Skip to main content
Asian-Australasian Journal of Animal Sciences logoLink to Asian-Australasian Journal of Animal Sciences
. 2017 Nov 3;31(4):548–555. doi: 10.5713/ajas.17.0426

The effect of dietary asparagine supplementation on energy metabolism in liver of weaning pigs when challenged with lipopolysaccharide

Ping Kang 1, Yulan Liu 1,*, Huiling Zhu 1, Jing Zhang 1, Haifeng Shi 1, Shuang Li 1, Dinan Pi 1, Weibo Leng 1, Xiuying Wang 1, Huanting Wu 1, Yongqing Hou 1
PMCID: PMC5838327  PMID: 29103285

Abstract

Objective

This experiment was conducted to investigate whether asparagine (Asn) could improve liver energy status in weaning pigs when challenged with lipopolysaccharide.

Methods

Forty-eight weaned pigs (Duroc×Large White×Landrace, 8.12±0.56 kg) were assigned to four treatments: i) CTRL, piglets received a control diet and injected with sterile 0.9% NaCl solution; ii) lipopolysaccharide challenged control (LPSCC), piglets received the same control diet and injected with Escherichia coli LPS; iii) lipopolysaccharide (LPS)+0.5% Asn, piglets received a 0.5% Asn diet and injected with LPS; and iv) LPS+1.0% Asn, piglets received a 1.0% Asn diet and injected with LPS. All piglets were fed the experimental diets for 19 d. On d 20, the pigs were injected intraperitoneally with Escherichia coli LPS at 100 μg/kg body weights or the same volume of 0.9% NaCl solution based on the assigned treatments. Then the pigs were slaughtered at 4 h and 24 h after LPS or saline injection, and the liver samples were collected.

Results

At 24 h after LPS challenge, dietary supplementation with 0.5% Asn increased ATP concentration (quadratic, p<0.05), and had a tendency to increase adenylate energy charges and reduce AMP/ATP ratio (quadratic, p<0.1) in liver. In addition, Asn increased the liver mRNA expression of pyruvate kinase, pyruvate dehydrogenase, citrate synthase, and isocitrate dehydrogenase β (linear, p<0.05; quadratic, p<0.05), and had a tendency to increase the mRNA expression of hexokinase 2 (linear, p<0.1). Moreover, Asn increased liver phosphorylated AMP-activated protein kinase (pAMPK)/total AMP-activated protein kinase (tAMPK) ratio (linear, p<0.05; quadratic, p<0.05). However, at 4 h after LPS challenge, Asn supplementation had no effect on these parameters.

Conclusion

The present study indicated that Asn could improve the energy metabolism in injured liver at the late stage of LPS challenge.

Keywords: Asparagine, Energy Metabolism, Lipopolysaccharide, Piglets

INTRODUCTION

L-asparagine (Asn) is non-essential amino acid. However, previous studies have demonstrated that weaning rats required Asn over a short period [1], and Asn could stimulate growth and protein synthesis of weaning rats. In addition, Asn can stimulate enterocyte proliferation [2,3] and improve jejunal enterocyte ornithine decarboxylase (ODC) activity [3,4]. Asparagine can be synthesized from aspartate and glutamine (or ammonia) by asparagine synthetase in mammals [5,6]. However, in liver, the rate of Asn synthesis is much less because of the lower Asn synthetase activity [7].

Asn has similar structure to aspartate, and it can be deaminated to form aspartate in an ATP-dependent amidation reaction [8]. Liver plays a pivotal role in the metabolism of the whole-body energy [9], such as stimulating fatty acid oxidation and glucose generation. LPS challenge could induce liver injury [10], which could cause insufficient energy supply in the liver [11]. Xu et al [12] reported that energy was necessary for a successful stress response. Our previous study has shown that dietary supplementation of aspartate improved energy status in lipopolysaccharide (LPS)-injured liver of weaning pigs [13]. Accordingly, we hypothesized that Asn could influence the energy metabolism in the liver in LPS-challenge weaning pigs. In this study, we measured the hepatic adenylate purine concentrations and the mRNA expression of key enzymes involved in glycolysis, tricarboxylic acid (TCA) cycle and fatty acid oxidation as well as AMP-activated protein kinase (AMPK) signaling pathway to examine the influence of Asn on energy metabolism in the liver in LPS-challenged weaning pigs.

MATERIALS AND METHODS

Animals

The Animal Care and Use Committee of Wuhan Polytechnic University approved the animal use protocol for this research. This experiment was conducted in the Hubei Key Laboratory of Animal Nutrition and Feed Science (Wuhan Polytechnic University, Wuhan, China). In this study, a total of 48 weaned castrated male pigs (Duroc×Large White×Landrace, 8.12±0.56 kg, weaned at 21±2 d of age ) were purchased from the Hubei Zhengda Swine Co., Ltd (Wuhan, Hubei, China), and individually housed in the stainless steel cages (length 1.08 m, width 0.98 m, height 0.84 m). All pigs were housed in an environmentally controlled room (temperature 28°C and natural light), and allowed ad libitum access to water and feed during a 19-d experimental period.

Experimental design

Based on the BW, forty-eight piglets were randomly assigned to four treatments (two sampling times), i) non-challenged control (CTRL; piglets received a control diet and injected with 0.9% NaCl solution); ii) lipopolysaccharide (LPS)-challenged control (LPSCC; piglets received the same control diet and injected with Escherichia coli LPS ); iii) LPS+0.5% Asn treatment (piglets received a 0.5% Asn diet and injected with LPS); and iv) LPS+1.0% Asn treatment (piglets received a 1.0% Asn diet and injected with LPS). There were six replicates (n = 6) for each treatment in each sampling time, and each replicate had one pig. In this study, the dose of the Asn (L-Asn, purity >99%; Amino Acid Bio-Chemical Co, Wuhan, China) and LPS (Escherichia coli serotype 055: B5, Sigma Chemical Inc., St. Louis, MO, USA) were determined on the basis of our previous studies [14]. The control diet was prepared to meet or exceed NRC [15] nutrient requirements (Table 1), and the diets were isonitrogenous by supplementation of L-alanine (purity >99%; Amino Acid Bio-Chemical Co, China). During the entire 19 d feeding trial (pre-challenge), there were no differences in average daily gain, average daily feed intake and feed:gain ratio among the four treatment groups (data not shown). On d 19, the LPS-challenged pigs were injected intraperitoneally with 500 μg/mL Escherichia coli LPS at 100 μg/kg BW (0.2 mL/kg BW), and the pigs in control group were injected with the same volume of 0.9% NaCl solution. LPS injection caused fever, somnolence, anorexia, vomiting, and shivering within 1 h in all pigs. At 4 h or 24 h (n = 6) after LPS or saline injection, pigs were slaughtered under anesthesia with an intravenous injection of sodium pentobarbital (50 mg/kg BW), and a portion of the liver (approximately 3 g) was removed and frozen in liquid nitrogen immediately. One part of the liver sample (approximately 1 g) was used for measuring ATP, ADP, and AMP concentrations, and another part (approximately 2 g) was then stored at −80ºC for mRNA and protein expression analysis.

Table 1.

Ingredients and nutritional composition of diet (as fed basis)

Items Content
Ingredients (%)
 Corn 55.50
 Soybean meal (44% crude protein) 22.00
 Wheat bran 3.00
 Fish meal 5.50
 Corn oil or fish oil 5.00
 Soy protein concentrate 2.50
 Milk-replacer powder 3.00
 Limestone 0.70
 Dicalcium phosphate 1.00
 Salt 0.20
 L-Lysine·HCl (78.8% Lysine) 0.27
 Acidifier1) 0.20
 Butylated hydroquinone 0.05
 Preservative2) 0.05
 Sweetener3) 0.03
 Vitamin and mineral premix4) 1.00
Nutrient composition (g/kg)
 Digestible energy5) (MJ/kg) 14.0
 Crude protein6) 202
 Calcium6) 9.0
 Phosphorus6) 7.0
 Lysine6) 13.5
 Methionine+cysteine6) 7.2
 Aspartate+asparagine6) 16.9
1)

A compound acidifier including lactic acid and phosphoric acid, provided by Wuhan Fanhua Biotechnology Company, Wuhan, China.

2)

A compound mould inhibitor including calcium propionate, fumaric acid, fumaric acid monoethyl ester and sodium diacetate, provided by Sichuan Minsheng Pharmaceutical Co., Ltd, Chengdu, China.

3)

A compound sweetener including saccharin sodium and disodium 5′-guanylate, provided by Wuhan Fanhua Biotechnology Company, Wuhan, China.

4)

The premix provided the following amounts per kilogram of complete diet: retinol acetate, 2,700 μg; cholecalciferol, 62.5 μg; dl-α-tocopheryl acetate, 20 mg; menadione, 3 mg; vitamin B12, 18 μg; riboflavin, 4 mg; niacin, 40 mg; pantothenic acid, 15 mg; choline chloride, 400 mg; folic acid, 700 μg; thiamin, 1.5 mg; pyridoxine, 3 mg; biotin, 100 μg; Zn, 80 mg (ZnSO4·7H2O); Mn, 20 mg (MnSO4·5H2O); Fe, 83 mg (FeSO4·H2O); Cu, 25 mg (CuSO4·5H2O); I, 0.48 mg (KI); Se, 0.36 mg (Na2SeO3·5H2O).

5)

Calculated.

6)

Analyzed.

ATP, ADP, and AMP concentrations in the liver

The ATP, ADP, and AMP concentrations in the liver were measured with high performance liquid chromatography (HPLC) according to a published method [16]. Briefly, the supernatant was prepared from the liver. As for the HPLC, the detection wavelength was 260 nm, and the column temperature and the pump flow was 35ºC and 1.0 mL/min, respectively. Total adenine nucleotide (TAN) and adenylate energy charges (AEC) were calculated using the following equations: TAN = ATP+ ADP+AMP; AEC = (ATP+0.5ADP)/(ATP+ADP+AMP) [16].

mRNA abundance analysis by real-time PCR

Total RNA was isolated from pig liver by Trizol (#9108, TaKaRa Biotechnology [Dalian] Co., Ltd., Dalian, China). cDNA was synthesized with Prime Script RT reagent kit with gDNA eraser according to the producer instructions (#RR047A, TaKaRa Biotechnology [Dalian] Co., Ltd., China). The expression of the target genes were analyzed by the real-time polymerase chain reaction (PCR) with an Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems, Life Technologies, Foster City, CA, USA) using a SYBR Premix Ex TaqTM (Tli RNaseH Plus) qPCR kit (#RR420A, TaKaRa Biotechnology [Dalian] Co., Ltd., China). The PCR program was as follows: 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 34 s. The target genes were amplified by using the forward and reverse primers, which were designed with Primer Premier 6.0 and synthesized by TaKaRa Biotechnology (China, Table 2), and their mRNA expression relative to housekeeping gene (glyceraldehyde-3-phosphate dehydrogenase) were calculated according to the 2ΔΔCT method [17].

Table 2.

Specific primer sequences for pigs used for real-time polymerase chain reaction

Gene Forward (5′-3′) Reverse (5′-3′) Gene Bank No. Sequences bp
Hexok 2 CTCATCACAACCGTTACCA TGTCATTAGTGTCCTCATCC NM_001122987.1 119
L-PFK CTGCACCGCATCATGGA CCCCATCACCTCCAGAACA XM_003358990.1 84
PK TCACTCCACAGACCTCAT TACCTAGCCACCTGATGT XM_003356683.1 123
PDH GCAGACTTACCGTTACCAT GATAGCCGAGTTCTTCCAA XM_003360244.2 248
ACO CTCGCAGACCCAGATGAAAT TCCAAGCCTCGAAGATGAGT AF185048 218
L-CPT-1 GGACCGCCACCTGTTCTGCCTCTA GCCCCCTCCGCTCGACACATAC AF288789 175
CS TCTCAGCTCAGTGCAGCCATTACA CTGCAACACAAGGTAGCTTTGCGA NM_214276 145
ICDH β TGTGGTTCCTGGTGAGAG CGAGATTGAGATGCCGTAG XM_003361597.1 149
ICDH γ GGTGGAGAGCCTCAAGAT TGGTGGTGTTGTCTACGA XM_003360495.1 218
AMPKα1 AAATCGGCCACTACATCCTG GGATGCCTGAAAAGCTTGAG NM_001167633.1 187
AMPKα2 AACATGGACGGGTTGAAGAG CGCAGAAACTCACCATCTGA NM_214266.1 193
Sirt1 CTGGAACAGGTTGCAGGAAT CCTAGGACATCGAGGAACCA EU030283 144
PGC1α GATGTGTCGCCTTCTTGTTC CATCCTTTGGGGTCTTTGAG NM_213963 93
GAPDH CGTCCCTGAGACACGATGGT GCCTTGACTGTGCCGTGGAAT AF017079 194

Hexok 2, hexokinase 2; L-PFK, 6-phosphofructokinase (liver type-like); PK, pyruvate kinase; PDH, pyruvate dehydrogenase; ACO, acyl-coenzyme A oxidase; L-CPT-1, liver carnitine palmitoyltransferase I; CS, Citrate synthase; ICDH β, isocitrate dehydrogenase β; ICDH γ, isocitrate dehydrogenase γ; AMPK, AMP-activated protein kinase; Sirt1, silent information regulator 1; PGC1α, peroxisome proliferator activated receptor gamma coactivator-1α; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Protein abundance analysis by Western blot

The method for quantification of liver protein expression was carried out with Western blot as previously described [13]. Briefly, equal amounts of proteins in liver supernatant fluids were separated on 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then transferred to blotting membrane for immunoblotting. The specific primary antibodies included rabbit phosphorylated AMPKα (pAMPKα; Thr172; 1:1,000, #2532) and rabbit anti-total AMPKα (tAMPKα; 1:1,000, #2535) (Cell Signaling Technology Inc., Danvers, MA, USA).

Statistical analysis

The experimental data were analyzed using SPSS 17.0 software (SPSS Inc., Chicago, IL, USA). T test was used to determine whether there was a significant difference between the data obtained in the LPS group (LPSCC, 0% Asn) and the data obtained in the control group, in order to determine the effect of LPS challenge on the weaned piglets. Linear and quadratic polynomial contrasts were used to determine the response to Asn supplementation among LPS-challenged pigs. All data were expressed as means±SE. The statistical significance level for all analyses was set at p≤0.05 and 0.05<p<0.10 were considered as trends.

RESULTS

Concentrations of ATP, ADP, and AMP in the liver

As shown in Table 3, LPS challenge had no effect on the ATP, ADP, and AMP concentrations (p>0.1) at 4 or 24 h post-injection. Dietary supplementation with Asn had no effect on the concentrations of ATP, ADP, and AMP at 4 h after LPS challenge (p>0.1), however, dietary Asn supplementation increased ATP and ADP concentrations (quadratic, p<0.05), and had a tendency to increase AEC (quadratic, p<0.1) and reduce AMP/ATP ratio (quadratic, p<0.1) at 24 h after LPS challenge.

Table 3.

The effect of Asn supplementation on the ATP production in liver at 24 h after Escherichia coli lipopolysaccharide challenge in weaned pigs1)

Item CTRL2) LPSCC2) LPS+0.5% Asn2) LPS+1.0% Asn2) SEM p value

Control vs LPSCC Linear Quadratic
4 h post-challenge
 ATP (μg/g wet wt) 280 143 206 172 67 0.129 0.558 0.340
 ADP (μg/g wet wt) 143 122 142 133 32 0.308 0.789 0.865
 AMP (μg/g wet wt) 443 419 291 391 51 0.611 0.759 0.101
 TAN3) (μg/g wet wt) 866 684 639 695 85 0.086 0.836 0.684
 AEC4) 0.38 0.31 0.42 0.35 0.06 0.220 0.629 0.182
 AMP/ATP 2.18 3.17 1.54 3.17 0.91 0.230 0.918 0.171
24 h post-challenge
 ATP (μg/g wet wt) 256 218 375 223 54 0.514 0.399 0.008
 ADP (μg/g wet wt) 176 138 211 86 41 0.426 0.725 0.025
 AMP (μg/g wet wt) 365 447 431 392 60 0.147 0.467 0.713
 TAN3) (μg/g wet wt) 796 802 1017 701 114 0.962 0.93 0.038
 AEC4) 0.42 0.36 0.47 0.39 0.05 0.235 0.254 0.063
 AMP/ATP 1.67 2.25 1.28 1.77 0.41 0.271 0.133 0.098

Asn, asparagine; LPSCC, lipopolysaccharide challenged control; LPS, lipopolysaccharide; SEM, standard error of the mean; TAN, total adenine nucleotide; AEC, adenylate energy charges.

1)

Values are means±SE, n = 6 (1 pig/pen).

2)

CTRL (non-challenged control), piglets receiving a control diet and injected with 0.9% NaCl solution; LPSCC (LPS challenged control), piglets receiving the same control diet and injected with Escherichia coli LPS; LPS+0.5% Asn, piglets receiving a 0.5% Asn diet and injected with LPS; LPS+1.0% Asn, piglets receiving a 1.0% Asn diet and injected with LPS.

3)

TAN = ATP+ADP+AMP.

4)

AEC = (ATP+0.5ADP)/(ATP+ADP+AMP).

mRNA expression of genes related to the energy metabolism

As shown in Table 4, at 4 h post-injection, LPS challenge up-regulated the mRNA expression of liver hexokinase (Hexok) 2, and down-regulated the mRNA expression of 6-phosphofructokinase (liver type-like) (L-PFK), pyruvate dehydrogenase (PDH), acyl-coenzyme A oxidase, and liver carnitine palmitoyltransferase (L-CPT)-1 (p<0.05). Asn supplementation had no effect on mRNA expression of the key enzymes involved in glycolysis, TCA cycle and fatty acid oxidation after 4 h LPS challenge (p>0.1). However, at 24 h post-challenge, LPS challenge decreased mRNA expressions of PDH and citrate synthase (CS) (p<0.05). Asn supplementation increased pyruvate kinase (PK), PDH, CS, and isocitrate dehydrogenase (ICDH) β mRNA expression (linear, p<0.05; quadratic, p<0.05), and had a tendency to increase Hexok 2 mRNA expression (linear, 0.05<p <0.1) at 24 h after LPS challenge.

Table 4.

The effect of Asn supplementation on the liver carbohydrate metabolism and tricarboxylic acid cycle at 24 h after Escherichia coli LPS challenge in weaned pigs1)

Item CTRL2) LPSCC2) LPS+0.5% Asn2) LPS+1.0% Asn2) SEM p value

Control vs LPSCC Linear Quadratic
4 h post-challenge
 Carbohydrate metabolism
  Hexok 2 1.00 15.9 21.3 25.57 5.13 0.001 0.120 0.293
  L-PFK 1.00 0.44 0.69 0.52 0.14 0.002 0.291 0.163
  PK 1.00 1.67 1.46 1.54 0.27 0.399 0.573 0.787
  PDH 1.00 0.90 0.80 0.81 0.11 0.032 0.305 0.571
 Fatty acid oxidation
  ACO 1.00 0.45 0.60 0.37 0.12 0.001 0.888 0.112
  L-CPT-1 1.00 0.35 0.42 0.22 0.14 0.003 0.483 0.158
 Tricarboxylic acid cycle
  CS 1.00 0.98 0.89 0.84 0.10 0.806 0.189 0.428
  ICDH β 1.00 0.90 0.94 0.77 0.12 0.397 0.460 0.348
  ICDH γ 1.00 0.83 0.79 0.77 0.10 0.194 0.511 0.811
24h post-challenge
 Carbohydrate metabolism
  Hexok 2 1.00 0.59 1.30 1.15 0.33 0.095 0.069 0.134
  L-PFK 1.00 0.64 0.59 0.60 0.17 0.169 0.519 0.771
  PK 1.00 0.90 1.25 1.14 0.11 0.486 0.010 0.007
  PDH 1.00 0.67 0.81 0.95 0.10 0.027 <0.001 0.001
 Fatty acid oxidation
  ACO 1.00 0.69 0.65 0.70 0.18 0.258 0.868 0.741
  L-CPT-1 1.00 0.32 0.16 0.24 0.30 0.163 0.211 0.194
 Tricarboxylic acid cycle
  CS 1.00 0.68 0.99 0.95 0.11 0.039 0.014 0.033
  ICDH β 1.00 0.66 0.72 0.91 0.15 0.145 0.008 0.004
  ICDH γ 1.00 0.72 0.71 0.67 0.11 0.078 0.570 0.760

Asn, asparagine; LPS, lipopolysaccharide; LPSCC, lipopolysaccharide challenged control; SEM, standard error of the mean; Hexok 2, hexokinase 2; L-PFK, 6-phosphofructokinase (liver type-like); PK, pyruvate kinase; PDH, pyruvate dehydrogenase; ACO, acyl-coenzyme A oxidase; L-CPT-1, liver carnitine palmitoyltransferase I; CS, Citrate synthase; ICDH β, isocitrate dehydrogenase β; ICDH γ, isocitrate dehydrogenase γ.

1)

Values are means, n = 6 (1 pig/pen).

2)

CTRL (non-challenged control), piglets receiving a control diet and injected with 0.9% NaCl solution; LPSCC (LPS challenged control), piglets receiving the same control diet and injected with Escherichia coli LPS; LPS+0.5% Asn, piglets receiving a 0.5% Asn diet and injected with LPS; LPS+1.0% Asn, piglets receiving a 1.0% Asn diet and injected with LPS.

mRNA expression of AMPKα1, AMPKα2, Sirt1, and PGC1α

As shown in Table 5, LPS challenge decreased the mRNA expression of AMP-activated protein kinase (AMPK) α1, AMPKα2, and silent information regulator (Sirt)1 at 24 h post-LPS challenge. However, Asn supplementation had no effect on the mRNA expression of AMPKα1, AMPKα2, Sirt1, and PGC1α at 4 h or 24 h after LPS challenge.

Table 5.

The effect of Asn supplementation on the liver mRNA expression of AMPKα1, AMPKα2, Sirt1, and PGC1α at 4 h or 24 h after LPS challenge in weaned piglets1)

Item CTRL2) LPSCC2) LPS+0.5% Asn2) LPS+1.0% Asn2) SEM p value

Control vs LPSCC Linear Quadratic
4 h post-challenge
 AMPKα1 1.00 0.94 1.02 0.82 0.14 0.627 0.623 0.355
 AMPKα2 1.00 0.99 1.01 0.89 0.19 0.945 0.715 0.798
 Sirt1 1.00 1.17 1.06 0.91 0.24 0.495 0.326 0.580
 PGC1α 1.00 0.36 0.39 0.14 0.22 0.073 0.189 0.094
24 h post-challenge
 AMPKα1 1.00 0.54 0.64 0.64 0.16 0.053 0.281 0.542
 AMPKα2 1.00 0.47 0.44 0.53 0.17 0.052 0.723 0.659
 Sirt1 1.00 0.61 0.46 0.60 0.13 0.039 0.608 0.277
 PGC1α 1.00 0.98 0.72 0.91 0.26 0.930 0.612 0.634

Asn, asparagine; AMPK, AMP-activated protein kinase; Sirt1, silent information regulator 1; PGC1α, peroxisome proliferator activated receptor gamma coactivator-1α; LPS, lipopolysaccharide; LPSCC, lipopolysaccharide challenged control; SEM, standard error of the mean.

1)

Values are means, n = 6 (1 pig/pen).

2)

CTRL (non-challenged control), piglets receiving a control diet and injected with 0.9% NaCl solution; LPSCC (LPS challenged control), piglets receiving the same control diet and injected with Escherichia coli LPS; LPS+0.5% Asn, piglets receiving a 0.5% Asn diet and injected with LPS; LPS+1.0% Asn, piglets receiving a 1.0% Asn diet and injected with LPS.

Protein phosphorylation and abundance of AMPKα

As shown in Table 6, LPS challenge had no effect on the pAMPKα/tAMPKα ratio (p>0.05) at 4 and 24 h post-injection. However, Asn supplementation increased this ratio at 24 h after LPS challenge (linear, p<0.05; quadratic, p<0.05).

Table 6.

The effect of Asn supplementation on the liver pAMPKα/tAMPKα ratio (AU) at 24 h after Escherichia coli LPS challenge in weaned piglets1)

Item CTRL2) LPSCC2) LPS+0.5% Asn2) LPS+1.0% Asn2) SEM p value

Control vs LPSCC Linear Quadratic
4 h post-challenge 16.79 16.11 19.02 20.90 5.22 0.897 0.326 0.586
24 h post-challenge 23.27 25.91 25.13 44.49 7.92 0.692 0.044 0.050

Asn, asparagine; AMPK, AMP-activated protein kinase; LPS, lipopolysaccharide; LPSCC, lipopolysaccharide challenged control; SEM, standard error of the mean.

1)

Values are means, n = 6 (1 pig/pen).

2)

CTRL (non-challenged control), piglets receiving a control diet and injected with 0.9% NaCl solution; LPSCC (LPS challenged control), piglets receiving the same control diet and injected with Escherichia coli LPS; LPS+0.5% Asn, piglets receiving a 0.5% Asn diet and injected with LPS; LPS+1.0% Asn, piglets receiving a 1.0% Asn diet and injected with LPS.

DISCUSSION

Many amino acids can be used as an energy source by the body, such as glutamine [18], proline [19,20], arginine [21], and aspartate [13,22]. Yi et al [23] found dietary N-acetylcysteine supplementation also could alleviate liver injury in lipopolysaccharide-challenged piglets by improving energy metabolism.

ATP is the main energy source in a variety of cellular functions. Ramesh et al [24] reported that Asn increased the ODC activity, which primarily controls the intracellular concentrations of polyamines. Fausto [25] also found that Asn could increase ODC activity in regenerating liver. Polyamines play an essential role in regulating energy metabolism [26]. In our study, Asn supplementation increased ATP concentration at 24 h after LPS challenge, which might have resulted from the increased polyamines concentration. Moreover, the rise of ATP level indicated that Asn could play an important role on recovery of injured liver.

The ATP generation in the liver mainly depends on the respiratory chain and glycolysis [27,28], which could meet the energy requirement during the early response to a stress. The Hexok catalyzes glucose phosphorylation, which is the first step of glycolysis. In the present study, we found that Asn supplementation had a tendency to increase Hexok 2 mRNA expression after 24 h LPS challenge, which could stimulate the subsequent glycolysis steps to produce more ATP to improve the liver’s response to stress after LPS challenge. Six-phosphofructokinase (PFK) is one of the key enzymes of glycolysis. ATP and AMP can down-regulate and up-regulate the activity of PFK, respectively [29]. However, Reinhart and Lardy [30] reported that this enzyme in liver could be inactive because of the lower physiological concentrations of ATP and AMP. This result is consistent with our findings that Asn supplementation could increase ATP level after LPS challenge, however, the increased ATP level could not be enough to stimulate liver PFK expression.

The PK is also a key regulatory enzyme in glycolysis. In erythrocytes, PK insufficiency can decrease ATP level, which might shorten their life span [31]. Roy et al [32] reported that PK deficiency increased susceptibility to Salmonella typhimurium infection in mice. In this study, Asn supplementation increased the PK mRNA expression at 24 h after LPS challenge, which might in turn augment the ATP production and have a positive function to alleviate the liver stress after LPS challenge. The PDH is not only the key enzyme in the TCA cycle, but also the first component enzyme of pyruvate dehydrogenase complex. PDH catalyzes pyruvate to produce acetyl coenzyme A (acetyl-CoA). This reaction is a main link between glycolysis and TCA cycle. In this study, Asn increased the PDH mRNA expression at 24 h after LPS challenge. Theoretically, this increased mRNA expression might increase the production of acetyl-CoA, which can produce the energy through the TCA cycle. These results are also in accordance with the result that Asn supplementation increased the ATP production.

The CS is the first enzyme in TCA cycle. Zhang et al [33] reported that the increased Asn could stimulate the CS activity. In this study, Asn supplementation increased the CS mRNA expression at 24 h after LPS challenge, which might result from the high Asn circulation concentration. Accordingly, the increased CS mRNA expression could stimulate TCA cycle to produce more ATP to improve the injured liver. The ICDH are also the key enzymes in TCA cycle. There are three ICDH in liver, including one cytosolic and two mitochondrial ones. The latter, including ICDHβ and ICDHγ, are the key enzymes against oxidative damage in mitochondria. Schanbacher et al [34] reported that ICDH level increased in cattle’s serum of hepatic injury model. However, in the present study, Asn supplementation had no effect on their mRNA expression.

Mammalian AMPK is a main regulator of energy control [35], which can be activated by the high concentration of the AMP and the reversible phosphorylation [36]. AMPK is a heterotrimer consisting seven subunits [37]. The major phosphorylated site is the Thr172 phosphorylation within the AMPK α-subunit. In response, the activated AMPK can stimulate catabolic pathways to produce more ATP in the face of energy stress. Our previous studies have shown that Asn supplementation could improve the injured intestine induced by LPS via the AMPK signaling pathway [38,39]. In this study, we found that 1.0% Asn supplementation had no effect on the AMPK mRNA expression at 4 and 24 h after LPS challenge, however, it increased liver pAMPKα/tAMPKα ratio at 24 h, which was in response to the decreased AMP-to-ATP ratio, indicating that Asn could increase AMPK phosphorylation to produce more ATP to improve energy status in the injured liver induced by LPS challenge.

Asn can be deaminated to form aspartate (Asp) in an ATP-dependent amidation reaction [8]. Our previous study had shown that Asp could decrease the expressions of hepatic pro-inflammatory mediators at 4h after LPS challenge, which could not stimulate the positive effects of Asp on the injured liver induced by LPS. In contrast, Asp could attenuate this injury resulting from the increased expressions of hepatic pro-inflammatory mediators at 24 h after LPS challenge. These responses might be part of the reason that Asn improved the energy status to attenuate the injured liver just at 24 h after LPS challenge due to the increased expressions of hepatic pro-inflammatory mediators. Moreover, because our previous study found only one time-point (4 h) might not the most appropriate time point to measure all the intestinal pro-inflammatory mediators following the LPS challenge, in this study, we chose two time points for liver sample collection to analyze energy metabolism in liver based on our found in Asp [13].

CONCLUSION

In the present study, we showed that dietary supplementation with Asn had no effect on the energy status at 4 h after LPS injection. However, Asn could improve the energy status in injured liver at 24 h after LPS challenge, as evidenced by increased liver content of ATP, which might result from increasing the activity of TCA cycle and glycolysis, and Asn supplementation could stimulate AMPK phosphorylation. The results indicated that Asn could play an important role in increasing energy production just at the late stage of LPS challenge. Furthermore, in our study, it remained unclear whether the positive effects on energy metabolism were mediated directly by Asn itself or by its metabolites.

ACKNOWLEDGMENTS

This study was financially supported by the National Natural Science Foundation of China (31422053 and 31372318).

Footnotes

CONFLICT OF INTEREST

We certify that there is no conflict of interest with any financial organization regarding the material discussed in the manuscript.

REFERENCES

  • 1.Crosby LO, Cline TR. Effect of asparagine on growth and protein synthesis in weanling rats. J Anim Sci. 1973;37:713–7. doi: 10.2527/jas1973.373713x. [DOI] [PubMed] [Google Scholar]
  • 2.Rhoads JM, Argenzio RA, Chen W, Gomez GG. Asparagine stimulates piglet intestinal Cl- secretion by a mechanism requiring a submucosal glutamate receptor and nitric oxide. J Pharmacol Exp Ther. 1995;274:404–12. [PubMed] [Google Scholar]
  • 3.Kandil HM, Argenzio RA, Chen W, et al. L-glutamine and L-asparagine stimulate ODC activity and proliferation in a porcine jejunal enterocyte line. Am J Physiol. 1995;269:G591–9. doi: 10.1152/ajpgi.1995.269.4.G591. [DOI] [PubMed] [Google Scholar]
  • 4.Ray RM, Viar MJ, Patel TB, Johnson LR. Interaction of asparagine and EGF in the regulation of ornithine decarboxylase in IEC-6 cells. Am J Physiol. 1999;276:G773–80. doi: 10.1152/ajpgi.1999.276.3.G773. [DOI] [PubMed] [Google Scholar]
  • 5.Milman HA, Cooney DA, Huang CY. Studies on the mechanism of the glutamine-dependent reaction catalyzed by asparagine synthetase from mouse pancreas. J Biol Chem. 1980;255:1862–6. [PubMed] [Google Scholar]
  • 6.Avramis VI, Panosyan EH. Pharmacokinetic/pharmacodynamic relationships of asparaginase formulations: the past, the present and recommendations for the future. Clin Pharmacokinet. 2005;44:367–93. doi: 10.2165/00003088-200544040-00003. [DOI] [PubMed] [Google Scholar]
  • 7.Balasubramanian MN, Butterworth EA, Kilberg MS. Asparagine synthetase: regulation by cell stress and involvement in tumor biology. Am J Physiol Endocrinol Metab. 2013;304:E789–99. doi: 10.1152/ajpendo.00015.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Milman HA, Cooney DA. Partial purification and properties of L-asparagine synthetase from mouse pancreas. Biochem J. 1979;181:51–9. doi: 10.1042/bj1810051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Viollet B, Foretz M, Guigas B, et al. Activation of AMP-activated protein kinase in the liver: a new strategy for the management of metabolic hepatic disorders. J Physiol. 2006;574:41–53. doi: 10.1113/jphysiol.2006.108506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Masaki T, Chiba S, Tatsukawa H, et al. Adiponectin protects LPS-induced liver injury through modulation of TNF-α in KK-Ay obese mice. Hepatology. 2004;40:177–84. doi: 10.1002/hep.20282. [DOI] [PubMed] [Google Scholar]
  • 11.Alipour M, Omri A, Smith MG, Suntres ZE. Prophylactic effect of liposomal N-acetylcysteine against LPS-induced liver injuries. J Endotoxin Res. 2007;13:297–304. doi: 10.1177/0968051907085062. [DOI] [PubMed] [Google Scholar]
  • 12.Xu L, Scheenen WJ, Roubos EW, Kozicz T. Peptidergic Edinger-Westphal neurons and the energy-dependent stress response. Gen Comp Endocrinol. 2012;177:296–304. doi: 10.1016/j.ygcen.2011.11.039. [DOI] [PubMed] [Google Scholar]
  • 13.Kang P, Liu Y, Zhu H, et al. The effect of aspartate on the energy metabolism in the liver of weanling pigs challenged with lipopolysaccharide. Eur J Nutr. 2015;54:581–8. doi: 10.1007/s00394-014-0739-3. [DOI] [PubMed] [Google Scholar]
  • 14.Li S, Liu YL, Shi HF, et al. Effect of asparagine acid on growth performance, blood cell differential count, and blood biochemical measurements of weaned piglets after lipopolysaccharide challenge. Chinese J Anim Nutr. 2012;24:2450–8. [Google Scholar]
  • 15.NRC . Nutrient requirements of swine. 11th edition. Washington, DC, USA: National Academic Press; 2012. [Google Scholar]
  • 16.Hou Y, Yao K, Wang L, et al. Effects of α-ketoglutarate on energy status in the intestinal mucosa of weaned piglets chronically challenged with lipopolysaccharide. Br J Nutr. 2011;106:357–63. doi: 10.1017/S0007114511000249. [DOI] [PubMed] [Google Scholar]
  • 17.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and 2− ΔΔ CT method. Methods. 2001;25:402–8. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • 18.Zielke HR, Zielke CL, Ozand PT. Glutamine: a major energy source for cultured mammalian cells. Fed Proc. 1984;43:121–5. [PubMed] [Google Scholar]
  • 19.Scaraffia PY, Wells MA. Proline can be utilized as an energy substrate during flight of Aedes aegypti females. J Insect Physiol. 2003;49:591–601. doi: 10.1016/s0022-1910(03)00031-3. [DOI] [PubMed] [Google Scholar]
  • 20.Andrade VS, Rojas DB, de Andrade RB, et al. A possible anti-inflammatory effect of proline in the brain cortex and cerebellum of rats. Mol Neurobiol. 2017 Jun 5; doi: 10.1007/s12035-017-0626-z. [Epub]. https:/doi.org/10.1007/s12035-017-0626-z. [DOI] [PubMed] [Google Scholar]
  • 21.Hristina K, Langerholc T, Trapecar M. Novel metabolic roles of L-arginine in body energy metabolism and possible clinical applications. J Nutr Health Aging. 2014;18:213–8. doi: 10.1007/s12603-014-0015-5. [DOI] [PubMed] [Google Scholar]
  • 22.Pi D, Liu Y, Shi H, et al. Dietary supplementation of aspartate enhances intestinal integrity and energy status in weanling piglets after lipopolysaccharide challenge. J Nutr Biochem. 2014;25:456–62. doi: 10.1016/j.jnutbio.2013.12.006. [DOI] [PubMed] [Google Scholar]
  • 23.Yi D, Hou Y, Wang L, et al. Dietary N-acetylcysteine supplementation alleviates liver injury in lipopolysaccharide-challenged piglets. Br J Nutr. 2014;111:46–54. doi: 10.1017/S0007114513002171. [DOI] [PubMed] [Google Scholar]
  • 24.Ray RM, Viar MJ, Johnson LR. Amino acids regulate expression of antizyme-1 to modulate ornithine decarboxylase activity. J Biol Chem. 2012;287:3674–90. doi: 10.1074/jbc.M111.232561. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Fausto N. The control of ornithine decarboxylase activity during liver regeneration. Biochim Biophys Acta. 1971;238:116–28. doi: 10.1016/0005-2787(71)90015-3. [DOI] [PubMed] [Google Scholar]
  • 26.Pirinen E, Kuulasmaa T, Pietilä M, et al. Enhanced polyamine catabolism alters homeostatic control of white adipose tissue mass, energy expenditure, and glucose metabolism. Mol Cell Biol. 2007;27:4953–67. doi: 10.1128/MCB.02034-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Soboll S. Regulation of energy metabolism in liver. J Bioenerg Biomembr. 1995;27:571–82. doi: 10.1007/BF02111655. [DOI] [PubMed] [Google Scholar]
  • 28.Wang J, Li GR, Tan BE, et al. Oral administration of putrescine and proline during the suckling period improves epithelial restitution after early weaning in piglets. J Anim Sci. 2015;93:1679–88. doi: 10.2527/jas.2014-8230. [DOI] [PubMed] [Google Scholar]
  • 29.Furuya E, Uyeda K. An activation factor of liver phosphofructokinase. Proc Nati Acad Sci USA. 1980;77:5861–4. doi: 10.1073/pnas.77.10.5861. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Reinhart GD, Lardy HA. Rat liver phosphofructokinase: kinetic activity under near-physiological conditions. Biochemistry. 1980;19:1477–84. doi: 10.1021/bi00548a034. [DOI] [PubMed] [Google Scholar]
  • 31.Zanella A, Fermo E, Bianchi P, Valentini G. Red cell pyruvate kinase deficiency: molecular and clinical aspects. Br J Haematol. 2005;130:11–25. doi: 10.1111/j.1365-2141.2005.05527.x. [DOI] [PubMed] [Google Scholar]
  • 32.Roy MF, Riendeau N, Bédard C, et al. Pyruvate kinase defi ciency confers susceptibility to Salmonella typhimurium infection in mice. J Exp Med. 2007;204:2949–61. doi: 10.1084/jem.20062606. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Zhang J, Fan J, Venneti S, et al. Asparagine plays a critical role in regulating cellular adaptation to glutamine depletion. Mol Cell. 2014;56:205–18. doi: 10.1016/j.molcel.2014.08.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Schanbacher FL, Willett LB, Moorhead PD. Ornithine decarboxylase, serum isocitrate dehydrogenase and clinical chemisty changes during thioacetamide-induced hepatotoxicity in a calf. J Anim Sci. 1981;53:1658–70. doi: 10.2527/jas1982.5361658x. [DOI] [PubMed] [Google Scholar]
  • 35.Kahn BB, Alquier T, Carling D, Hardie DG. AMP-activated protein kinase: ancient energy gauge provides clues to modern understanding of metabolism. Cell Metab. 2005;1:15–25. doi: 10.1016/j.cmet.2004.12.003. [DOI] [PubMed] [Google Scholar]
  • 36.Stein SC, Woods A, Jones NA, Davison MD, Carling D. The regulation of AMP-activated protein kinase by phosphorylation. Biochem J. 2000;345:437–43. [PMC free article] [PubMed] [Google Scholar]
  • 37.Merrill JF, Thomson DM, Hardman SE, et al. Iron deficiency causes a shift in AMP-activated protein kinase (AMPK) subunit composition in rat skeletal muscle. Nutr Metab (Lond) 2012;9:104. doi: 10.1186/1743-7075-9-104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Wang XY, Liu YL, Li S, et al. Asparagine attenuates intestinal injury, improves energy status and inhibits AMP-activated protein kinase signalling pathways in weaned piglets challenged with Escherichia coli lipopolysaccharide. Br J Nutr. 2015;114:553–65. doi: 10.1017/S0007114515001877. [DOI] [PubMed] [Google Scholar]
  • 39.Wu HT, Liu YL, Pi DA, et al. Asparagine attenuates hepatic injury caused by lipopolysaccharide in weaned piglets associated with modulation of Toll-like receptor 4 and nucleotide-binding oligomerisation domain protein signalling and their negative regulators. Br J Nutr. 2015;114:189–201. doi: 10.1017/S0007114515001476. [DOI] [PubMed] [Google Scholar]

Articles from Asian-Australasian Journal of Animal Sciences are provided here courtesy of Asian-Australasian Association of Animal Production Societies (AAAP)

RESOURCES