firstly observed that WWP1 mRNA and protein is commonly up-regulated in CRC tissues compared with normal counterparts. Furthermore, by immunohistochemical analysis in 348 cases of CRC specimens, we demonstrated that the WWP1 protein expression is up-regulated in 58.91% (205/348) samples and detected increasing WWP1 expression is closely correlated with enhanced tumor size (P=0.022), CEA level (P=0.021), T classification (P=0.010), distant metastasis (P=0.021) and TNM stage (P=0.005). Meanwhile, Kaplan-Meier survival analysis showed CRC patients with a high WWP1 expression have a poorer overall survival (P<0.001) and disease-free survival (P=0.001) than those with a low WWP1 expression. Multivariate Cox regression analysis revealed WWP1 is the independent prognostic factors for overall survival rate of CRC patients. What’s more, by CCK-8 assays and Transwell assays, we found WWP1 depletion markedly inhibited tumor proliferation and invasion in CRC cells, and cells with WWP1 overexpression had a prominently higher proliferative and invasive capacity. Most notably, we illuminated WWP1 downregulation inactivated PTEN/Akt pathway in CRC cells. Taken together, our studies revealed the prognostic value of WWP1 in CRC and support that WWP1 may act as a molecular target for CRC treatment.

Introduction

Colorectal cancer (CRC) is currently one of the most common causes of cancer-related death worldwide [1]. Despite the diagnosis and treatment of CRC have been improved, the efficacy of surgery and chemotherapy remains unsatisfactory, and the 5-year survival rate of CRC patients with metastasis is still under 10% [2,3]. Classical clinicopathologic parameters, such as TNM stage and serum CEA level, have been widely used for prognosis evaluation, but most of them do not fully predict individual clinical outcome [4]. Therefore, novel therapeutic approaches and prognostic factors are required to improve the poor prognosis of colorectal cancer patients.

WWP1 (WW domain-containing E3 ubiquitin protein ligase 1), belongs to NEDD4-like proteins family, is a multifunction protein which contains an N-terminal C2 domain, a C-terminal catalytic HECT domain for ubiquitin transferring and four tandem WW domains for substrate binding [5,6]. Previous studies showed that WWP1 is an intrinsic E3 ubiquitin ligase, which participates in multiple physiological and pathological processes in disease [7,8]. Recently, WWP1 has been found overexpressed in human cancers, such as gastric cancer, prostate cancer and breast cancer [9-11]. However, whether WWP1 plays a role in tumorigenesis and progression of colorectal cancer have not been explored.

To determine the expression pattern of WWP1 in CRC, we profiled the expression status of WWP1 in CRC tissues. Moreover, we analyzed the association between WWP1 expression and clinicopathological characteristics in colorectal cancer, elucidated the prognostic role of WWP1 in CRC patients. Finally, we found WWP1 through PTEN/Akt pathway promotes proliferative and invasive phenotype of CRC cells.

Materials and methods

Patients and tissue specimens

All the CRC tissues were obtained from the patients who had surgical resection from January 2007 to December 2016 in Renji hospital, and were diagnosed pathologically by two pathologists. 348 paraffin-embedded CRC specimens were used for immunohistochemistry and another 32 paired freshly frozen CRC and corresponding noncancerous tissues were immersed in RNAlater overnight at 4°C for real-time quantitative PCR (RT-qPCR) and western blot. All the patients were provided with written informed consent before enrollment. This study was approved by the Human Research Committee of Shanghai Jiao Tong University, School of Medicine, Renji Hospital.

Cell culture and transfection

Human CRC cell lines SW480, HCT116, SW620, HT29, LoVo and the normal colonic epithelial cell line NCM460 were purchased from American Type Culture Collection and kept in our laboratory. The transfections were performed using Lipofectamine 2000 (Invitrogen, USA), according to the manufacturer’s instructions. Small interfere RNAs (siRNA) targeting WWP1 and a negative control were obtained from GenePharma Technology (Shanghai, China), and WWP1 overexpressing plasmids were purchased from Genearray Biotechnology (Shanghai, China).

Real-time quantitative PCR

The RT-qPCR assays were performed according to the minimum information for publication of quantitative real-time PCR experiments (MIQE) guidelines [12]. Total RNA was extracted from tissues using Trizol reagent (Takara, Japan) and was reverse-transcribed using a PrimeScript RT-PCR kit (Takara, Japan), according to the manufacturer’s instructions. RT-qPCR was performed using StepOne Real-Time PCR System (Applied Biosystems, Grand Island, USA). The primers used in this study were shown in Table 1. Relative expressions were determined by normalizing expression of each Ct value to GAPDH Ct value.

Table 1.

Quantitative Real-time PCR primers used in this study

Gene name	Primer sequence (5’ to 3’)	Amplicon size
WWP1	Forward: GTATGGATCCTGTACGGCAGCA	141 bp
	Reverse: GTTGTGGTCTCTCCCATGTGGT
GAPDH	Forward: TGAAGGTCGGAGTCAACGGA	225 bp
	Reverse: CCTGGAAGATGGTGATGGGAT

Western blot

Cells were lysed with RIPA (Beyotime, China) containing a protease inhibitor mixture on ice for 30 min. The membranes were blocked with 5% non-fat milk and incubated with the primary antibodies at 4°C overnight. After that, the membranes were incubated with HRP-conjugated goat anti-rabbit or goat anti-mouse IgG (1:3000, KangChen, China) for 1 hour. Finally, the ECL detection system (SuperSignal West Femto Maximum Sensitivity Substrate, Thermo Fisher Scientific, USA) was used for visualization. Sources of antibodies and concentrations used were as follows: mouse anti-WWP1 (1:1000, Abnova), rabbit anti-PTEN (1:1000, Abcam), rabbit anti-p-Akt (1:1000, Abcam), rabbit anti-Akt (1:1000, Abcam), rabbit anti-GAPDH (1:1000, Abcam).

Immunohistochemistry

Immunohistochemical staining was performed as previously described [13]. The WWP1 antibody was purchased from Abnova (1:1000). Protein expression was quantified using a visual grading system based on the extent and intensity of staining. The percentage of positive tumor cells was graded on the following 0-4 scale: 0, none; 1 (1-25%); 2 (26-50%); 3 (51-75%); 4 (76-100%). The staining intensity was graded on the following 0-3 scale, represent no staining, weak staining, moderate staining and strong staining, respectively. The final score was designated as low or high expression group using the percent of positive cell score × staining intensity score. If total score >6, it defined as high expression, or defined as low expression. These scores were determined independently by two senior pathologists.

Tumorigenesis in nude mice

Male BALB/c nude mice (4-6 weeks, 18-22 g) were purchased from the Animal Center of East China Normal University, Shanghai, China, and xenograft tumors were generated by subcutaneous injection of 4 × 10⁶ cells on subcutaneous. The mice were housed under specific pathogen-free conditions. All animal experiments were carried out in accordance with the guidelines of China Animal Welfare Legislation. HCT116 cells were transduced with lentivirus vectors expressing WWP1 ShRNA. The mice were separated into 2 groups randomly, one with subcutaneous injection of si-WWP1, and the other with Control. Injection was performed twice a week.

Statistical analysis

Statistical analyses were performed using SPSS version 18.0 (SPSS Inc, Chicago, USA) and GraphPad Prism 5 (San Diego, CA) software. For real-time PCR, 2^-ΔΔCt was calculated, and paired student t-test was performed to analyze the P value between the two groups. The chi-square test was used to analyze clinicopathological characteristics. Survival curves were evaluated using the Kaplan-Meier method, and analyzed by the log-rank test. All the experiments were repeated at least three times. P<0.05 defined as statistically significant.

Results

The expression of WWP1 is significantly upregulated in CRC

To evaluate the expression status of WWP1 in human CRC tissues, we firstly analyzed four independent microarray datasets from Oncomine database [14-17]. The results showed the mRNA expression levels of WWP1 were up-regulated in the majority of tumor tissues compared with noncancerous colorectal tissues (Figure 1A-D). Furthermore, 32 paired CRC and noncancerous colorectal tissues were collected in Renji hospital to examine the WWP1 mRNA expression by RT-qPCR in the current study. Consistent with the data from Oncomine database, WWP1 mRNA was also up-regulated in CRC tissues (7.11 ± 0.37) in comparison with the paired noncancerous tissues (5.37 ± 0.36) (P=0.007, Figure 1E). And we also found that the WWP1 protein level expression is higher in CRC tissues compared with paired noncancerous colorectal tissues (Figure 1F), and this was consistent with the result of RT-qPCR. What’s more, we measured the expression levels of WWP1 in 5 CRC cell lines and the normal colonic epithelial cell line NCM460. As showed, the lowest WWP1 level was detected in NCM460 cells (Figure 1G). These results indicated that both mRNA and protein level of WWP1 were significantly increased in CRC tissues.

Figure 1.

The expression of WWP1 was significantly increased in CRC tissues. WWP1 expression in Gaedcke Colorectal (A), sabates-bellver (B), skrzpczak colorectal 2 (C) and zou colon (D) and derived from Oncomine database grouped by normal tissues (N) and colorectal cancer (T). (E) WWP1 mRNA expression in 32 pairs of CRC tissues via RT-qPCR. (F) WWP1 protein expression in 12 pairs of CRC tissues via Western blot. (G) RT-qPCR and Western blots show the WWP1 expression in five CRC cell lines and the nonmalignant NCM460 cells. P-values were calculated by Paired t-test.

WWP1 expression is associated with clinicopathological features in CRC patients

To better understand the significance of WWP1 expression in CRC, immunohistochemistry was used to assess the expression of WWP1 protein in 348 paraffin embedded CRC specimens. The immunostaining for WWP1 was observed in the cytoplasm of CRC cells, and 58.91% (205/348) of CRC samples displayed high expression of WWP1, while the other 41.09% (143/348) samples showed normally (Figure 2). Then, the correlation of the protein level with the clinicopathologic parameters was analyzed. Table 2 showed the correlation between WWP1 and clinicopathologic factors, and the up-regulation of WWP1 was significantly associated with tumor size (≤5 cm vs. >5 cm; P=0.022), CEA level (≤5 ng/ml vs. >5 ng/ml; P=0.021), T classification (T1-2 vs. T3-4; P=0.010), distant metastasis (absent vs. present; P=0.021) and TNM stage (I vs. II vs. III vs. IV; P=0.005). Whereas, no significant association was observed between the WWP1 expression and the other clinicopathologic factors, such as gender, age, tumor location, lymph node metastasis.

Figure 2.

WWP1 expression in CRC was determined by immunochemistry. A. Negative expression of WWP1. B. Positive expression level of WWP1. Representative images are shown at × 200 and × 400 magnification, respectively.

Table 2.

Correlations between WWP1 expression and clinicopathologic features in 348 colorectal cancer patients

Clinicopathological feature		Expression of WWP1
	Total 348	Low (n=143, 41.09%)	High (n=205, 58.91%)	P value (χ2 test)
Age (years)
<65	199	78 (39.20)	121 (60.80)	0.406
≥65	149	65 (43.62)	84 (56.38)
Gender
Male	196	82 (41.84)	114 (58.16)	0.748
Female	152	61 (40.13)	91 (59.87)
Tumor location
Rectum	197	88 (44.67)	109 (55.33)	0.126
Colon	151	55 (36.42)	96 (63.58)
Tumor size
≤5 cm	177	62 (35.03)	115 (64.97)	0.022
>5 cm	171	81 (47.37)	90 (52.63)
CEA level
≤5 ng/ml	158	54 (34.18)	104 (65.82)	0.021
>5 ng/ml	190	89 (46.84)	101 (53.16)
T classificattion
T1-2	135	67 (49.63)	68 (50.37)	0.010
T3-4	213	76 (35.68)	137 (64.32)
Lymph node metastasis
Absent	161	73 (45.34)	88 (54.66)	0.156
Present	187	70 (37.43)	117 (62.57)
Distant metastasis
Absent	287	126 (43.90)	161 (56.10)	0.021
Present	61	17 (27.87)	44 (72.13)
TNM stage (AJCC)
Stage I	52	31 (59.62)	21 (40.38)	0.005
Stage II	90	33 (36.67)	57 (63.33)
Stage III	145	62 (42.76)	83 (57.24)
Stage IV	61	17 (27.87)	44 (72.13)

Values in parentheses indicate percentage values. The bold number represents the P-values with significant differences.

Elevated WWP1 expression predicts poor prognosis in patients with CRC

To determine the prognostic value of WWP1 for CRC, the relationship between WWP1 expression and the clinical follow-up data was analyzed using Kaplan-Meier survival curves and the log-rank test. The results showed patients with high expression of WWP1 had a significantly shorter overall survival (OS) and disease-free survival (DFS) than those with low expression (Figure 3), (P<0.001 and P=0.001, respectively, log-rank test).

Figure 3.

WWP1 is correlated with OS and DFS rate in CRC patients. Kaplan-Meier survival curves show high expression of WWP1 is associated with a bad OS (P<0.001) (A) and a shoeter DFS (P=0.001) (B). P-values were calculated by log-rank test.

To directly identify the risk factors associated with OS in CRC patients, univariate and multivariate analysis were performed to confirm that WWP1 represents an independent risk factor for poor prognosis. Univariate Cox regression analysis indicated that WWP1 expression, tumor size, CEA level and TNM stage were significantly associated with OS. What’s more, WWP1 expression, tumor size and TNM stage were independent predictors of OS in multivariate Cox regression analysis (Table 3), (P=0.038, 0.032 and 0.000, respectively). These data indicated that high expression of WWP1 may be a predictor for diagnosis and prognosis in colorectal cancer patients.

Table 3.

Univariate and multivariate analyses of prognostic parameters for survival in 254 colorectal cancer patients

	Univariate analysis			Multivariate analysis
Prognostic parameter	HR	95% CI	P value	HR	95% CI	P value
Expression of WWP1 (low vs. high)	2.084	1.418-3.062	0.000	1.510	1.021-2.232	0.038
Age (<65 vs. ≥65)	1.208	0.824-1.771	0.333	-	-	-
Gender (female vs. male)	1.264	0.876-1.825	0.210	-	-	-
Tumor Size (≤5 cm vs. >5 cm)	1.664	1.128-2.455	0.010	1.534	1.036-2.272	0.032
CEA level (≤5 ng/ml vs. >5 ng/ml)	1.589	1.086-2.326	0.017	1.366	0.930-2.006	0.112
Tumor location (rectum vs. colon)	0.762	0.525-1.105	0.152	-	-	-
TNM stage (I vs. II vs. III vs. IV)	2.264	1.772-2.891	0.000	2.142	1.654-2.774	0.000

HR: Hazard ratio; CI: Confidence interval. The bold number represents the P-values with significant differences.

WWP1 enhances the proliferation and invasion of colorectal cancer cells in vitro

To test whether WWP1 promoted CRC cell proliferation and invasion, we silenced WWP1 in HCT116 and SW480 cells with siRNA-WWP1 or overexpressed WWP1 in SW620 and HT29 cells with plasmids by transient transfection. The transfection efficiency was confirmed by RT-qPCR and Western blot (Figures 4A, 4B, 5A, 5B). Then, we performed CCK-8 assays and transwell assays. The results showed silencing of WWP1 notably blocked the proliferation and invasion of HCT116 and SW480 cells compared with control (Figure 4C-E). While cells with WWP1 overexpression had a prominently higher proliferative and invasive capacity than negative control in SW620 and HT29 cells (Figure 5C-E). These results showed that WWP1 promoted a more proliferative and invasive phenotype in colorectal cancer cells.

Figure 4.

Knock-down of WWP1 inhibited proliferation and invasion in CRC cell. A, B. WWP1 knockdown efficiency was confirmed by RT-qPCR and Western blot in HCT116 and SW480 cells. C, D. Effects of WWP1 knockdown on proliferation was evaluated by CCK-8 assays. E. Effects of Rab3D knockdown on invasion was measured by Transwell assays. Results shown are the mean ± SEM (*P<0.05, **P<0.01, ***P<0.001) of triplicate determination from three independent experiments.

Figure 5.

Overexpression of WWP1 promoted migration and invasion in CRC cell. A, B. WWP1 overexpression efficiency was confirmed by RT-qPCR and Western blot in SW620 and HT-29 cells. C, D. Effects of WWP1 overexpression on proliferation was evaluated by CCK-8 assays. E. Effects of WWP1 overexpression on invasion was measured by Transwell assay. Results shown are the mean ± SEM (**P<0.01, ***P<0.001) of triplicate determination from three independent experiments.

WWP1 activates PTEN/Akt pathway to promote CRC progression

According to previous studies, PTEN/Akt signaling pathway is associated with cell proliferation in normal adults, as well as in cancers, especially in colorectal cancer cells [19]. To investigate which signaling pathway is affected by WWP1, we performed western blot assays to determine the expression levels of PTEN, phospho-Akt. Compared with untreated cells, silenced WWP1 significantly decreased the p-Akt expression, and decreased the PTEN expression (Figure 6A, 6B). Collectively, the data above indicates that WWP1 mediates PTEN/Akt pathway in colorectal cancer.

Figure 6.

WWP1 activates PTEN/Akt signaling pathway in colorectal cancer cells. A, B. Expression of PTEN, p-Akt and Akt protein were determined in HCT116 and SW480 cells transfected with siRNA-WWP1. Results shown are the mean ± SEM (*P<0.05, **P<0.01, ***P<0.001) of triplicate determination from three independent experiments.

WWP1 through PTEN/Akt pathway promote tumor growth in vivo

To verify the effects of WWP1 on tumorigenesis in vivo, si-WWP1 or control siRNA was directly injected into the CRC implanted tumor, and found si-WWP1 significantly decreased tumor growth (Figure 7A, 7B). Furthermore, the protein expression of p-Akt was markedly decreased, while the PTEN was increased significantly in the si-WWP1 treated with mice compared with that in control (Figure 7C, 7D). Taken together, these results demonstrate that WWP1 plays a crucial role on CRC progression by activating PTEN/Akt pathway.

Figure 7.

si-WWP1 inhibited tumor growth in vivo. A. Tumor xenograft volume in si-WWP1-treated nude mice was smaller than that in the mock group. B. Tumor xenograft growth in si-WWP1-treated nude mice was slower than that in the mock group. C, D. PTEN, p-Akt, Akt protein expression were examined in the tumor xenografts. Results shown are the mean ± SEM (*P<0.05, **P<0.01, ***P<0.001) of triplicate determination from three independent experiments.

Discussion

Our data suggest that WWP1 mRNA and protein is highly expressed in colorectal cancer tissues, and is tightly associated with patients’ overall survival and disease free survival. Stepwise investigation shows that WWP1 is the independent prognostic factors CRC patients. Furthermore, we verified that WWP1 activated PTEN/Akt pathway to promote cell proliferation and invasion in CRC. Therefore, our data suggest WWP1 may be a novel biomarker for therapy the patients with CRC.

WWP1 is located at 8q21, a region frequently amplified in human cancer [20-22]. Recently, studies have showed WWP1 is overexpression in a variety of tumors and is tightly associated with the prognosis of the patients with many tumors [21-24]. Several studies confirmed that the levels of WWP1 mRNA and protein were frequently increased in human breast cancer and prostate cancer to promote cell proliferation by inactivate of TGFbeta function [23,24]. Furthermore, Cheng et al. found that WWP1 was up-regulated in human hepatocellular carcinoma, and knock-down of WWP1 could inhibit cell growth and induced apoptosis by activating caspase 3 and p53 [25]. What’s more, other research found the high expression of WWP1 was associated with poor prognosis in hepatocellular carcinoma [26]. These studies indicate WWP1 may be an oncogenic factor in these tumors to promote the tumor development and progression. Conversely, known-down of WWP1 could inhibit cell apoptosis in breast cancer, and low expression of WWP1 had a worse prognosis in the patients [18]. Similar results were observed in the head and neck squamous cell carcinoma [27]. These findings suggest that WWP1 may be a tumor suppressor in some type of tumors.

Consistent with WWP1 expression was up-regulated in a large number of tumors, we confirmed that WWP1 was overexpressed in human colorectal cancer in both mRNA and protein level. And then, the Kaplan-Meier and correlation analysis showed that higher expression of WWP1 was associated with poor prognosis and was an independent predictor of patients’ survival. Furthermore, WWP1 could promote a more proliferative and invasive phenotype in colorectal cancer cells by CCK-8 assays and Transwell assays. Our work firstly investigated the function of WWP1 and suggested it also act as an oncogene in colorectal cancer.

Many studies revealed that WWP1 could manipulate multiple signaling pathways, including TGFβ signaling pathway [23] and EGF signaling pathway [28]. Additionally, PTEN/Akt pathway is a critical mediator of oncogenic signaling in varies of tumors [29]. Currently, Nedd4, belongs to NEDD4-like proteins family, decreased PTEN level and promoted Akt signaling pathway in cancer cells [30]. These studies suggest that WWP1 also belongs to NEDD4-like proteins family and may be an essential regulator in PTEN/Akt signaling pathway in colorectal cancer. Based on the studies mentioned above, we found WWP1 depletion significantly increased PTEN level and reduced p-Akt level in vitro and in vivo experiments, indicating that biological functions exerted by WWP1 may be tightly associated with PTEN/Akt pathway in colorectal cancer. Furthermore, Seo SR et al. found WWP1 suppressed the expression of TbR1, Smad2 and JunB to increased proliferation in cancer cells [31]. Current studies also showed WWP1 suppressed the expression of TbR1, Smad4, and the cell cycle-dependent kinase inhibitor p15 in PC-3 [8]. It seems that WWP1 promotes cell proliferation and survival in both ubiquitin ligase-dependent and -independent way. So our next work is aimed to investigate the target molecular or signaling of WWP1 in colorectal cancer cells.

In summary, this study demonstrated that WWP1 overexpression is associated with poor survival in CRC patients, and WWP1 through PTEN/Akt pathway promotes proliferative and invasive phenotype of CRC cells. These suggest that WWP1 expression may serve as an important prognostic marker and may represent a potential molecular target for the treatment of CRC.

Disclosure of conflict of interest

None.