Abstract
Correct patterning of the nervous system is essential for an organism’s survival and complex behavior. Embryologists have used the sea urchin as a model for decades, but our understanding of sea urchin nervous system patterning is incomplete. Previous histochemical studies identified multiple neurotransmitters in the pluteus larvae of several sea urchin species. However, little is known about how, where and when neural subtypes are differentially specified during development. Here, we examine the molecular mechanisms of neuronal subtype specification in 3 distinct neural subtypes in the Lytechinus variegatus larva. We show that these subtypes are specified through Delta/Notch signaling and identify a different transcription factor required for the development of each neural subtype. Our results show achaete-scute and neurogenin are proneural for the serotonergic neurons of the apical organ and cholinergic neurons of the ciliary band, respectively. We also show that orthopedia is not proneural but is necessary for the differentiation of the cholinergic/catecholaminergic postoral neurons. Interestingly, these transcription factors are used similarly during vertebrate neurogenesis. We believe this study is a starting point for building a neural gene regulatory network in the sea urchin and for finding conserved deuterostome neurogenic mechanisms.
Keywords: Neurogenesis, sea urchin, Achaete-Scute, Neurogenin, Orthopedia, neural progenitor
INTRODUCTION
Numerous transcription factors and signaling pathways regulate neurogenesis, and changes in neurogenic gene regulatory networks underlie the diversity in patterning of nervous systems. At the same time, there are examples of common signaling pathways and shared gene families that are essential for the specification and differentiation of neurons throughout metazoans (Marlow et al., 2014; Sinigaglia et al., 2013; Wei et al., 2009). When considering the evolution of the nervous system, there are many questions left unanswered such as which regulatory networks, signaling pathways and developmental mechanisms were part of the “toolkit” of the bilaterian ancestor (Hartenstein and Stollewerk, 2015). A thorough understanding of the mechanisms that drive neural development in diverse taxa can enable us to reconstruct the ancestral bilaterian nervous system and infer how nervous systems evolved (Hartenstein and Stollewerk, 2015).
In bilaterians, the acquisition of a neural fate involves several steps. The first is early expression of proneural transcription factors in the ectoderm to select neural progenitors from the rest of the ectoderm (Huang et al., 2014). In this initial specification process, some cells in the ectoderm begin to express a proneural transcription factor at a higher level relative to surrounding cells which triggers increased expression of the Notch ligand Delta (Bertrand et al., 2002; Huang et al., 2014). This elevated expression of Delta in the presumptive neural progenitors initiates Notch-mediated lateral inhibition, which causes a salt- and-pepper pattern of neuroblasts within the ectoderm (Artavanis-Tsakonas, et al., 1999; Castro et al., 2006; Kageyama et al., 2009). Downstream of Delta expression, neural transcription factors direct progenitors toward a neuronal fate, and control differentiation of precursors into specific neuronal subtypes (Bertrand et al., 2002; Simionato et al., 2008; Huang et al., 2014).
To understand how these pathways come together during development it has been of value to explore organisms that are relatively simple. As such, the sea urchin embryo, with relatively few neurons to consider, provides a unique opportunity to study regulatory networks that drive neurogenesis in a basal deuterostome. The sea urchin nervous system is made up of the apical organ, which is a neuroepithelium located at the anterior end of the embryo and the ciliary band, an ectodermal region made up of neurons and ciliated cells positioned between the oral and aboral ectoderm. It is believed that the apical organ acts as a central nervous system, since it expresses a set of genes that are similar to those expressed in the developing vertebrate forebrain (Range, 2014; Wei et al., 2009) and because axonal tracts lead from the ciliary band to the apical organ (Burke et al., 2014). The ciliary band is the functioning peripheral nervous system in the sea urchin embryo and is thought to contain a variety of neurons which control the coordinated beating of cilia (Mackie et al., 1969; Satterlie and Andrew Cameron, 1985; Strathmann, 2007). Recent studies have shown that the early sea urchin larval nervous system consists of about 40–50 neurons (Wei et al., 2015). It has also been shown that all neural progenitors express the transcription factors SoxB, SoxC and then Brn1/2/4 and that this particular order of expression is required for the specification and differentiation of all neurons (Garner et al., 2016). However, it is unclear how many subtypes of neurons are present in the sea urchin embryo and how neural subtype identity is determined. Also unknown is the extent to which Delta/Notch signaling functions in L. variegatus neural development, which transcription factors are proneural, and which transcription factors control differentiation of neuron subtypes.
Here we provide an overview of the types of neurons present in the L. variegatus larval nervous system based on the expression of several enzymes required for neurotransmitter synthesis. Through differential gene expression, we show that there are at least 4 subtypes of neurons present by 48 hours of development. We then focus on the three subtypes that are specified and differentiate in the ectoderm, and show that all three are under the influence of Delta/Notch signaling. We provide an example of a transcription factor that is expressed exclusively in a single neuronal subtype and show by perturbations that each transcription factor is required for the proper specification or differentiation of only that subtype. These data suggest that Lv-achaete-scute (Lv-ac/sc) is proneural and is required for the specification of serotonergic neurons in the apical organ. Lv-neurogenin (Lv-ngn) is also a proneural transcription factor, being required for the specification of the ciliary band neurons. Lv-orthopedia (Lv-otp) is expressed in the postoral neurons, which we show are both cholinergic and catecholaminergic. Perturbations of Lv-otp show that orthopedia is required for the differentiation of the postoral neurons. Interestingly, these transcription factors function in a similar manner during vertebrate neural patterning, which suggests that there are conserved modes of neurogenesis between sea urchin and chordates. This study can be used as a starting point to expand the sea urchin developmental gene regulatory network (GRN) to include neurogenesis and the specification of different populations of neurons.
RESULTS
Overview of embryonic L. variegatus neuronal fates
The sea urchin larval nervous system is composed of two ectodermal territories: the neuroepithelial apical organ which functions as a central nervous system and peripheral neurons that differentiate in and near the ciliary band (Fig. 1D) (Garner et al., 2016). Previous studies using histochemical and immunological techniques showed expression of several neurotransmitters in cells and axonal tracts of the ciliary band of late stage plutei of other sea urchin species (Bisgrove and Burke, 1987; Katow et al., 2016; Sutherby et al., 2012). Those studies did not attempt to examine the molecular mechanisms that led to the diversification of neurons. Before determining how correct patterning of the nervous system is achieved, we first defined different sub-populations of neurons present in the embryonic nervous system of L. variegatus. We did this by examining the spatial expression of several enzymes essential for the synthesis of neurotransmitters which we use as markers for fully differentiated neurons. Our analysis demonstrates that there are at least four subtypes of neurons present in the L. variegatus larval nervous system (Fig. 1, Fig. S1). One subtype is the previously identified serotonergic neurons in the apical organ which express tryptophan 5-hydroxylase (Lv-tph), an enzyme required for serotonin synthesis (Yaguchi and Katow, 2003). Lv-tph mRNA expression begins at late gastrula stage and persists through development in 2–4 bilaterally symmetric serotonergic neurons in the apical organ (Fig. 1A). A second neuronal subtype expresses tyrosine hydroxylase (Lv-th) and choline acetytransferase (Lv-chat), enzymes essential for the synthesis of catecholamines and acetylcholine, respectively (Fig. 1B, 1E). Expression of Lv-chat and Lv-th mRNA begins at late gastrula stage at 18 hours post fertilization (hpf) in cells that make up two symmetric patches in the oral ectoderm (Fig. S1A,E). As development proceeds, Lv-chat and Lv-th mRNA expression expands to a line of neurons in the postoral ectoderm (Fig. 1B, 1E, Fig. S1A–D′, E–G). This neuronal subtype, identified previously by a pan neural marker, has been referred to as the “postoral neurons” because of their relative position in the sea urchin embryo (Burke et al., 2014). It was shown previously that neurons near the base of the larval arms of sea urchin embryos express TH (Adams et al., 2011), but at the time the postoral neurons had not been defined and the fact that they also synthesize acetylcholine was unknown. Double whole mount in situ hybridizations confirm that expression of Lv-chat in the postoral neurons coincides with expression of Lv-th, which shows that these neurons are both cholinergic and catecholaminergic (Fig. 1E).
Figure 1. Overview of the L. variegatus embryonic nervous system.
(A–C) Fluorescent whole mount in situ hybridization shows 3 different neural subtypes: serotonergic neurons express Lv-tph (A), postoral neurons express Lv-chat (B) and ciliary band neurons also express Lv-chat (C). (D) Schematic showing overview of neurons present in 48 hour pluteus larva of L. variegatus. (E) Double fluorescent in situ hybridization shows co-expression of Lv-chat with Lv-th in the postoral neurons in the maximum intensity Z projection. Area in square shown in panels as composite or single channel of a single confocal section. (F) Double fluorescent in situ (maximum intensity Z projection) shows the serotonergic neurons and the ciliary band cholinergic neurons are different cell types and do not co-express Lv-chat and Lv-tph. Area in rectangle shown in panels as composite or single channel of maximum intensity projection. Nuclei (blue) in fluorescent images stained with Hoechst. hr- hour post fertilization, PL-Pluteus, Oral-oral view, Aboral- aboral view. Scale bars: 50 um.
The third neuronal subtype in the L. variegatus embryo is found throughout the ciliary band. Once differentiated, these neurons express Lv-chat, which first appears in the ciliary band at about 39 hours post fertilization (Fig. 1C, Fig. S1H–H′). By 48 hpf, additional Lv-chat expressing cells are added to the ciliary band and are found in a more oral position in the ciliary band relative to the serotonergic neurons. Cells of the fourth neuronal subtype in the sea urchin embryo are found in the gut. Some of these neurons (2–4 cells surrounding the mouth and anus) express Lv-th at pluteus stage (Fig. S1C′–C″). Neurons in the gut have been shown to be specified de novo in the endoderm of sea urchin embryos and will not be the focus in this paper (Wei et al., 2011). Taken together, we show that by 48 hours of development, there are only 40–50 neurons present in the L. variegatus larva. This small number of neurons is formed and patterned without complicated tissue layer movements which can allow for a clear dissection of the gene regulatory network inputs required for nervous system patterning (Angerer et al., 2011; Burke et al., 2014, 2006).
All three neural subtypes are subject to Delta/Notch signaling
A conserved aspect of neurogenesis in metazoans, the Notch signaling pathway controls when and where in the neuroectoderm neurons arise (Hartenstein and Stollewerk, 2015). Expression of the Notch ligand delta in L. variegatus is initially restricted to endomesoderm until about 12 hpf when it begins to be expressed in neural progenitors in the oral ectoderm (Fig 2B). By 14 hpf, delta is expressed in neural progenitors in the apical organ as well (Fig. 2C). As development proceeds, additional cells in the oral ectoderm express delta (Fig. 2D–H).
Figure 2. Delta-notch signaling regulates the correct number and location of neurons.
(A–H) Whole mount in situ hybridization of delta expression. (A) At 10 hpf (hour post fertilization), delta expression is strictly endomesodermal. (B)At 12 hpf, cells in the oral ectoderm begin to express delta. (C) By 14 hpf expression extends to the apical organ. Delta-expressing cells are continually added to the ectoderm through 24 hpf and beyond. (I–P) Perturbations using a delta morpholino result in an increased number neurons belonging to all three neural subtypes. (I–J) Delta knockdown results in more serotonergic neurons in the apical organ, marked by Lv-tph expression (n=84, 76%). (K–N) Delta knockdown results in more postoral neurons marked by Lv-chat (n=78, 78%) and Lv-th (n=52, 69%). (O–P) Embryos injected with a delta MO have an increased number of ciliary band neurons at 48 hpf marked by Lv-chat (n= 75, 89%). ‘n’ represents the total number of embryos scored, and the percentage indicates the percent of embryos scored with the shown effect. See Fig. S2 for explanation of focal plane shown in (O). Scale bars: 50 um. Embryos cultured at 22° C. Endo- endomesoderm expression, Oral ecto- oral ectoderm, Ap. Organ- apical organ. Nuclei (blue) in fluorescent images stained with Hoechst.
Treatment with the γ-secretase inhibitor DAPT (N- [N-(3,5-difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester) to inhibit Notch signaling or inhibition of Delta using a morpholino (MO) results in an increase in the number of neurons and the neural progenitors in related echinoderm species (Wei et al., 2011; Yaguchi et al., 2012; Yankura et al., 2013; Mellott et al., 2017). However, it is unclear whether Delta/Notch signaling effects all neural subtypes in the sea urchin embryo and the effect of Notch signaling on neurogenesis has not been shown in L. variegatus. We therefore used a Delta morpholino (MO) to specifically inhibit translation of the Notch-ligand and assessed the effect on individual neuron subtypes in the larval nervous system. Injection of Delta MO results in an increase in the number of neurons for all three subtypes (serotonergic, postoral, and ciliary band neurons) compared to controls (Fig. 2I–P). We conclude that Delta-Notch signaling is used by all three neural subtypes as a lineage restriction mechanism in L. variegatus.
Lv-achaete-scute is proneural for serotonergic neurons in the apical organ
In the neuroectoderm of animal embryos, expression of proneural transcription factors is required to select neural progenitors from the rest of the ectoderm. To determine how the three identified neuronal subtypes are differentially specified in L. variegatus, we focused on three transcription factors that were expressed in only one subtype of neuron. To determine whether those transcription factors operate as proneural specifiers or downstream in differentiation of a subtype of neural precursors, we determined whether that transcription factor acted upstream of Delta signaling.
We focused on an achaete-scute family ortholog in the sea urchin, Lv-achaete-scute (Burke et al., 2006). In situ hybridizations over a time course of developmental stages showed that Lv-achaete-scute is expressed beginning at mesenchyme blastula stage (14 hpf) in 1–2 cells in the developing apical organ (Fig. 3A). This is the same time point at which delta begins to be expressed in neural progenitors of the apical organ (Fig. 2C). Lv-achaete-scute expression remains in the apical organ through pluteus stage (Fig. 3A–D).
Figure 3. Expression of three neurogenic transcription factors in L. variegatus.
(A–D) Expression of Lv-achaete-scute begins at 14 hours post fertilization (hpf) in the apical organ and remains there through pluteus stage. (E–H) Expression of Lv-neurogenin begins in two bilaterally symmetric patches in the oral ectoderm at 18 hpf and then appears in the ciliary band beginning at prism stage. (G–H) Lv-ngn expression remains restricted to cells in the ciliary band in pluteus larva. (I–L) Expression of Lv-orthopedia begins in 2–4 cells in the post oral ectoderm at mid-gastrula stage and expression is found in the line of postoral neurons through pluteus larval stage. (M) Confocal maximum intensity projection shows expression of Lv-ngn does not overlap with Lv-chat expression in the oral ectoderm at late gastrula stage. Cells that express Lv-ngn are anterior to the position of the postoral neurons, marked here by Lv-chat expression. (N) Confocal maximum intensity projection shows at pluteus stage Lv-ngn and Lv-chat are expressed in different neural subtypes with no overlap of expression. (O) Confocal maximum intensity projection shows Lv-ngn expressing neural cells are not the serotonergic neurons of the apical organ because expression does not overlap with expression of Lv-tph. To confirm that the two genes are not expressed in the same cells, combined and split channels of the maximum intensity projection are provided (the region of the embryo shown in the right insets is highlighted by white box). Nuclei (blue) in fluorescent images stained with Hoechst. Scale bars: 50 um. MB-mesenchyme blastula, MG-mid gastrula, LG-late gastrula, PR-prism, PL-pluteus.
In order to examine whether a transcription factor is proneural, knockdowns must result in a loss of delta expression (Huang et al., 2014). To determine if Lv-achaete-scute is proneural, we used a translation blocking morpholino antisense oligonucleotide (MO) designed to target the translation start site and looked for expression of delta by whole mount in situ hybridization. We found that Lv-achaete-scute knockdown embryos retain expression of delta in the ventral ectoderm, but lose expression of delta in the apical organ domain (Fig. 4A–B′). This suggests that Lv-achaete-scute is upstream of delta expression in the apical organ and therefore is proneural in that location. Confirming a role in the serotonergic neurons, we find that embryos injected with achaete-scute MO lose Lv-tph mRNA expression in the apical organ (Fig. 4C–D). Co-injection of full length Lv-achaete-scute RNA coding sequence with Lv-achaete-scute morpholino resulted in a rescue of the serotonergic neurons, confirming the specificity of the morpholino (Fig. S3). In situ hybridization with probes for the other neuronal subtypes (in the rest of the ciliary band and the postoral neurons) showed that these neuronal subtypes are unaffected by Lv-achaete-scute knockdowns (Fig. S4). This suggests that in the sea urchin, achaete-scute is a proneural gene that is necessary for the specification of only the serotonergic neurons in the apical organ.
Figure 4. Perturbations show Lv-achaete-scute is proneural for serotonergic neurons.
(A–D) Perturbations using an Lv-achaete-scute translation-blocking morpholino (MO) shows Lv-ac/sc is upstream of delta (n=197, 94%) and tph (n=130, 72%) in the apical organ which suggests that Lv-achaete-scute is proneural for the serotonergic neurons. A′ and B′ are oral view images the same embryo shown in either A or B. Arrowheads in B′ show delta expressing cells present in the oral ectoderm. Dotted line indicates apical organ. (E–F) Injection of full length achaete-scute RNA results in increased number of serotonergic neurons in the apical organ. ‘n’ represents the total number of embryos scored, and the percentage indicates the percent of embryos scored with the shown effect, μ equals the average number of tph-expressing cells per embryo. (G) A single Apotome section shows that Lv-ac/sc expressing cells in the apical organ also express delta at 14 hpf. (H) A single Apotome section shows that Lv-ac/sc expressing cells in the apical organ also express Lv-tph, confirming Lv-ac/sc is expressed in the serotonergic neurons of the apical organ. Arrowhead shows an example of adjacent cells where one cell expresses Lv-ac/sc and the other expresses Lv-tph. To confirm that the two genes are expressed in the same cells in (G) and (H), combined and split channels of a single Apotome section are provided (the region of the embryo shown in the right insets is highlighted by white box). Scale bars: 50 um. Nuclei (blue) in fluorescent images stained with Hoechst.
To test whether ectopic expression of Lv-achaete-scute is sufficient to specify additional ectopic serotonergic neurons, we injected single cell zygotes with full length capped Lv-achaete-scute RNA. Embryos injected with 50ng/ul of RNA exhibited an increase in the number of serotonergic neurons in the apical organ when fixed at 27 hpf (Fig. 4E–F) and 48 hpf (Fig. S5). This increase in neuron number is specific only to serotonergic neurons in the apical organ because embryos injected with Lv-achaete-scute RNA do not show an increase in the number of postoral neurons (Fig. S5D–G). This along with the knockdown experimental data, shows that Lv-achaete-scute is necessary to drive specification of the serotonergic neural subtype in the apical organ and confirms that Lv-achaete-scute is proneural for the serotonergic neurons. In the embryos injected with full length RNA, additional serotonergic neurons were not randomly specified throughout the ectoderm but were found in increased numbers only in the apical organ. This suggests that cells must be competent to receive the proneural cue from Lv-achaete-scute, again supporting the conclusion that its proneural role is specific to the serotonergic neurons.
To confirm that the effects of knockdown and overexpression of Lv-achaete-scute are likely cell autonomous in the serotonergic neurons, we performed double whole mount in situ hybridization with delta and Lv-tph. These experiments show that at 14 hpf there are cells in the apical organ that co-express Lv-achaete-scute and delta in the apical organ (Fig 4G). At the pluteus stage there are cells in the apical organ that co-express Lv-achaete-scute and Lv-tph (Fig. 4H), suggesting that Lv-achaete-scute acts in the serotonergic neurons themselves to specify fate. There are examples, however of cells in the apical organ which express Lv-ac/sc but not Lv-tph, and often cells that express Lv-ac/sc are directly adjacent to a cell that expresses Lv-tph (arrowhead in Fig. 4H). The expression of Lv-ac/sc and Lv-tph in adjacent cells could be because 1) Lv-ac/sc is expressed in some serotonergic neural precursors that do not yet express Lv-tph but will later in development, 2) Lv-ac/sc is expressed in some neural progenitors that will divide and give rise to serotonergic neurons 3) Lv-ac/sc is expressed in additional cell types in the apical organ. Nevertheless, these results confirm that Lv-achaete-scute is proneural and acts on a specific subset of neurons in the developing nervous system.
Lv-neurogenin is proneural for ciliary band neurons
Based on developmental in situ hybridizations, the L. variegatus neurogenin ortholog, Lv-ngn, begins to be expressed at the late gastrula stage in two bilaterally symmetric territories in the oral ectoderm in an area anterior to the postoral neurons expressing Lv-chat (Fig. 3E,M). At prism and pluteus stages, expression is found in a salt and pepper pattern throughout the ciliary band (Fig. 3F–H). The neural cells that express Lv-ngn are not the postoral or the serotonergic neurons because they do not co-localize with either Lv-tph or Lv-chat at pluteus stage (Fig. 3M–O).
To determine whether Lv-ngn is proneural or involved in neural differentiation we injected zygotes with a translation blocking morpholino designed near the translation start site of Lv-ngn. In neurogenin knockdown embryos, expression of delta mRNA was diminished at early pluteus stage particularly in and around the ciliary band (Fig. 5A–B). This suggests that Lv-neurogenin is upstream of delta and is proneural in the ciliary band. Confirming its role in neural specification in the ciliary band, Lv-neurogenin knockdown embryos showed a decrease of expression of Lv-chat in the ciliary band at 48 hpf (Fig. 5C–D). Knockdown of Lv-ngn did not affect expression of Lv-tph, Lv-th, or Lv-chat in the postoral neurons which shows that the specification of these neurons does not depend on Lv-ngn (Fig. S6A–F). To confirm morpholino specificity, we injected embryos with a second morpholino designed near the translation start site and found the same effects (Fig. 5E–H, Fig. S6G–L). These results indicate that Lv-ngn is proneural in the sea urchin and is necessary for the specification of a subtype of neuron, the cholinergic neurons in the ciliary band.
Figure 5. Perturbations show Lv-neurogenin is proneural for ciliary band neurons.
(A–H) Perturbations using two different Ngn MOs show Lv-ngn is upstream of delta (MO1: n=83, 86% downregulated; MO2: n=60, 82% downregulated) and Lv-chat expression in the ciliary band at 48 hrs (MO1: n=67, 75% downregulated; MO2: n=107, 87% downregulated), which suggests that Lv-ngn is proneural for neurons in the ciliary band. See Fig. S2 for explanation of focal planes shown in (C–D, G–H). ‘n’ represents the total number of embryos scored, and the percentage indicates the percent of embryos scored with the shown effect. Arrowheads in (D) and (H) show the Lv-chat-expressing postoral neurons are still specified in Ngn knockdown embryos. (I–J) Fluorescent whole mount double in situ hybridization shows that Lv-ngn co-expresses with delta. (I) A single confocal section shows that Lv-ngn expressing cells in the ectoderm also express delta at a time before the Lv-ngn cells are in the ciliary band. (J) A maximum intensity projection on the left panel shows that later in development, once Lv-ngn cells are in the ciliary band, they continue to express Lv-delta. (K) Shows Lv-Ngn cells in the ciliary band express Lv-chat at 40 hpf. To confirm that the two genes are expressed in the same cells, combined and split channels of a single confocal section are provided (the region of the embryo shown in the right insets is highlighted by white box). Scale bars: 50 um. Nuclei (blue) in fluorescent images stained with Hoechst.
To confirm whether the effects of neurogenin knockdown are cell autonomous, we performed double whole mount in situ hybridization with Lv-ngn and Lv-delta or Lv-chat. These data show that Lv-ngn is co-expressed with delta at late gastrula stage, before these cells are in the ciliary band and at pluteus stage when Lv-ngn expression is in the ciliary band (Fig. 5I–J). Furthermore, at a later pluteus stage (40 hpf) cells in the ciliary band that express Lv-ngn also express Lv-chat (Fig. 5K). This suggests that the effects of neurogenin knockdown on neurons in the ciliary band are cell autonomous.
To determine whether Lv-ngn is sufficient to drive specification of ciliary band neurons, we injected zygotes with full-length capped Lv-ngn mRNA. Embryos injected with Lv-ngn RNA did not show an increase in the expression of Lv-chat in the ciliary band at 48hpf, nor did it show ectopic expression of Lv-chat elsewhere in the embryo (Fig. S7). This suggests that Lv-ngn may require co-factors for proper transcriptional binding or that Lv-ngn is used in combination with other transcription factors to specify the ciliary band neurons. Taken together, these data suggest that Lv-ngn is required for the specification of cholinergic ciliary band neurons, but alone is not sufficient to drive neurogenesis in L. variegatus.
Lv-orthopedia is required for differentiation of dopaminergic/cholinergic neurons
In the sea urchin, the homeobox transcription factor orthopedia was previously shown to be expressed in the ventral ectoderm beginning at mid-gastrula stage in two bilaterally symmetric domains of the oral ectoderm (Di Bernardo et al., 1999). As development proceeds through pluteus stage, Lv-otp expressing cells form a line of cells in the oral ectoderm (Fig. 3I–L). Previous studies in a related sea urchin species, Paracentrotus lividus, suggested that otp is involved in ectoderm patterning of skeletal morphogenesis (Di Bernardo et al., 1999; Cavalieri et al., 2003). We show by double in situ hybridization that these orthopedia expressing ectodermal cells are in fact the postoral neurons, which co-express Lv-chat and Lv-th by late gastrula stage (Fig. 6N). Since Lv-otp is expressed in the postoral neurons, we asked whether it was involved in specification of this neural subtype.
Figure 6. Perturbations show Lv-orthopedia is necessary for differentiation of postoral neurons.
(A–B, G–H) Perturbations using two different Otp MOs show Lv-otp is not upstream of delta expression in the postoral neuroblasts (MO1: n=131, 96% unchanged; MO2: n=101, 91% unchanged) or in other neural cells of the embryo. Arrowheads show examples of postoral neural cells that express delta. (C–F, I–L) Lv-otp is upstream of Lv-chat (MO1: n=196, 66% downregulated; MO2: n=201, 75% downregulated) and Lv-th (MO1: n=104, 76% downregulated; MO2: n=31, 97% downregulated) in the oral ectoderm. ‘n’ represents the total number of embryos scored, and the percentage indicates the percent of embryos scored with the shown effect. These data suggest that Orthopedia is required for the differentiation of the dopaminergic/cholinergic postoral neurons in L. variegatus, acting downstream of delta. (M) A single confocal section shows that Lv-otp expressing cells in the oral ectoderm also express delta. (N) A maximum intensity projection on the left panel shows that later in development, the Lv-otp expressing cells in the oral ectoderm will become the postoral neurons, which express Lv-chat. To confirm that the two genes are expressed in the same cells, combined and split channels of a single confocal section are provided (the region of the embryo shown in the right insets is highlighted by white box). Scale bars: 50 um. Nuclei (blue) in fluorescent images stained with Hoechst.
To determine whether Lv-otp is proneural or involved in downstream differentiation of the postoral neurons, we injected zygotes with a translation blocking morpholino designed to target the start site and a second MO near the start site in the 5′ UTR. When Lv-otp was perturbed using either morpholino, we saw by in situ hybridization that expression of delta was unaffected both in the postoral neural precursors as well as in other areas of the embryo (Fig. 6A–B, G–H). Nevertheless, Otp knockdown embryos exhibited a loss of Lv-th and Lv-chat when fixed at 24 hpf (Fig. 5C–F, I–L). These data suggest that Otp is not proneural since it is not upstream of delta expression in L. variegatus, but it is required for the proper differentiation of the postoral neurons. Perturbation of Lv-otp had no effect on the development of the serotonergic neurons or the cholinergic neurons in the ciliary band when fixed after 48 hours (Fig. S8). However, when examining Lv-chat mRNA expression in the Otp knockdown embryos fixed at 54 hours, it appears that there may be a rescue of Lv-chat expression in the postoral neurons. Rescue of expression of Lv-chat in the postoral neurons is not surprising given that the postoral neurons are still specified and express delta when Otp is perturbed and the embryos were fixed over 48 hours after injection. Double whole mount in situ hybridization shows that Lv-otp is co-expressed with delta at 16 hpf (mid gastrula stage), (Fig. 6M). This suggests that the effects of orthopedia knockdown are cell autonomous.
DISCUSSION
Towards a sea urchin neurogenic gene regulatory network
Until now, the sea urchin larval nervous system was largely treated as a system that was patterned as unit with 2 types of neurons: serotonergic neurons and all other neurons that were treated as a single entity. It was previously shown that there are genes that are expressed in all neurons/neural progenitors, with certain transcription factors (such as SoxC and Brn1/2/4) being required broadly for neurogenesis (Garner et al., 2016; Wei et al., 2015). Here, using a combination of gene expression and perturbation analysis, we characterize the L. variegatus nervous system as consisting of at least 4 subtypes of neurons by 48 hours of development, each with their own unique expression profile. For the 3 neuronal subtypes that are specified in the ectoderm, we show an example of a single transcription factor expressed uniquely in that subtype that is necessary for proper differentiation. Given that these 3 neural subtypes rely on a different transcription factor for proper development and that they ultimately go on to express different combinations of neurotransmitters, they must each have their own unique gene regulatory network subcircuits (Fig. 7A–C). While these data show differences, we also show shared features of the gene regulatory network subcircuits for these neuron subtypes, as all 3 subtypes rely on Delta/Notch signaling to regulate the correct number and location of neurons.
Figure 7. Gene regulatory network subcircuits operating in each neural subtype.
(A–C) Schematics show the effect of transcription factor perturbations on the L. variegatus nervous system. Biotapestry models show the gene regulatory network subcircuit each gene is acting in (Longabaugh et al., 2005). (A) Knockdown and overexpression of Lv-ac/sc results in less or more serotonergic neurons in the L. variegatus apical organ, respectively. (B) Knockdown of Lv-ngn results in a loss of ciliary band cholinergic neurons (C) Knockdown of Lv-otp results in loss of cholinergic/catecholaminergic postoral neurons. (D) Phylogenetic tree showing relative positions of vertebrates, echinoderms, and protostome groups. Shapes represent the different transcription factors; colors represent function found in each clade. Data from Platynereis, vertebrates, and sea urchins suggest shared functions of Achaete-Scute and Neurogenin. We propose the GRN subcircuit containing Orthopedia is conserved with vertebrates and is likely ancient to the deuterostome lineage, however further analyses need to be carried out with Orthopedia orthologues in protosome groups to determine if the subcircuit evolved earlier (blue triangle). Data taken from (Simionato et al., 2008) (Lu, et al., 2012) (Stolfi et al., 2015)(Vervoort and Ledent, 2001)(Huang et al., 2014)(Bertrand et al., 2002)(Ghysen and Dambly-Chaudière, 1988)(Skeath and Carroll, 1994)(Ma et al., 1998)(Ma et al., 1999)(Ma et al., 1996)(Sommer et al., 1996)(Roybon et al., 2010)(Bush et al., 1996)(Yuan et al., 2016)(Ryu et al., 2007)(Fernandes et al., 2013)(Mummery-widmer et al., 2009).
Together, L. variegatus and a related sea urchin species S. purpuratus, which have very similar developmental GRNs, represent one of the most complete experimentally documented deuterostome developmental GRNs up to and including the time of neurulation (Davidson, 2010; Hinman and Cheatle Jarvela, 2014; McClay, 2011; Oliveri and Davidson, 2004). This study, along with ones before it (Garner et al., 2016; Yaguchi et al., 2012) can be used as a starting point to create and expand the GRN for sea urchin neurogenesis. Over time, more transcription factors and signaling molecules can be added to expand the GRN subcircuits presented here.
Observations made in this study also present new questions that are unanswered about the patterning of the sea urchin nervous system. Based on the spatial expression of delta, there are more neural progenitors in the oral ectoderm than neurons in the larva. It has recently been shown in the sea urchin S. purpuratus that neural progenitors divide in the oral ectoderm and produce two daughter cells: one neural precursor and one cell that will undergo apoptosis (Mellott et al., 2017). In other systems, such as the developing mouse brain, apoptosis is essential to avoid hyperproliferation of neuronal stem cells (Blaschke et al., 1996; Sommer and Rao, 2002). Such a scenario is likely the case in the L. variegatus embryo, where a proportion of delta expressing neural progenitors in the ectoderm are fated to undergo apoptosis. Additionally, many cells that express delta in the oral ectoderm are located at distances from the ciliary band or postoral ectoderm where neurons will arise (in some cases ~50 um). This presents the question of whether some neural cells undergo a coordinated migration to their final positions in the embryo. Live imaging coupled with lineage tracing of neural progenitors will be required to determine whether this is the case in the sea urchin.
Transcription factors are often used for more than one developmental process in controlling expression of genes in the embryo. Only a restricted number of them are dedicated to a single process such as neurogenesis. Of the genes we examined in the sea urchin, achaete-scute and neurogenin are largely limited to roles in neurogenesis while orthopedia is also published as a gene involved in skeletal growth in the sea urchin. This is surprising given that Otp in most, if not all other organisms, is associated almost exclusively with neural or neuroendocrine development (Fernandes et al., 2013; Ryu et al., 2007; Simeone et al., 1994). Two publications in a related sea urchin embryo concluded that Otp governs skeletal patterning by possibly triggering an ectodermal signaling pathway to positively promote skeletogenesis (Di Bernardo et al., 1999; Cavalieri et al., 2003). By in situ analysis, the authors saw a similar sequential pattern of otp expression in the ectoderm as we report here. However, here we show that these otp- expressing ectodermal cells are neurons based on co-expression analysis with neurotransmitter synthesis enzymes. Consistent with previous data, we found that knockdown of Otp resulted in no apparent effect on the expression levels of the skeletal marker msp130 (Fig. S9A–B). We also found that the higher volumes of MO delivered resulted in embryos that were severely delayed and lacked skeletal spicules (Fig. S9E–F), and Otp knockdown embryos had shorter arms compared to controls (Fig. S9C–D). At a molecular level, these skeletal phenotypes could be an off-target effect or it could be a neural input to skeletal patterning. There is evidence that dopamine signaling in the sea urchin, which we show here is acting at least in part through the otp expressing postoral neurons, can affect arm length in pre-feeding sea urchin larvae in response to food abundance (Adams et al., 2011). More work is required to determine the mechanism by which neural patterning and function can elicit a morphogenic response in the sea urchin.
The evolution of neural gene regulatory networks
Gene regulatory network (GRN) analyses have the potential for revealing ancestral modes of neurogenesis used by bilaterians and therefore is a major focus in studies of the evolution of the nervous system. As echinoderms, sea urchins are a basally branching deuterostome group that are closely related to chordates. Echinoderms have been largely excluded from studies on the origins of neurogenesis because adults have pentaradial symmetry, a trait thought to be highly derived (Angerer et al., 2011; Burke et al., 2006). However, echinoderm embryos and larva are bilaterally symmetric, can be experimentally perturbed, and have simple embryonic development (Angerer et al., 2011; McClay, 2011). When taken together, the phylogenetic position, along with the tractability to molecular techniques, the ease with which developmental GRNs can be created and the simplicity of their development at the time of neurogenesis make echinoderms an excellent model to study the origins of the deuterostome nervous system GRN.
Achaete-scute, neurogenin, and orthopedia function in three neuronal subtypes in the sea urchin, and their apparent function is strikingly similar to their function in vertebrates. Lv-achaete-scute and Lv-neurogenin belong to the bHLH family of transcription factors and have differing roles during neurogenesis between ecdysozoan and vertebrate models (Simionato et al., 2008). In Drosophila, achaete-scute (Ac/Sc) genes are essential for specification of neural identity in ectodermal cells and are the main proneural bHLH genes for the central nervous system (Ghysen and Dambly-Chaudière, 1988; Simionato et al., 2008; Skeath and Carroll, 1994). In the nematode c. elegans, there are two Ac/Sc genes involved in neurogenesis, hlh-3 and hlh-14, one of which, hlh-14, is proneural and is necessary for the specification of neuroblast lineages that will generate neurons of distinct functions (Doonan et al., 2008; Frank et al., 2003). In mice, there are two achaete-scute genes, one of which, acsl1/mash1, is expressed in the developing nervous system (Huang et al., 2014). While the vertebrate ortholog, acsl1 is also proneural, it only functions as a neural specification gene in certain cellular contexts, and contributes to neural specification only in a small subset of cells in the central and enteric nervous systems (Huang et al., 2014). Functional differences of orthologues between species also exist for genes belonging to the neurogenin family. The vertebrate neurogenin genes (neurog1, neurog2, and neurog3) are essential for broad neuronal specification and are the main proneural bHLH genes in the central and peripheral nervous systems of vertebrate embryos (Ma et al., 1996; Sommer et al., 1996; Ma et al., 1998, 1999; Roybon et al., 2010; Huang et al., 2014). In contrast to the broad specification roles of neurogenin genes in vertebrates, the single Drosophila neurogenin ortholog, tap/biparous, has no apparent role in specification and is only involved in differentiation (downstream of Delta signaling) and axon outgrowth in a small subset of neural cells (Bush et al., 1996; Yuan et al., 2016). The sea urchin, as a basally branching deuterostome can be an informative model to clarify when these differences arose in evolution and can help reconstruct ancestral features of neurogenesis.
This study confirms that Lv-achaete-scute is proneural in the sea urchin and acts only on a specific subset of neurons in the developing nervous system, a role more similar to vertebrates. Data presented here also indicates that Lv-ngn is proneural in the sea urchin, which is a function conserved with vertebrates and different from Drosophila. Expression data for neurogenin and achaete-scute in the protostome annelids Platynereis dumerilii and Capitella suggests that these genes are also proneural (Meyer and Seaver, 2009; Simionato et al., 2008; Sur et al., 2017). In fact, it has been proposed based on expression data that Platynereis uses its achaete-scute ortholog as a proneural gene specifically for its population of serotonergic neurons, the exact role we find in the sea urchin (Simionato et al., 2008). This expression data in annelid models along with our experiments in the sea urchin suggests that the use of achaete-scute and neurogenin as proneural genes could have evolved in the common ancestor of all bilaterians. We propose that this ancestor developed its nervous system with achaete-scute being used to specify a population of serotonergic neurons and neurogenin used to specify another neural subtype(s) (Fig. 7D).
In the postoral neurons we focused on orthopedia, a homeobox transcription factor expressed in areas of the central nervous system of mice and in the hypothalamus of tetrapods shown to have a prominent role in ventral diencephalic dopaminergic differentiation (Ryu et al., 2007). Otp knockout zebrafish and mice exhibit a loss of th expression in the hypothalamus but these perturbations do not eliminate markers for neural precursors, suggesting that Otp is used not in a proneural fashion but in the differentiation of neurons in vertebrates (Ryu et al., 2007). In Drosophila, orthopedia is expressed throughout the ventral nerve cords and in the hindgut (Gramates et al., 2017). It is suggested from a Drosophila screen that orthopedia has a role upstream of Delta-Notch lateral inhibition, but the function of orthopedia in the fly embryo during neurogenesis is still unclear (Mummery-widmer et al., 2009). However, the nearly identical role of Otp in the differentiation of dopaminergic neurons in both sea urchins and vertebrates suggests that this transcription factor may be a component of an ancient deuterostome GRN used by the common ancestor of echinoderms and chordates. In Platynereis, otp is expressed in neurosecretary cell types but the role of otp in these cells is untested (Tessmar-Raible et al., 2007). The role of orthopedia orthologs in arthropods and other species outside of deuterostomes needs to be examined to determine if this function evolved earlier (Fig. 7D).
Comparisons of nervous system GRNs in several model organisms suggests that neurogenesis across the animal kingdom is generally well conserved. How well conserved across metazoans is still an open question. Up to this point, neural development studies in non-traditional model organisms have been largely descriptive and lack functional data because functional analyses are only now gaining traction in many organisms. While the three GRN subcircuits presented here are likely conserved along the deuterostome lineage, these depictions represent a fraction of GRNs operating during neurogenesis. As the sea urchin neural GRN expands, there certainly will be more opportunities for comparative studies to find conserved and derived modes of neurogenesis. Furthermore, through the expansion of the neural GRN in the sea urchin, we will have a better understanding of the transcriptional targets of neural transcription factors and how that gives rise to the nervous system in the pluteus larva. Together, the ease of creating GRNs in the sea urchin combined with the simple development of the embryo at the time of neurogenesis gives the sea urchin the potential to become a deuterostome model for the molecular mechanisms that occur during neural patterning.
MATERIALS AND METHODS
Adult animals and embryo culture
Adult L. variegatus were from the Duke University Marine Lab (Beaufort, NC, United States), Reeftopia (Key West, FL, United States), or Pelagic Corp. (Sugarloaf Key, FL, United States). Gametes were harvested by injection of 0.5 M KCl into the adult and embryos were cultured at 22°C in filtered artificial seawater (ASW).
Cloning and whole mount in situ hybridization
The full length or partial coding sequences for transcription factors and neurotransmitter genes were obtained by designing primers against a transcriptome data set. PCR was carried out with High Fidelity Phusion Master Mix (NEB). Accession numbers: Achaete-Scute: KY766875, Neurogenin: KY766876, Orthopedia: AY445031.1, Chat: KY766877, TH: KY766878, Tph: KY766879. In situ hybridization (ISH) was performed using antisense RNA probes labeled with Digoxigenin-11-UTP (Roche). Embryos were fixed overnight at 4°C in 4% paraformaldehyde made in filtered artificial sea water (FASW), washed with FASW, and stored in methanol at −20°C. RNA probes were synthesized in vitro and hybridized at 65°C. Probes were visualized using AP-conjugated anti-DIG antibody (1:1500, Roche [Indianapolis, IN, United States]). Color was developed using NBT/BCIP (Roche). For double fluorescent in situ hybridization, a second probe labeled with Fluorescein-12-UTP was hybridized. For all double in situ hybridization except those featuring Lv-achaete-scute, expression of both the Dig and Flu labeled probes were detected using a Tyramide Signal Amplification system (TSA-plus kit, Perkin Elmer [Waltham, MA, United States]). Double in situ hybridization were visualized with a Zeiss LSM 510 inverted confocal microscope. For double ISH with Lv-achaete-scute probe, Dig-labeled Lv-ac/sc probes were developed using NBT/BCIP and the Flu-labeled probe was detected with the TSA kit. These Lv-achaete-scute double ISH were visualized using the far red autofluorescence of the NBT/BCIP precipitate on a Zeiss Axio Imager with an Apotome.2. DIC images were taken with a Zeiss upright Axio Imager.
Morpholino and RNA microinjections
Morpholino antisense oligonucleotides were designed against the start site of translation or 5′ UTR by GeneTools. Morpholino sequences and concentrations are as listed in Table 1. Morpholinos and mRNA were diluted in molecular-grade H20 and FITC injectable dye. All experiments were carried out at least twice and cultured at 22°C. For embryos injected with standard control morpholino, images shown for each experiment are representatives of observed in greater than 90% of injected embryos. To test the specificity of the Ngn and Otp morpholinos, we ordered a second, distinct morpholino to the 5′ UTR and verified using in situ hybridization (Fig. 5, 6; Fig. S6, S8). Full length Lv-achaete-scute RNA was synthesized using the mMessage mMachine Kit (Invitrogen) and injected at a concentration of 50 ng/ul. For rescue experiments, full length Lv-achaete-scute RNA was co-injected at 100ng/ul with morpholino concentration listed in Table 2. Full length Lv-neurogenin was also synthesized with mMessage kit and injected at concentrations of 250, 500, and 700 ng/ul, none of which produced a phenotype.
Table 1.
Sequences and concentrations of morpholinos used in this study.
| MO | MO Sequence | MO Type | Working Concentration |
|---|---|---|---|
| Lv-Delta | GTGCAGCCGATTCGTTATTCCTTT | Translation Blocking | .75mM |
| Lv-AcSc | ACAATGTTCTCCATTTTGTGTCTTT | Translation Blocking | .75mM |
| Lv-Ngn MO1 | GCGCTGTTGACCCATCGTTTTGTTC | Translation Blocking | .75mM |
| Lv-Ngn MO2 | ATGGATATGCCCTTCTCCTCTAATT | Translation Blocking | .75mM |
| Lv-Otp MO1 | ACATGGGCTAGAGTTCGCTCCATTC | Translation Blocking | .75mM |
| Lv-Otp MO2 | ATACCCGGAGACAAGTCCTGAGGAA | Translation Blocking | .75mM |
| Control MO | CTTCTTACCTCAGTTACAATTTATA | Translation Blocking | .75mM |
Supplementary Material
HIGHLIGHTS.
Sea urchin embryos have 3 subtypes of neurons that differentiate in the ectoderm.
Achaete-scute is proneural for serotonergic neurons in the apical organ.
Neurogenin is proneural for cholinergic neurons in the ciliary band.
Orthopedia is required for differentiation of the postoral neurons.
All 3 transcription factors are used similarly during vertebrate neurogenesis.
Acknowledgments
Acknowledgements and Funding Sources
We would like to thank the members of the McClay lab as well as Drs Megan Martik, Deirdre Lyons and Gregory Wray for providing constructive and insightful feedback on the manuscript and Brianna Peskin for contributions to the paper during her laboratory rotation. This material is based upon work supported by the National Science Foundation Graduate Research Fellowship Program under Grant No. (NSF DGF 1106401) (to LAS) and NIH (RO1-HD-14483 and NIH PO1-HD-037105) (to DRM).
The funder had no role in study design, data collection and interpretation, or the decision to submit the work for publication.
Funding Sources
This work was supported by: National Science Foundation GRFP grant DGF 1106401 to Leslie A. Slota.
National Institute of Child Health and Human Development (NICHD) NIH RO1-HD-14483 to David R McClay.
National Institute of Child Health and Human Development (NICHD) NIH PO1-HD-037105 to David R McClay.
Footnotes
Competing Interests
The authors declare no competing interest or financial interests.
Author Contributions
L.A.S conducted and designed experiments, wrote manuscript and prepared figures. D.R.M supervised the study and revised/reviewed manuscript and figures.
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
References
- Adams DK, Sewell Ma, Angerer RC, Angerer LM. Rapid adaptation to food availability by a dopamine-mediated morphogenetic response. Nat Commun. 2011;2:592. doi: 10.1038/ncomms1603. https://doi.org/10.1038/ncomms1603. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Angerer LM, Yaguchi S, Angerer RC, Burke RD. The evolution of nervous system patterning: insights from sea urchin development. Development. 2011;138:3613–23. doi: 10.1242/dev.058172. https://doi.org/10.1242/dev.058172. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Artavanis-Tsakonas S, Rand M, Lake R. Notch Signaling: Cell Fate Control and Signal Integration in Development. Science (80- ) 1999;284:770–776. doi: 10.1126/science.284.5415.770. https://doi.org/10.1126/science.284.5415.770. [DOI] [PubMed] [Google Scholar]
- Bertrand N, Castro DS, Guillemot F. Proneural genes and the specification of neural cell types. Nat Rev Neurosci. 2002;3:517–30. doi: 10.1038/nrn874. https://doi.org/10.1038/nrn874. [DOI] [PubMed] [Google Scholar]
- Bisgrove BW, Burke RD. Development of the nervous system of the pluteus larva of Strongylocentrotus droebachiensis. Cell Tissue Res. 1987;248:335–343. https://doi.org/10.1007/BF00218200. [Google Scholar]
- Blaschke aJ, Staley K, Chun J. Widespread programmed cell death in proliferative and postmitotic regions of the fetal cerebral cortex. Development. 1996;122:1165–1174. doi: 10.1242/dev.122.4.1165. [DOI] [PubMed] [Google Scholar]
- Burke RD, Angerer LM, Elphick MR, Humphrey GW, Yaguchi S, Kiyama T, Liang S, Mu X, Agca C, Klein WH, Brandhorst BP, Rowe M, Wilson K, Churcher aM, Taylor JS, Chen N, Murray G, Wang D, Mellott D, Olinski R, Hallböök F, Thorndyke MC. A genomic view of the sea urchin nervous system. Dev Biol. 2006;300:434–60. doi: 10.1016/j.ydbio.2006.08.007. https://doi.org/10.1016/j.ydbio.2006.08.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Burke RD, Moller DJ, Krupke Oa, Taylor VJ. Sea urchin neural development and the metazoan paradigm of neurogenesis. Genesis. 2014;14 doi: 10.1002/dvg.22750. n/a-n/a. https://doi.org/10.1002/dvg.22750. [DOI] [PubMed] [Google Scholar]
- Bush a, Hiromi Y, Cole M. Biparous: a novel bHLH gene expressed in neuronal and glial precursors in Drosophila. Dev Biol. 1996;180:759–772. doi: 10.1006/dbio.1996.0344. https://doi.org/10.1006/dbio.1998.9154. [DOI] [PubMed] [Google Scholar]
- Castro DS, Skowronska-Krawczyk D, Armant O, Donaldson IJ, Parras C, Hunt C, Critchley JA, Nguyen L, Gossler A, Göttgens B, Matter JM, Guillemot F. Proneural bHLH and Brn Proteins Coregulate a Neurogenic Program through Cooperative Binding to a Conserved DNA Motif. Dev Cell. 2006;11:831–844. doi: 10.1016/j.devcel.2006.10.006. https://doi.org/10.1016/j.devcel.2006.10.006. [DOI] [PubMed] [Google Scholar]
- Cavalieri V, Spinelli G, Di Bernardo M. Impairing Otp homeodomain function in oral ectoderm cells affects skeletogenesis in sea urchin embryos. Dev Biol. 2003;262:107–118. doi: 10.1016/s0012-1606(03)00317-8. https://doi.org/10.1016/S0012-1606(03)00317-8. [DOI] [PubMed] [Google Scholar]
- Davidson EH. Emerging properties of animal gene regulatory networks. Nature. 2010;468:911–20. doi: 10.1038/nature09645. https://doi.org/10.1038/nature09645. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Di Bernardo M, Castagnetti S, Bellomonte D, Oliveri P, Melfi R, Palla F, Spinelli G. Spatially restricted expression of PlOtp, a Paracentrotus lividus orthopedia-related homeobox gene, is correlated with oral ectodermal patterning and skeletal morphogenesis in late-cleavage sea urchin embryos. Development. 1999;126:2171–9. doi: 10.1242/dev.126.10.2171. [DOI] [PubMed] [Google Scholar]
- Doonan R, Hatzold J, Raut S, Conradt B, Alfonso A. HLH-3 is a C. elegans Achaete/Scute protein required for differentiation of the hermaphrodite-specific motor neurons. Mech Dev. 2008;125:883–893. doi: 10.1016/j.mod.2008.06.002. https://doi.org/10.1016/j.mod.2008.06.002. [DOI] [PubMed] [Google Scholar]
- Fernandes AM, Beddows E, Filippi A, Driever W. Orthopedia transcription factor otpa and otpb paralogous genes function during dopaminergic and neuroendocrine cell specification in larval zebrafish. PLoS One. 2013;8:e75002. doi: 10.1371/journal.pone.0075002. https://doi.org/10.1371/journal.pone.0075002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Frank CA, Baum PD, Garriga G. HLH-14 is a C. elegans achaete-scute protein that promotes neurogenesis through asymmetric cell division. Development. 2003;130:6507–18. doi: 10.1242/dev.00894. https://doi.org/10.1242/dev.00894. [DOI] [PubMed] [Google Scholar]
- Garner S, Zysk I, Byrne G, Kramer M, Moller D, Taylor V, Burke RD. Neurogenesis in sea urchin embryos and the diversity of deuterostome neurogenic mechanisms. 2016:286–297. doi: 10.1242/dev.124503. https://doi.org/10.1242/dev.124503. [DOI] [PubMed]
- Ghysen A, Dambly-Chaudière C. From DNA to form: the achaete-scute complex. Genes Dev. 1988;2:495–501. doi: 10.1101/gad.2.5.495. https://doi.org/10.1101/gad.2.5.495. [DOI] [PubMed] [Google Scholar]
- Gramates LS, Marygold SJ, dos Santos G, Urbano J-M, Antonazzo G, Matthews BB, Rey AJ, Tabone CJ, Crosby MA, Emmert DB, Falls K, Goodman JL, Hu Y, Ponting L, Schroeder AJ, Strelets VB, Thurmond J, Zhou P the FlyBase Consortium. FlyBase at 25: looking to the future. Nucleic Acids Res. 2017;45(D1):D663–D671. doi: 10.1093/nar/gkw1016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hartenstein V, Stollewerk A. The Evolution of Early Neurogenesis. Dev Cell. 2015;32:390–407. doi: 10.1016/j.devcel.2015.02.004. https://doi.org/10.1016/j.devcel.2015.02.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hinman VF, Cheatle Jarvela AM. Developmental gene regulatory network evolution: Insights from comparative studies in echinoderms. Genesis. 2014;52:193–207. doi: 10.1002/dvg.22757. https://doi.org/10.1002/dvg.22757. [DOI] [PubMed] [Google Scholar]
- Huang C, Chan Ja, Schuurmans C. Current topics in developmental biology. 1. Elsevier Inc; 2014. Proneural bHLH Genes in Development and Disease. https://doi.org/10.1016/B978-0-12-405943-6.00002-6. [DOI] [PubMed] [Google Scholar]
- Kageyama R, Ohtsuka T, Shimojo H, Imayoshi I. Dynamic regulation of Notch signaling in neural progenitor cells. Curr Opin Cell Biol. 2009;21:733–740. doi: 10.1016/j.ceb.2009.08.009. https://doi.org/10.1016/j.ceb.2009.08.009. [DOI] [PubMed] [Google Scholar]
- Katow H, Katow T, Yoshida H, Kiyomoto M, Uemura I. Immunohistochemical and ultrastructural properties of the larval ciliary band-associated strand in the sea urchin Hemicentrotus pulcherrimus. Front Zool. 2016;13:27. doi: 10.1186/s12983-016-0159-8. https://doi.org/10.1186/s12983-016-0159-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Longabaugh WJR, Davidson EH, Bolouri H. Computational representation of developmental genetic regulatory networks. Dev Biol. 2005;283:1–16. doi: 10.1016/j.ydbio.2005.04.023. https://doi.org/10.1016/j.ydbio.2005.04.023. [DOI] [PubMed] [Google Scholar]
- Lu TM, Luo YJ, Yu JK. BMP and Delta/Notch signaling control the development of amphioxus epidermal sensory neurons: insights into the evolution of the peripheral sensory system. Development. 2012;139:2020–2030. doi: 10.1242/dev.073833. https://doi.org/10.1242/dev.073833. [DOI] [PubMed] [Google Scholar]
- Ma Q, Chen Z, Barrantes IDB, De La Pompa JL, Anderson DJ. Neurogenin1 Is Essential for the Determination of Neuronal Precursors for Proximal Cranial Sensory Ganglia. Neuron. 1998;20:469–482. doi: 10.1016/s0896-6273(00)80988-5. https://doi.org/10.1016/S0896-6273(00)80988-5. [DOI] [PubMed] [Google Scholar]
- Ma Q, Fode C, Guillemot F, Anderson DJ. NEUROGENIN1 and NEUROGENIN2 control two distinct waves of neurogenesis in developing dorsal root ganglia. Genes Dev. 1999;13:1717–1728. doi: 10.1101/gad.13.13.1717. https://doi.org/10.1101/gad.13.13.1717. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ma Q, Kintner C, Anderson DJ. Identification of neurogenin, a vertebrate neuronal determination gene. Cell. 1996;87:43–52. doi: 10.1016/s0092-8674(00)81321-5. https://doi.org/10.1016/S0092-8674(00)81321-5. [DOI] [PubMed] [Google Scholar]
- Mackie GO, Spencer AN, Strathmann R. Electrical activity associated with ciliary reversal in an echinoderm larva. Nature. 1969;223:1384. [Google Scholar]
- Marlow H, Tosches MA, Tomer R, Steinmetz PR, Lauri A, Larsson T, Arendt D. Larval body patterning and apical organs are conserved in animal evolution. BMC Biol. 2014;12:7. doi: 10.1186/1741-7007-12-7. https://doi.org/10.1186/1741-7007-12-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- McClay DR. Evolutionary crossroads in developmental biology: sea urchins. Development. 2011;138:2639–48. doi: 10.1242/dev.048967. https://doi.org/10.1242/dev.048967. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mellott DO, Thisdelle J, Burke RD. Notch signaling patterns neurogenic ectoderm and regulates the asymmetric division of neural progenitors in sea urchin embryos. Development. 2017 doi: 10.1242/dev.151720. https://doi.org/10.1242/dev.151720. [DOI] [PubMed]
- Meyer NP, Seaver EC. Neurogenesis in an annelid: Characterization of brain neural precursors in the polychaete Capitella sp I. Dev Biol. 2009;335:237–252. doi: 10.1016/j.ydbio.2009.06.017. https://doi.org/10.1016/j.ydbio.2009.06.017. [DOI] [PubMed] [Google Scholar]
- Mummery-widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA. Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi. Nature. 2009;458:987–992. doi: 10.1038/nature07936. https://doi.org/10.1038/nature07936. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Oliveri P, Davidson EH. Gene regulatory network controlling embryonic specification in the sea urchin. Curr Opin Genet Dev. 2004;14:351–360. doi: 10.1016/j.gde.2004.06.004. https://doi.org/10.1016/j.gde.2004.06.004. [DOI] [PubMed] [Google Scholar]
- Range R. Specification and positioning of the anterior neuroectoderm in deuterostome embryos. Genesis. 2014;52:222–34. doi: 10.1002/dvg.22759. https://doi.org/10.1002/dvg.22759. [DOI] [PubMed] [Google Scholar]
- Roybon L, Mastracci TL, Ribeiro D, Sussel L, Brundin P, Li JY. GABAergic differentiation induced by Mash1 is compromised by the bHLH proteins Neurogenin2, NeuroD1, and NeuroD2. Cereb Cortex. 2010;20:1234–44. doi: 10.1093/cercor/bhp187. https://doi.org/10.1093/cercor/bhp187. [DOI] [PubMed] [Google Scholar]
- Ryu S, Mahler J, Acampora D, Holzschuh J, Erhardt S, Omodei D, Simeone A, Driever W. Orthopedia homeodomain protein is essential for diencephalic dopaminergic neuron development. Curr Biol. 2007;17:873–80. doi: 10.1016/j.cub.2007.04.003. https://doi.org/10.1016/j.cub.2007.04.003. [DOI] [PubMed] [Google Scholar]
- Satterlie RA, Andrew Cameron R. Electrical activity at metamorphosis in larvae of the sea urchin Lytechinus pictus (Echinoidea: Echinodermata) J Exp Zool. 1985;235:197–204. https://doi.org/10.1002/jez.1402350206. [Google Scholar]
- Simeone A, D’Apice MR, Nigro V, Casanova J, Graziani F, Acampora D, Avantaggiato V. Orthopedia, a novel homeobox-containing gene expressed in the developing CNS of both mouse and drosophila. Neuron. 1994;13:83–101. doi: 10.1016/0896-6273(94)90461-8. https://doi.org/10.1016/0896-6273(94)90461-8. [DOI] [PubMed] [Google Scholar]
- Simionato E, Kerner P, Dray N, Le Gouar M, Ledent V, Arendt D, Vervoort M. atonal- and achaete-scute-related genes in the annelid Platynereis dumerilii: insights into the evolution of neural basic-Helix-Loop-Helix genes. BMC Evol Biol. 2008;8:170. doi: 10.1186/1471-2148-8-170. https://doi.org/10.1186/1471-2148-8-170. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sinigaglia C, Busengdal H, Leclère L, Technau U, Rentzsch F. The Bilaterian Head Patterning Gene six3/6 Controls Aboral Domain Development in a Cnidarian. PLoS Biol. 2013:11. doi: 10.1371/journal.pbio.1001488. https://doi.org/10.1371/journal.pbio.1001488. [DOI] [PMC free article] [PubMed]
- Skeath JB, Carroll SB. The achaete-scute complex: generation of cellular pattern and fate within the Drosophila nervous system. FASEB J. 1994;8:714–721. doi: 10.1096/fasebj.8.10.8050670. [DOI] [PubMed] [Google Scholar]
- Sommer L, Ma Q, Anderson DJ. neurogenins, a novel family of atonal-related bHLH transcription factors, are putative mammalian neuronal determination genes that reveal progenitor cell heterogeneity in the developing CNS and PNS. Mol Cell Neurosci. 1996;8:221–241. doi: 10.1006/mcne.1996.0060. https://doi.org/10.1006/mcne.1996.0060. [DOI] [PubMed] [Google Scholar]
- Sommer L, Rao M. Neural stem cells and regulation of cell number. Prog Neurobiol. 2002;66:1–18. doi: 10.1016/s0301-0082(01)00022-3. [pii] [DOI] [PubMed] [Google Scholar]
- Stolfi A, Ryan K, Meinertzhagen IA, Christiaen L. Migratory neuronal progenitors arise from the neural plate borders in tunicates. Nature. 2015;527:371–374. doi: 10.1038/nature15758. https://doi.org/10.1038/nature15758. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Strathmann RR. Time and extent of ciliary response to particles in a non-filtering feeding mechanism. Biol Bull. 2007;212:93–103. doi: 10.2307/25066587. [pii] [DOI] [PubMed] [Google Scholar]
- Sur A, Magie CR, Seaver EC, Meyer NP. Spatiotemporal regulation of nervous system development in the annelid Capitella teleta. Evodevo. 2017;8:13. doi: 10.1186/s13227-017-0076-8. https://doi.org/10.1186/s13227-017-0076-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sutherby J, Giardini JL, Nguyen J, Wessel G, Leguia M, Heyland A. Histamine is a modulator of metamorphic competence in Strongylocentrotus purpuratus (Echinodermata: Echinoidea) BMC Dev Biol. 2012;12:14. doi: 10.1186/1471-213X-12-14. https://doi.org/10.1186/1471-213X-12-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tessmar-Raible K, Raible F, Christodoulou F, Guy K, Rembold M, Hausen H, Arendt D. Conserved Sensory-Neurosecretory Cell Types in Annelid and Fish Forebrain: Insights into Hypothalamus Evolution. Cell. 2007;129:1389–1400. doi: 10.1016/j.cell.2007.04.041. https://doi.org/10.1016/j.cell.2007.04.041. [DOI] [PubMed] [Google Scholar]
- Vervoort M, Ledent V. The evolution of the neural basic Helix-Loop-Helix proteins. ScientificWorldJournal. 2001;1:396–426. doi: 10.1100/tsw.2001.68. https://doi.org/10.1100/tsw.2001.68. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wei Z, Angerer LM, Angerer RC. Neurogenic gene regulatory pathways in the sea urchin embryo. Development. 2015 doi: 10.1242/dev.125989. dev.125989-. https://doi.org/10.1242/dev.125989. [DOI] [PMC free article] [PubMed]
- Wei Z, Angerer RC, Angerer LM. Direct development of neurons within foregut endoderm of sea urchin embryos. Proc Natl Acad Sci U S A. 2011;108:9143–9147. doi: 10.1073/pnas.1018513108. https://doi.org/10.1073/pnas.1018513108. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wei Z, Yaguchi J, Yaguchi S, Angerer RC, Angerer LM. The sea urchin animal pole domain is a Six3-dependent neurogenic patterning center. Development. 2009;136:1583–1583. doi: 10.1242/dev.032300. https://doi.org/10.1242/dev.037002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yaguchi J, Angerer LM, Inaba K, Yaguchi S. Zinc finger homeobox is required for the differentiation of serotonergic neurons in the sea urchin embryo. Dev Biol. 2012;363:74–83. doi: 10.1016/j.ydbio.2011.12.024. https://doi.org/10.1016/j.ydbio.2011.12.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yaguchi S, Katow H. Expression of tryptophan 5-hydroxylase gene during sea urchin neurogenesis and role of serotonergic nervous system in larval behavior. J Comp Neurol. 2003;466:219–29. doi: 10.1002/cne.10865. https://doi.org/10.1002/cne.10865. [DOI] [PubMed] [Google Scholar]
- Yankura Ka, Koechlein CS, Cryan AF, Cheatle A, Hinman VF. Gene regulatory network for neurogenesis in a sea star embryo connects broad neural specification and localized patterning. Proc Natl Acad Sci U S A. 2013;110:8591–6. doi: 10.1073/pnas.1220903110. https://doi.org/10.1073/pnas.1220903110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yuan L, Hu S, Okray Z, Ren X, De Geest N, Claeys A, Yan J, Bellefroid E, Hassan BA, Quan X-J. The Drosophila Neurogenin, Tap, functionally interacts with the Wnt-PCP pathway to regulate neuronal extension and guidance. Development. 2016:dev.134155. doi: 10.1242/dev.134155. https://doi.org/10.1242/dev.134155. [DOI] [PMC free article] [PubMed]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.







