Skip to main content
PMC home page
Plant Physiology logoLink to Plant Physiology
. 2018 Jan 16;176(3):2456–2471. doi: 10.1104/pp.17.01281

Heat Shock Factor HsfA1a Is Essential for R Gene-Mediated Nematode Resistance and Triggers H2O2 Production1

Jie Zhou a,2, Xue-Chen Xu a,2, Jia-Jian Cao a, Ling-Ling Yin a, Xiao-Jian Xia a, Kai Shi a, Yan-Hong Zhou a, Jing-Quan Yu a,b,c,3
PMCID: PMC5841716  PMID: 29339397

HsfA1a is essential for Mi-1.2-mediated resistance to Meloidogyne incognita and regulates Wfi1 transcription and H2O2 production.

Abstract

Plants generate reactive oxygen species (ROS) in the apoplast in response to pathogen attack, especially following resistance (R) gene-mediated pathogen recognition; however, the mechanisms activating ROS generation remain unknown. Here, we demonstrate that RKN (Meloidogyne incognita) infection rapidly induces ROS accumulation in the roots of tomato (Solanum lycopersicum) plants that contain the R gene Mi-1.2 but rarely induces ROS accumulation in the susceptible or Mi-1.2-silenced resistant genotypes. RNK also induces the hypersensitive response, a form of programmed cell death, in Mi-1.2 plants. RKN induces the expression of numerous class-A heat shock factor (HsfA) genes in resistant tomato plants. Silencing HsfA1a compromises Mi-1.2-mediated resistance, apoplastic H2O2 accumulation, and the transcription of whitefly induced 1 (Wfi1), which encodes a respiratory burst oxidase homolog. HsfA1a regulates Wfi1 transcription by binding to the Wfi1 promoter, and silencing of Wfi1 compromises Mi-1.2-mediated resistance. HsfA1a and Wfi1 are involved in Mi-1.2-triggered Hsp90 accumulation and basal defense in susceptible tomato. Thus, HsfA–1aWfi1-dependent ROS signaling functions as a crucial regulator of plant defense responses.

Plants respond to pathogens by activating pattern-triggered immunity (PTI) and effector-triggered immunity (ETI; Jones and Dangl, 2006). PTI is a basal defense response that is induced by microbe- or pathogen-associated molecular patterns (PAMPs) and can effectively resist most nonadapted pathogens, leading to basal immunity in plants during pathogen infection (Goverse and Smant, 2014; Couto and Zipfel, 2016). Cytoplasmic resistance (R)-protein-activated ETI is a second immune response that is classically associated with the recognition of pathogen-secreted virulence effectors (Cui et al., 2015). ETI is stronger than PTI and often culminates with localized programmed cell death (PCD) known as the hypersensitive response (HR; Stael et al., 2015).

Over the past two decades, numerous R genes that limit the establishment and spread of plant pathogens have been identified, and most encode structurally similar nucleotide-binding site, Leu-rich repeat (NBS-LRR) proteins (Eitas and Dangl, 2010; Sarris et al., 2015). NBS-LRR proteins can directly or indirectly recognize pathogen-derived molecules and induce cell death through their antipathogen complexes with chaperones such as Hsp90 and Sgt1 (Shirasu, 2009).

In plant immune responses, reactive oxygen species (ROS) function as early signaling molecules that activate subsequent defense pathways, and they display direct antimicrobial activity against pathogens (Stael et al., 2015). Among the ROS produced in different organelles (Xia et al., 2015), ROS produced in the apoplast by plasma membrane-bound NADPH oxidases play a critical role in the regulation of a variety of biological processes, such as plant immunity, growth, and development (Li et al., 2014b; Kadota et al., 2015; Xia et al., 2015). NADPH oxidases are encoded by the respiratory burst oxidase homolog (RBOH) family, which includes 10 members in Arabidopsis (Arabidopsis thaliana) and 8 members in tomato (Solanum lycopersicum; Sagi and Fluhr, 2006; Li et al., 2015). RBOH-mediated extracellular ROS accumulation is one of the first responses during PAMP treatment or pathogen-triggered ETI (Kadota et al., 2015; Couto and Zipfel, 2016). In both PTI and ETI, the accumulation of ROS is mainly dependent on RBOHD, which functions as a critical regulator of systemic defense signaling in Arabidopsis (Li et al., 2014b; Kadota et al., 2015). Moreover, the NADPH oxidase encoded by RBOHD is responsible for pattern recognition receptor-triggered ROS bursts in Arabidopsis (Couto and Zipfel, 2016). In PTI, the NADPH oxidase encoded by AtRBOHD can be directly phosphorylated and activated by the upstream BOTRYTIS-INDUCED KINASE1 (BIK1) and promotes stomatal closure by generating ROS upon pathogen infection (Kadota et al., 2014; Li et al., 2014b). Early recognition of infection by the bacterial pathogen Pseudomonas syringae pv tomato DC3000 (Pto DC3000) is impaired in Arabidopsis bik1 and rbohD/F mutants (Kadota et al., 2014, 2015). Furthermore, calcium-dependent protein kinase phosphorylates the RBOHD-encoded NADPH oxidase, which facilitates the rapid propagation of defense signals in Arabidopsis (Dubiella et al., 2013). In solanaceous species, AtRBOHD orthologs, such as whitefly induced 1 (Wfi1), also reported as SlRBOHB, in tomato, StRBOHB in potato (Solanum tuberosum), and NbRBOHD in Nicotiana benthamiana, play an important role in ROS production in response to pathogens (Yoshioka et al., 2003; Kobayashi et al., 2007; Asai et al., 2008; Li et al., 2015).

Like bacterial pathogens, nematodes also induce significant ROS accumulation in tomato roots (Melillo et al., 2006, 2011; Vos et al., 2013). Arabidopsis rbohD/rbohF double mutants are more susceptible than wild-type plants to root-knot nematodes (RKNs; Teixeira et al., 2016). We recently found that RBOHs mediated brassinosteroid-induced resistance to RKNs via the RBOH-dependent activation of mitogen-activated protein kinases in susceptible tomato genotypes (Song et al., 2017). However, it is still unknown how RBOH transcripts are activated in R-gene-mediated basal resistance and induced resistance.

RKNs, which are plant-parasitic nematodes from the genus Meloidogyne, have a wide geographical distribution and a broad host range (Wesemael et al., 2011). Meloidogyne incognita, a major RKN species, causes considerable damage to numerous economically important crops, including solanaceous crops (Djian-Caporalino et al., 2011). However, our understanding of nematode resistance lags far behind that of resistance to other biotic stressors, such as bacteria, fungi, and viruses.

In tomato, the R gene locus Mi-1 contains two genes that encode two proteins, Mi-1.1 and Mi-1.2, which have high sequence similarity and contain NBS-LRR motifs (Milligan et al., 1998). Mi-1.1 does not function in pest resistance; Mi-1.2 confers race-specific resistance against RKNs, potato aphids (Macrosiphum euphorbiae), and whiteflies (Bemisia tabaci; Milligan et al., 1998; Nombela et al., 2003). The NBS domain of the Mi-1.2 protein can be autoactivated to trigger defense signaling (Tameling et al., 2002; Lukasik-Shreepaathy et al., 2012). The LRR domain of the Mi-1.2 protein has many roles in the regulation of RKN recognition and HR signaling (Hwang and Williamson, 2003).

Resistance to Meloidogyne (Rme1) is speculated to be regulated by a protein kinase acting either early in Mi-1.2 signal transduction or upstream of Mi-1.2 and is required for Mi-1.2-mediated RKN resistance (de Ilarduya et al., 2001; Martinez de Ilarduya et al., 2004). Notably, the chaperones Hsp90-1 and Sgt1 are involved in the formation of the Mi-1.2 signaling complex (Bhattarai et al., 2007). WRKY72-type transcription factors are required and are transcriptionally upregulated in Mi-1.2-triggered ETI (Bhattarai et al., 2010). Furthermore, transcript analysis has revealed that several genes encoding heat shock transcription factors (Hsfs) and heat shock proteins (Hsps) are induced in susceptible genotypes in response to nematode infection (Escobar et al., 2003; Hosseini and Matthews, 2014; Jain et al., 2016). However, studies on the role of Hsfs and Hsps in nematode resistance are limited to Hsp90, which is essential for Mi-1.2-mediated resistance to RKNs by functioning as a chaperone of the R protein signaling complex during pathogen attack (Bhattarai et al., 2007).

How ROS signaling is regulated in R-gene-mediated pathogen resistance remains a critical unanswered question. We hypothesized that Hsfs might play a regulatory role in ROS signaling and subsequent defense against pathogens. In this study, we used RKN as a model pest system and found that HsfA1a acts as a positive regulator of an RBOH gene, Wfi1, at the transcript level, which triggers the production of ROS in the apoplast during RKN infection in the roots of tomato plants. In resistant plants, Wfi1-induced ROS eventually establish a localized HR to arrest RKN advancement. Moreover, HsfA1a and Wfi1-dependent ROS are required for the activation of Hsp90 and Stg1 and for Mi-1.2-mediated resistance. Finally, we show that the higher levels of HsfA1a and Wfi1 transcripts in plants with R genes relative to those in susceptible genotypes contributed to the difference in resistance against RKNs. This study deepens the understanding of R-gene-mediated resistance against pathogens and may have important implications for breeding resistant crop plants.

RESULTS

Mi-1.2-Mediated Resistance against RKNs Is Associated with the HR and Apoplastic ROS Accumulation in Tomato Roots

To determine the potential involvement of the HR and H2O2 in Mi-1.2-mediated resistance against RKNs, we first compared the severity of RKN infection in the susceptible genotype cv Moneymaker (MM), the resistant genotype cv Motelle (Mo), which contains the Mi-1.2 gene, and Mo plants with Mi-1.2 silenced using virus-induced gene silencing (VIGS). To allow an unbiased comparison, both MM and Mo plants were infiltrated with Tobacco rattle virus (TRV) as empty vector controls. The Mi-1.2-silenced plants (Mo-TRV-Mi-1.2) had only 20% to 30% of the Mi-1.2 transcript levels of the TRV control Mo plants (Supplemental Fig. S1). At 12 h postinoculation (hpi) with J2-stage RKNs, RKNs were observed inside the roots of Mo-TRV, Mo-TRV-Mi-1.2, and MM-TRV plants by acid fuchsin staining (Supplemental Fig. S2). Acid fuchsin staining also showed HR-like cell necrosis around the RKNs, and the nematodes were arrested in the roots of Mo-TRV plants from 24 to 48 hpi (Supplemental Fig. S2). Trypan blue staining further confirmed the occurrence of HR and HR-like cell necrosis at 24 hpi, which was accompanied by an oxidative burst, leading to potential nematode death at 48 hpi in the roots of Mo-TRV plants (Fig. 1, A and B). By contrast, RKNs continued to develop, and HR and HR-like cell necrosis were not observed in the roots of MM empty vector or Mi-1.2-silenced Mo plants (Fig. 1, A and B; Supplemental Fig. S2).

Figure 1.

Figure 1.

Open in a new tab

Time course of the HR and reactive oxygen species accumulation in tomato roots following RKN infection. A, Time course of the HR in susceptible MM empty vector plants (MM-TRV), resistant Mo empty vector plants (Mo-TRV), and Mi-1.2-silenced Mo plants (Mo-TRV-Mi-1.2) after RKN infection. The HR and cell death in the root tips were analyzed with trypan blue staining solution and were dark blue. At each time point, more than 100 root tips were assessed and photographed (BX61; Olympus). Scale bars = 100 μm. B, Time course of the change in HR density in the root tips of MM-TRV, Mo-TRV, and Mo-TRV-Mi-1.2 after RKN infection. At each time point, more than 100 root tips were tested, and the percentage of cell death was recorded. C, DCF staining (left) and subcellular localization (right) of H2O2 accumulation in Mo-TRV roots after RKN infection. Black arrowheads indicate CeCl3 precipitates on the membranes. Scale bars = 200 μm (left) and 1 μm (right). D, Histochemical detection of H2O2 and O2⋅− in tomato roots using DAB (left) and NBT (right) staining, respectively, 36 h after RKN infection. Scale bars = 200 μm. E, H2O2 accumulation 36 h after RKN infection. FW, fresh weight. F, DCF staining (left) and subcellular localization (right) of H2O2 accumulation in MM-TRV and Mo-TRV-Mi-1.2 36 h after RKN infection. Scale bars = 200 μm (left) and 1 μm (right). The RKN experiment was repeated three times; similar results were obtained each time, and data from one representative experiment are presented. Asterisks and different letters indicate statistically significant differences (P < 0.05, Tukey’s test).

The accumulation of ROS was strongly induced in the roots of Mi-1.2-resistant tomato plants in response to RKN infection (Melillo et al., 2006). By using 2,7-dichlorofluorescein diacetate (DCF) as a probe for H2O2, we found that H2O2 accumulation was induced by RKN in the roots of Mo-TRV plants at 18 hpi and was highly elevated at 36 hpi. Further analysis of the subcellular localization of H2O2 revealed that H2O2 accumulation occurred primarily in the apoplast of the root cells of Mo plants, including the plasma membranes, cell walls, and intercellular spaces, in response to RKN infection (Fig. 1C). In addition, staining the roots with 3,3′-diaminobenzidine (DAB) and nitro blue tetrazolium (NBT) further confirmed that the roots of Mo plants accumulated more H2O2 and superoxide anion (O2⋅-) than the roots of MM-TRV and Mi-1.2-silenced Mo plants (Fig. 1D). Moreover, the H2O2 contents in the MM-TRV and Mi-1.2-silenced Mo plants were only 40.1% and 65.7% of that in Mo plants, respectively (Fig. 1E). In comparison, H2O2 accumulation was barely detectable in the apoplast of the root cells of MM-TRV and Mi-1.2-silenced Mo plants (Fig. 1F). Meanwhile, there were no significant differences in the accumulation of H2O2 between the Mo and Mo-TRV plants in the absence of RKN, suggesting that empty TRV infection did not affect the RKN-induced accumulation of H2O2 in Mo plants (Supplemental Fig. S3). These results indicate that the Mi-1.2-mediated HR against RKNs is linked to a significant increase in the accumulation of H2O2 in the apoplast of root cells.

Involvement of HsfAs in Mi-1.2-Mediated Resistance and Basal Defense against RKNs

Hsp90 participates in the regulation of Mi-1.2-mediated resistance against RKNs in tomato (Bhattarai et al., 2007). To elucidate whether HsfAs, which are key Hsp-regulating transcription factors, are involved in Mi-1.2-mediated plant defense against RKNs, we examined the expression of 15 HsfAs identified in the Sol Genomics Network (http://solgenomics.net/) as being responsive to RKN infection. Phylogenetic analysis of HsfA family proteins from Arabidopsis, tomato, and rice (Oryza sativa) showed that different HsfA proteins are structurally unique in each species but have close structural homologs in both monocot and dicot plants (Supplemental Fig. S4). The transcripts of these HsfA genes were differentially induced after RKN infection, especially at 18 hpi (Fig. 2A; Supplemental Fig. S5).

Figure 2.

Figure 2.

Open in a new tab

RKN-induced transcription of HsfA genes and the role of different HsfAs in RKN resistance. A, Heat map showing the expression profiles of HsfA genes in resistant Mo plants after RKN infection at different time points. Transcript levels were determined using RT-qPCR, and cluster analysis was performed using MeV version 4.9. The color bar at the bottom shows levels of expression. The labels 0 h, 6 h, 12 h, 18 h, 24 h, 36 h, and 48 h indicate the time after RKN infection. B, RKN reproduction in susceptible MM empty vector plants (MM-TRV), resistant Mo empty vector plants (Mo-TRV), and HsfA-gene-silenced plants in the Mo background. Thirty plants per genotype were used in each experiment. C, Time course of the HR in resistant Mo empty vector plants (Mo-TRV) and HsfA1a-silenced Motelle plants (Mo-TRV-HsfA1a) after RKN infection. The HR and cell death in the root tips were stained using trypan blue staining solution and were dark blue. At each time point, more than 100 root tips were tested and photographed (BX61; Olympus). Scale bars = 100 μm. D, Time course of the change in HR density in the root tips of Mo-TRV and Mo-TRV-HsfA1a after RKN infection. At each time point, more than 100 root tips were checked, and the percentage of cell death was recorded. E, RKN reproduction in susceptible tomato plants with different HsfA1a levels. Thirty plants per genotype were used in each experiment. AC, RKN-susceptible AC plants; AC-HsfA1a-OE, HsfA1a overexpressing AC plants; AC-TRV, AC empty vector plants (TRV); and AC-TRV-HsfA1a, HsfA1a-silenced AC plants. The labels 1# and 2# represent two HsfA1a-OE lines. Seven weeks after RKN infection, plants were evaluated by counting the number of egg masses on each root. The RKN experiment was repeated three times, similar results were obtained each time, and data from one representative experiment are presented. Asterisks and different letters indicate statistically significant differences (P < 0.05, Tukey’s test).

To identify the roles of the HsfAs in Mi-1.2-mediated resistance, we silenced all these HsfA genes in Mo plants. Reverse transcription-quantitative PCR (RT-qPCR) analysis indicated that transcript levels of these HsfA genes in the silencing lines were only 20% to 30% of those in empty vector plants (Supplemental Fig. S1). Mo plants were resistant, as indicated by the few egg-masses in the roots at 7 weeks postinoculation with RKNs (Fig. 2B). While Mi-1.2-mediated RKN resistance was partially compromised by the silencing of the Mi-1.2 gene, the silencing of most HsfA genes did not abolish Mi-1.2-induced resistance to RKNs in Mo plants (Fig. 2B). However, the silencing of HsfA1a partially compromised resistance to RKNs, as indicated by the reduced HR and the development of RKNs in the roots of HsfA1a-silenced Mo plants (Fig. 2, B–D; Supplemental Fig. S6). In contrast, HR and RKN resistance were not increased further in HsfA1a- overexpressing (OE) plants with Mo as background after RKN infection (Supplemental Fig. S7).

To determine the role of HsfA1a in basal defense, we also generated HsfA1a-OE and HsfA1a-silenced plants in a susceptible cultivar, Ailsa Craig (AC). The growth of HsfA1a-OE or HsfA1a-silenced plants was similar to AC or AC-TRV control plants under normal conditions (Supplemental Fig. S8). The HR-like cell necrosis was not detected in AC and AC-HsfA1a-OE plants after RKN infection (Supplemental Fig. S7). However, resistance against RKNs was enhanced in HsfA1a-OE plants but was compromised in HsfA1a-silenced plants (Fig. 2E). These results suggest that the heat shock factor HsfA1a is not only required for Mi-1.2-mediated RKN resistance, but is also important for basal defense in a susceptible genotype.

Association between HsfA1a and H2O2 Accumulation in Mi-1.2-Mediated RKN Resistance

To determine whether HsfA1a plays a critical role in Mi-1.2-mediated RKN resistance by regulating H2O2 production, we compared the accumulation of H2O2 in RKN-infected lines in which individual HsfA genes were silenced or overexpressed. The production of O2⋅− and H2O2 was similar between the susceptible AC and its HsfA1a-overexpressing plants, and was also similar between the resistant Mo and its HsfA1a-overexpressing plants in the absence of RKN (Supplemental Fig. S9A). Importantly, the production of H2O2 and O2⋅− were highly induced by RKNs at 36 hpi in Mo-TRV plants, as evidenced by the increased DCF signal intensity and by histochemical staining with DAB and NBT (Fig. 3A). This increase was further confirmed by spectrophotometric analyses and by the subcellular detection of H2O2 in the apoplast using CeCl3 (Fig. 3, B and C). While H2O2 production was not compromised at 36 hpi in the roots of plants silenced for 14 HsfAs, as revealed by spectrophotometric analyses and by DCF staining (Supplemental Fig. S10, A and B), the silencing of HsfA1a abolished RKN-induced apoplastic H2O2 and O2⋅− production in the roots at 36 hpi (Fig. 3). These results indicate that HsfA1a is required for the Mi-1.2-mediated production of H2O2 in the apoplast in response to RKN infection.

Figure 3.

Figure 3.

Open in a new tab

Accumulation of ROS after RKN infection in the roots of tomato plants. A, Histochemical detection of H2O2 and O2⋅− using DCF (left), DAB (middle), and NBT (right) staining in Mo-TRV and Mo-TRV-HsfA1a plants 36 h after RKN infection. Scale bars = 200 μm. B, H2O2 accumulation 36 h after RKN infection. FW, fresh weight. C, Subcellular localization of H2O2 accumulation in Mo-TRV and Mo-TRV-HsfA1a 36 h after RKN infection. Black arrowheads indicate CeCl3 precipitates on the membranes. Scale bars = 1 μm. The RKN experiment was repeated three times, similar results were obtained each time, and data from one representative experiment are presented. Different letters indicate statistically significant difference (P < 0.05, Tukey’s test).

The production of apoplastic H2O2 is associated with the activation of RBOH NADPH oxidase (Melillo et al., 2006). We therefore examined the expression of all eight tomato RBOH genes in Mo-TRV and HsfA1a-silenced plants in response to RKN infection (Fig. 4A). Among these genes, Wfi1 and RBOHF were induced as early as 12 hpi, and other genes, such as RBOHA and RBOH1, were induced at 36 hpi with RKNs in the roots of Mo-TRV plants. The expression of these RBOH genes in TRV-HsfA1a plants was similar to that in Mo-TRV plants in the absence of RKN (Fig. 4B). Although the transcript levels of the other seven genes (RBOHA, RBOHC, RBOHD, RBOHE, RBOHF, RBOH1, and RBOHH) were similarly induced in Mo-TRV and HsfA1a-silenced plants, the transcription of Wfi1 in Mo-TRV-HsfA1a plants was 73.8% lower than that in Mo-TRV plants at 36 hpi with RKNs (Fig. 4B). Meanwhile, there were few differences in the transcript accumulation of Wfi1 between the susceptible AC and its HsfA1a-overexpressing plants. Similarly, overexpressing of HsfA1a did not alter the transcript of Wfi1 in the resistant Mo plants in the absence of RKN (Supplemental Fig. S9B). These results indicate that HsfA1a is involved in the regulation of Wfi1 transcription in response to RKN infection.

Figure 4.

Figure 4.

Open in a new tab

Induction of RBOH genes after RKN infection. A, Heat map showing the expression profiles of RBOH genes in resistant Mo plants after RKN infection at different time points. Transcript levels were determined using RT-qPCR, and cluster analysis was performed using MeV version 4.9. The color bar at the top shows the levels of expression. The labels 0 h, 6 h, 12 h, 18 h, 24 h, 36 h, and 48 h indicate the time after RKN infection. B, Transcript levels of RBOH genes in Mo empty vector plants (Mo-TRV) plants and HsfA1a-silenced Mo plants (Mo-TRV-HsfA1a) 36 h after RKN infection. Different letters indicate statistically significant differences (P < 0.05, Tukey’s test).

Binding of HsfA1a to RBOH Promoters

To test the possible transcriptional regulation of tomato RBOH genes by HsfA1a, we inspected 1.5-kb sequences located upstream of the predicted transcriptional start sites of the eight tomato RBOH genes. The promoters of three RBOH genes (RBOHA, Wfi1, and RBOHB) contain heat shock element sequences (GAANNTTC; Fig. 5A). We performed electrophoretic mobility shift assays (EMSAs) to analyze whether HsfA1a directly binds to these promoters in vitro. The signal of the probe-protein complex was not detected using RBOHA or RBOHB probes (data not shown). Interestingly, HsfA1a bound to the Wfi1 promoter probe (Fig. 5B). When the core sequence of the Heat shock element (HSE) motif in the Wfi1 probe was mutated to generate a mutant Wfi1∆ probe, the signal of the probe-protein complex was not detected (Fig. 5B).

Figure 5.

Figure 5.

Open in a new tab

HsfA1a binds to the promoter of the RBOH gene Wfi1 in vitro and in vivo. A, HSEs in the promoter of the tomato RBOHA, Wfi1, and RBOHC genes. The numbering is from the predicted transcription start sites. B, EMSAs showing HsfA1a bound to the HSE sequence of the ASMT promoter. The Wfi1 probe contains one directly bound HSE, whereas in the Wfi1Δ probe, the HSE core sequence was mutated. The wild-type and mutated HSE sequences are underlined. The mutated bases are indicated in red. Recombinant HsfA1a was purified from E. coli cells and used for DNA binding assays with the Wfi1 and Wfi1Δ probes. C, Direct binding of HsfA1a to the Wfi1 promoter was analyzed using ChIP-qPCR in 35S-HsfA1a-HA-overexpressing Motelle plants. The input chromatin was isolated from root samples 36 h after RKN infection. The epitope-tagged HsfA1a-chromatin complex was immunoprecipitated with an anti-HA antibody. A control reaction was processed in parallel using mouse IgG. Input and ChIP-DNA samples were quantified by RT-qPCR using primers specific for the promoter of the Wfi1 gene. ChIP results are presented as percentages of the input DNA. Different letters indicate statistically significant differences (P < 0.05, Tukey’s test).

To further assess whether tomato HsfA1a directly regulates the expression of these three RBOH genes in vivo, we performed chromatin immunoprecipitation (ChIP)-qPCR assays to test HsfA1a protein binding to the promoters of these RBOH genes at 36 hpi with RKNs. As shown in Figure 5C, at 36 hpi with RKNs, an anti-HA antibody immunoprecipitated the 3HA-tagged HsfA1a transgene product in the OE lines, resulting in the substantial enrichment of the Wfi1 promoter sequence in these lines but not the WT lines. In contrast, the IgG control antibody failed to pull down DNA segments of this gene promoter (Fig. 5C). Thus, HsfA1a binds to the Wfi1 gene promoter and may directly regulate the transcription of Wfi1.

Requirement of HsfA1a and Wfi1 for Mi-1.2-Dependent RKN Resistance

Using VIGS technology, we generated plants with an 80% reduction in Wfi1 transcript relative to that of the Mo empty vector TRV plants (Supplemental Fig. S1). As shown in Figure 6, A and B, the Mi-1.2-mediated HR was largely compromised in Wfi1-silenced Mo plants. Acid fuchsin staining also showed that in the roots of Wfi1-silenced plants (Mo-TRV-Wfi1), RKNs continued to develop, and HR-like cell necrosis was not observed (Supplemental Fig. S11). Significantly, the silencing of Wfi1 attenuated Mi-1.2-mediated RKN resistance in Mo plants (Fig. 6C). Furthermore, the RKN-induced accumulation of H2O2 in the apoplast of the root cells was compromised in Wfi1-silenced plants at 36 hpi (Fig. 6, D–F). We also examined the role of Wfi1 in basal defense by silencing Wfi1 in the susceptible MM plants. Compared with the TRV plants, there was a 28.8% increase in the number of egg masses in the TRV-Wfi1 plants (Fig. 6C). These results indicate that Wfi1 is not only important for R gene-mediated resistance but also plays a role in basal defense.

Figure 6.

Figure 6.

Open in a new tab

The function of Wfi1 in tomato Mi-1.2-mediated resistance and basal defense after RKN infection. A, Time course of the HR in resistant Mo empty vector plants (Mo-TRV) and Wfi1-silenced Mo plants (Mo-TRV-Wfi1) after RKN infection. The HR and cell death in the root tips were stained dark blue using trypan blue staining solution. At each time point, more than 100 root tips were assessed and photographed (BX61; Olympus). Scale bars = 100 μm. B, Time course of the change in HR density in the root tips of resistant Mo-TRV and Mo-TRV-Wfi1 plants after RKN infection. At each time point, more than 100 root tips were tested, and the percentage of cell death was recorded. C, RKN reproduction in control plants (TRV) and Mi-1.2- or Wfi1-silenced plants in the Mo background (TRV-Mi-1.2, TRV-Wfi1), as well as in control plants (TRV) and Wfi1-silenced plants (TRV-Wfi1) in the susceptible MM background. Thirty plants per genotype were used in each experiment. Seven weeks after RKN infection, plants were evaluated by counting the number of egg masses on each root. D, H2O2 accumulation 36 h after RKN infection. FW, Fresh weight. E, Histochemical detection of reactive oxygen species using DCF (H2O2 detection, top), DAB (H2O2 detection, middle), and NBT (O2⋅− detection, lower) staining in Mo-TRV and Mo-TRV-Wfi1 36 h after RKN infection. Scale bars = 200 μm. F, Subcellular localization of H2O2 production in Mo-TRV and Mo-TRV-Wfi1 plants 36 h after RKN infection. Black arrows indicate CeCl3 precipitates on the membranes. Scale bars = 1 μm. The RKN experiment was repeated three times; similar results were obtained each time, and data from one representative experiment are presented. Asterisks and different letters indicate statistically significant differences (P < 0.05, Tukey’s test).

To further substantiate the role of HsfA1a and Wfi1 in susceptible and Mi-1.2 resistant tomato plants against RKN infection, we examined the expression of the HsfA1a and Wfi1 genes in MM-TRV, Mo-TRV, and Mo-TRV-Mi-1.2 plants. The transcript levels of HsfA1a and Wfi1 in the roots of Mo-TRV plants were 58.7% and 2.9-fold higher, respectively, than those in the roots of MM-TRV plants under normal condition (Fig. 7A). Importantly, the expression of HsfA1a and Wfi1 was induced by 5.0- and 1.6-fold, respectively, at 18 hpi and by 2.9- and 4.9-fold, respectively, at 36 hpi with RKNs in Mo-TRV plants, but such an induction was not observed in MM-TRV plants (Fig. 7A). However, the RKN-induced transcript levels of HsfA1a and Wfi1 were both compromised in Mi-1.2-silenced Mo plants, indicating that Mi-1.2 is important for the regulation of HsfA1a and Wfi1 expression (Fig. 7A). Immunofluorescence analysis showed that HsfA1a signals were distributed in the whole cell in the absence of RKN; however, the HsfA1a signals were mostly detected in the suspected nucleus after RKN infection (Supplemental Fig. S12). These results further indicated that HsfA1a can bind to the HSEs of target genes and regulate their transcription after RKN infection.

Figure 7.

Figure 7.

Open in a new tab

Transcript levels of Mi-1.2-related genes and the accumulation of Hsp90 in the roots. A, Transcript levels of HsfA1a and Wfi1 in MM empty vector plants (MM-TRV), Mo empty vector plants (Mo-TRV), and Mi-1.2-silenced Mo plants (Mo-TRV-Mi-1.2) 18 and 36 h after RKN infection. B, Transcript levels of Hsp90-1 and Sgt1-1 in Mo-TRV plants and HsfA1a-silenced Mo plants (Mo-TRV-HsfA1a) 36 h after RKN infection. C, Accumulation of Hsp90 proteins from Mo-TRV, Mo-TRV-HsfA1a, and Mo-TRV-Wfi1 36 h after RKN infection as shown using anti Hsp90 polyclonal antibodies. Equal protein loading was confirmed using an antiactin antibody. Different letters indicate statistically significant differences (P < 0.05, Tukey’s test).

The molecular chaperone Hsp90 is required for R-gene-mediated resistance, and it interacts with RAR1, SGT1, and R proteins (Bhattarai et al., 2007). We therefore analyzed the expression of the Hsp90-1 and Sgt1-1 genes and the accumulation of Hsp90 in HsfA1a- and Wfi1-silenced Mo plants. As shown in Figure 7B, the transcript levels of both Hsp90-1 and Sgt1-1 were increased at 36 hpi with RKNs in the Mo empty vector plants; however, the silencing of HsfA1a and Wfi1 compromised the RKN-induced expression of Hsp90-1 and Sgt1-1. Moreover, Hsp90 protein accumulated to very high levels at 36 hpi, with RKNs in the Mo empty vector plants. Such an increase in the level of Hsp90 protein was not observed in HsfA1a- and Wfi1-silenced plants (Fig. 7C). These results imply that HsfA1a and Wfi1 are required for the induction of Hsp90-1 and Sgt1-1 in the Mi-1.2-dependent defense pathway against RKNs.

DISCUSSION

Although ROS have been suggested to play a crucial role in R-gene-mediated resistance against pathogens, how ROS signaling is regulated remains largely unknown. In the current study, we showed that the HsfA1a-mediated production of ROS was important for Mi-1.2-mediated RKN resistance. Silencing the HsfA1a gene abolished Mi-1.2-mediated RKN resistance, Wfi1 gene expression, and ROS accumulation. Moreover, HsfA1a could regulate the transcription of Wfi1 by directly binding to the promoter of the Wfi1 gene; decreased Wfi1 transcription compromised Mi-1.2-mediated RKN resistance. HsfA1a and Wfi1 were also involved in the regulation of the Mi-1.2-mediated-resistance-related genes Hsp90-1 and Stg1-1. We also found that Mi-1.2-mediated RKN resistance is directly linked to the higher induction of both HsfA1a and Wfi1 relative to that in susceptible genotypes.

The role of Hsfs in plant basal tolerance to heat and other abiotic stresses is well established (Hahn et al., 2011; Scharf et al., 2012). HsfA family proteins contain the domain of transcriptional activation (Kotak et al., 2004). Although the transcription of several HsfAs is known to be induced by various biotic stressors in plants, evidence for the roles of Hsfs in plant pathogen defense is scarce (von Koskull-Döring et al., 2007; Hu et al., 2015). In this study, we found that the highest transcript levels of most HsfA genes were detected at 18 hpi, in the roots of RKN-resistant tomato plants (Fig. 2; Supplemental Fig. S5). However, only the silencing of HsfA1a compromised Mi-1.2-mediated RKN resistance (Fig. 2), indicating that HsfA1a contributes mostly to the Mi-1.2-resistant signaling pathway in response to RKNs.

HsfA1a is a master regulator that functions as an activator of its target genes under stresses (Liu et al., 2011; Wang et al., 2015). Exposure to stress leads to interaction of this protein with HsfA2 and HsfB1 to form hetero-oligomers and thus activate the transcription of numerous Hsp genes (von Koskull-Döring et al., 2007). In addition to Hsp genes, HsfA1a can regulate other functional genes, including those involved in protein biosynthesis and processing, signaling, metabolism, and transport in Arabidopsis during heat stress (Busch et al., 2005). Recently, we found that HsfA1a can bind to the promoters of two autophagy-related genes (Atg10 and Atg18f) and can induce the expression of these genes and autophagy in tomato plants under drought stress (Wang et al., 2015). Here, we found that the silencing of HsfA1a not only attenuated RKN resistance in susceptible genotypes but also abolished Mi-1.2-mediated RKN resistance, revealing that HsfA1 has dual functions in the regulation of the basal immunity and Mi-1.2-triggered defense signaling (Fig. 2) and providing evidence for the involvement of an Hsf in R-gene-mediated resistance.

In the current study, HsfA1a-induced RKN resistance was tightly linked to ROS accumulation, which resulted mostly from the activity of Wfi1 (RBOHB) NADPH oxidase in the apoplast after RKN infection (Fig. 3). Although the expression levels of eight RBOHs increased to different extents at 12 to 36 hpi in Mi-1.2-mediated resistant plants, only Wfi1 transcription was compromised in HsfA1a-silenced plants, with reduced ROS accumulation. This suggests that Wfi1 is the key regulator of ROS production in response to RKN infection (Fig. 4). Tomato Wfi1 is a homolog of AtRBOHD and is the most highly expressed RBOH homolog in tomato plants (Sagi et al., 2004). Similar to suppression of wounding-induced ROS accumulation and jasmonic acid signaling downstream of the PI-1 gene, Wfi1 silencing also suppresses flg22-induced ROS bursts and the expression of the PTI marker gene Lrr22, while Wfi1 overexpression in Nicotiana benthamiana enhances resistance to B. cinearea (Li et al., 2015). In line with previous reports, here, we provide convincing evidence of the involvement of Wfi1 NADPH oxidase-dependent apoplastic ROS in R-gene-mediated resistance against nematodes.

In Arabidopsis, the strong and specific RBOHD-dependent production of ROS is one of the earliest responses after PAMP treatment and is also observed during ETI, though at a much slower pace (Kadota et al., 2015). RBOH-produced ROS trigger the HR through programmed cell death in pathogen-infected cells (Nühse et al., 2007; Elling et al., 2014; Gilroy et al., 2014; Couto and Zipfel, 2016). Although these studies demonstrated the central role of ROS-induced defense response signaling in PTI and ETI gene-mediated defense, little is known how RBOH/NADPH oxidase is activated. In Arabidopsis, the RBOHD promoter is activated and RBOH/NADPH oxidase-dependent ROS accumulate in response to avirulent Pto DC3000 (avrRpm1) following the activation of ETI (Morales et al., 2016). Recently, Li et al. (2014b) reported that the plasma membrane-associated cytoplasmic kinase BIK1, a direct substrate of pattern recognition receptors, directly interacts with and phosphorylates RBOHD to induce ROS accumulation and defense responses. In our study, EMSA and ChIP-qPCR assays both confirmed that HsfA1a can bind to the promoter of the RBOH gene Wfi1 (Fig. 5), leading to the induction of ROS production and the HR (Figs. 2 and 6). Furthermore, the silencing of Wfi1 attenuated the RKN infection-induced H2O2 accumulation, HR, and resistance to RKN (Fig. 6). These results provide convincing evidence that HsfA1a is an upstream regulator of Mi-1.2-mediated ROS production and subsequent defense. It is of great interest to study whether the homologs of Wfi1, such as RBOHD in Arabidopsis, are subject to the transcriptional regulation of HsfA in other plants in R-gene-mediated resistance to pathogens.

Mi-1.2 encodes a single protein with NBS-LRR motifs; however, its signal transduction remains unclear. In one study, de Ilarduya et al. (2001) found that mutating the rme1 gene abolished Mi-1.2-mediated RKN resistance, as Rme1 could interact directly or indirectly with Mi-1.2 and function in the early steps of the resistance signaling pathway. The R protein RPS2 mediates the HR against Pto DC3000 in Arabidopsis (Takahashi et al., 2003); similarly, the chaperone Hsp90 and its interacting proteins, Sgt1, Wrky70, and Wrky72a/b, are all critical for Mi-1.2-mediated RKN resistance (Bhattarai et al., 2007; Bhattarai et al., 2010; Atamian et al., 2012). Furthermore, the Hsp90-Sgt1 chaperone complex plays essential roles in the stabilization, pathogen recognition, and signal transduction of the R protein signaling complex during pathogen attack (Shirasu, 2009). Similarly, Mi-1.2-mediated RKN resistance is partially compromised in Hsp90-1- and Sgt1-silenced plants (Bhattarai et al., 2007). Hsp90 is a target gene of HsfA1a and can interact with HsfA1a under heat stress (Hahn et al., 2011). In agreement with our earlier finding that RBOH1-dependent H2O2 production is critical for the induction of several Hsps (Li et al., 2014a), we found here that the Mi-1.2-mediated expression of Hsp90-1 and Sgt1-1 and the accumulation of Hsp90 proteins were abolished in HsfA1a- and Wfi1-silenced plants during RKN infection (Fig. 7). These results lead us to argue that the HsfA1a-Wfi1 cascade is important not only for the ROS-dependent HR but also for the stability of the Mi-1.2 protein complex with Hsp90. A previous study showed that the transcription factor genes Wrky72a/b are transcriptionally upregulated in the resistant Mo roots but were not upregulated in susceptible MM roots after RKN infection; this suggested that the RKN-induced Wrky72a/b expression is dependent on Mi-1.2 (Bhattarai et al., 2010). Similarly, we found the RKN-induced transcript accumulations of HsfA1a and Wfi1 were both compromised in Mi-1.2-silenced Mo plants (Fig. 7A). These results indicate that Mi-1.2 acts a critical regulator in RKN-induced resistance gene signaling pathways. Notably, Mi-1.2-mediated resistance against RKNs is abolished when the growth temperature is >28°C (Dropkin, 1969). Given the significant impact of environmental factors on Hsf and ROS homeostasis in cells, it is of great interest to study whether environmental factors such as growth temperatures affect R-gene-mediated resistance by enhancing redox signaling and HsfA1a expression. The ROS are important as signaling compounds for cell death, or for activation of other defenses, or through direct toxicity to pathogens (Yoshioka et al., 2003; Dunand et al., 2007; Li et al., 2015), and results from the current study suggest that both pathways contribute to Mi-1.2-mediated nematode resistance.

In conclusion, our results demonstrate the importance of the HsfA1a-Wfi1 cascade in R-gene-mediated resistance and in RKN susceptibility. RKNs attack root cells and the active Mi-1.2 complex induces HsfA1a expression. HsfA1a forms trimers and binds HSE motifs of the promoters of defense-related genes, including Wfi1 and Hsp90. The HsfA1a-Wfi1 cascade is also important for the maintenance of NBS-LRR protein complexes with chaperones such as Hsp90. Wfi1-dependent ROS induce HR around RKN-infected cells, resulting in failure of RKN development in the roots (Fig. 8). Our work provides new insight into the R-gene-mediated resistance mechanism and for potential approaches manipulating the HsfA1a-Wfi1 cascade to enhance plant resistance to pests.

Figure 8.

Figure 8.

Open in a new tab

A proposed model for the HsfA1a-Wfi1 cascade in Mi-1.2-mediated RKN resistance. RKNs attack root cells and active Mi-1.2 complex to induce HsfA1a expression. HsfA1a forms trimers and binds HSE motifs of the promoters of defense-related genes including Wfi1 and Hsp90. Meanwhile, HsfA1a-Wfi1 cascade is also important for the maintenance of NBS-LRR protein complexes with chaperones such as Hsp90. Wfi1-dependent ROS induce HR around RKN-infected cells, resulting in failure of RKN development in the roots.

MATERIALS AND METHODS

Plant Materials

The tomato (Solanum lycopersicum) cultivars Mo (Mi-1.2/Mi-1.2), MM (mi-1.2/mi-1.2), and AC (mi-1.2/mi-1.2) were used in all experiments. Germinated seeds were grown in 100-cm3 plastic pots filled with steam-sterilized river sand. The plants were watered daily with Hoagland’s nutrient solution in the growth room. The growth conditions were maintained at 23/21°C day/night temperature and a photoperiod of 14 h with 600 μmol m−2 s−1 photosynthetic photon flux density. The transgenic HsfA1aOE tomato (Solanum lycopersicum) lines were in the Mo and AC backgrounds. To silence gene transcription, VIGS was used. The Mi-1.2, Wfi1, and HsfA family genes were amplified by PCR using specific primers as presented in Supplemental Table S1. The PCR products were digested by specific restriction enzymes and ligated into the same restriction sites in TRV2. The specific restriction sites of each vector were presented in Supplemental Table S1. For the VIGS assay, a mixed culture of Agrobacterium tumefaciens bearing TRV1 and gene-targeted TRV2 in a 1:1 ratio was infiltrated into germinating seeds by vacuum infiltration. The inoculated seeds were sown, and the seedlings were grown in a growth room at 22°C for 4 weeks before they were used for experiments (Cai et al., 2017). Two independent homozygous transgenic lines overexpressing the HsfA1a in the Mo or AC backgrounds were used for experiments as described previously (Wang et al., 2015). The full-length coding DNA sequence was amplified with the primers (5′-TTGGCGCGCCATGGAGCCGAATTCTTAT-3′) and (5′-GGGGTACCGATCATATGTTTTTGTTG-3′) using tomato cDNA as the template. The PCR product was digested with AscI and KpnI and inserted downstream of the CaMV 35S promoter in the plant transformation vector pFGC1008-HA. The resulting HsfA1a-HA plasmid was transformed into A. tumefaciens strain EHA105. Mo and AC tomato seeds were used for the transformation.

Meloidogyne incognita Infection Assays

Plants at the four-leaf stage were used for RKN infection. The RKN M. incognita line, race 1, was cultured on the susceptible tomato cultivar AC in a greenhouse at 22°C to 26°C. Nematode EMs were extracted from infected roots by processing in 0.52% NaOCl in a blender for 2 min at 12,000 rpm (Zhou et al., 2015). The egg masses were passed through a 100-mesh sieve and collected on a 500-mesh sieve. Second-stage juveniles (J2s) were obtained by hatching the eggs in petri dishes with two layers of paper towels. The dishes were incubated at 27°C, and J2 hatchlings were collected after 48 h. The tomato plants were inoculated with 2,000 J2s or mock inoculated with water over the surface of the sand around the primary roots using a pipette. In each experiment, more than 30 plants of each genotype were infected with nematodes. Nematode colonization was detected by staining the roots with 3.5% acid fuchsin. Seven weeks after inoculation, the EMs were evaluated by staining with 3.5% acid fuchsin.

Nematode Staining

To detect RKN colonization and production, plants were carefully uprooted and washed. The roots were placed in 1.5% (w/v) NaOCl for 4 min, then rinsed with tap water to remove excess NaOCl. The roots were then plunged into boiling 3.5% acid fuchsin stain, after which they were rinsed with tap water and blotted dry (Zhou et al., 2015). To examine RKN colonization, more than 10 roots of each treatment were placed in acidified glycerin and photographed (BX61; Olympus). Thirty seedlings of each genotype were used for the determination of the EMs on individual root systems in each experiment. For each treatment, nematode assays were performed three or four times.

Cell Death Detection by TB Staining

The TB staining was performed according to the method of Phillips and Hayman (1970), with minor modifications. Roots were cleared with 10% (w/v) KOH by boiling for 15 min, rinsed once with water, soaked in 2% (w/v) HCl at room temperature for 5 min, and stained with TB solution (0.05% in lactic acid, Sigma-Aldrich) by boiling for 5 min. After rinsing three times with water, the roots were stored in lactoglycerol (lactic acid:glycerol:water, 8:1:1 [v/v/v]). At each time point, 6 roots per cultivar were stained, and more than 100 root tips were assessed and photographed (BX61; Olympus). The dead cells, which were stained blue, and the total cells were counted under a microscope. The percentage of cell death was determined and recorded (Biermann and Linderman, 1981). The RKN experiment was repeated three times with similar results. In each case, data from one representative experiment are presented.

Total RNA Extraction and Gene Expression Analysis

Total RNA was extracted from tomato roots using an RNA extraction kit (Tiangen) following the manufacturer’s instructions. First-strand cDNA was synthesized from 500 ng of total RNA with a Rever Tra Ace qPCR RT Kit (Toyobo). RT-qPCR was performed using a Light Cycler 480 II Real-Time PCR detection system (Roche), and the tomato Actin2 gene was used as an internal control. Each reaction consisted of 10 μL SYBR Green PCR Master Mix, 1 μL cDNA, and forward and reverse primers at 0.1 μm. The PCR program included predenaturation at 95°C for 3 min, followed by 35 cycles of 95°C for 30 s, 58°C for 15 s, and 72°C for 30 s, and then a final extension at 72°C for 5 min. Gene-specific primers are listed in Supplemental Table S2. Relative gene expression was calculated as described previously (Livak and Schmittgen, 2001). Four biological replicates were analyzed. Cluster analysis was performed using MeV version 4.9 (http://www.tm4.org/). The color bar at the bottom shows the levels of expression.

Protein Extraction and Western Blotting

For protein extraction, tomato roots were collected 36 h after RKN infection, ground in liquid nitrogen, and homogenized in extraction buffer (20 mm HEPES, pH 7.5, 40 mm KCl, 1 mm EDTA, 1% Triton X-100, 10% glycerol, 1 mm PMSF, 5 mm DTT, and 25 mm sodium fluoride). The extracted protein was heated at 95°C for 15 min, then separated using 10% SDS-PAGE. For western blotting, the proteins on the SDS-PAGE gel were transferred to a nitrocellulose membrane. The membrane was blocked for 1 h at room temperature in TBS (20 mm Tris, pH 7.5, 150 mm NaCl, and 0.1% Tween 20 with 5% skim milk powder), then incubated for 1 h in TBS with 1% BSA and a mouse anti-HA monoclonal antibody (Thermo Fisher Scientific), a rabbit anti-Hsp90 polyclonal antibody (Santa Cruz Biotechnology), or a rabbit antiactin polyclonal antibody (Abcam). After incubation with a goat anti-mouse HRP-conjugated antibody (Cell Signaling Technology) or a goat anti-rabbit HRP-conjugated antibody (Cell Signaling Technology), the complexes on the blot were visualized using SuperSignal West Pico Chemiluminescent Substrate (Thermo Fisher Scientific) following the manufacturer’s instructions.

H2O2 Quantification, Histochemical Analysis, and Cytochemical Detection

To determine H2O2 concentrations, 0.3 g of fresh root tissue was homogenized in 3 mL of precooled HClO4 (1.0 m) using a prechilled mortar and pestle according to the method described previously (Willekens et al., 1997). H2O2 and O2⋅− accumulation in root tissues was visualized using DCF, DAB, and NBT staining as described previously (Dunand et al., 2007; Zhou et al., 2014b; Yi et al., 2015). To detect O2⋅− production with NBT, detached roots were stained for 15 min in a solution of 0.5 g/L NBT in 25 mm HEPES buffer (pH 7.8). The reaction was stopped by transferring the seedlings to distilled water. The roots were stored in acidified glycerin and photographed (BX61; Olympus; Dunand et al., 2007). To detect H2O2 production with DCF, detached roots were washed with deionized water, incubated for 15 min with 25 μm DCF in 200 mm phosphate buffer (pH 7.4), then washed five times with the same buffer without dye. To scavenge H2O2, the root segments were incubated with 1 mm ascorbate or 100 U/mL catalase for 30 min; these samples served as negative controls. Fluorescence was observed using a Leica DM4000B microscope, and images were captured using a Leica DFC425C camera and Leica application suite V3.8 software (Leica Microsystems, Wetzlar; Yi et al., 2015). To detect H2O2 production with DAB, detached roots were washed with deionized water and placed in a solution containing 1 mg/mL DAB (pH 5.5) for 4 h after briefly vacuum infiltrating. The detached roots were boiled in 90% (v/v) ethanol for 10 min, stored in acidified glycerin, and photographed (BX61; Olympus; Zhou et al., 2014b).

H2O2 was also monitored at the subcellular level using CeCl3 for localization as described previously (Zhou et al., 2014a). The sections were examined using a transmission electron microscope (Hitachi) at an accelerating voltage of 75 kV to detect the electron-dense CeCl3 deposits that formed in the presence of H2O2.

Recombinant Protein and EMSA Analysis

The preparation of tomato HsfA1a recombinant protein and the EMSA were performed as previously described (Cai et al., 2017). Briefly, the probes were biotin end-labeled according to the instructions of the Biotin 3′ End DNA Labeling Kit (Thermo Fisher Scientific) and then incubated with double-stranded probe DNA (Wfi1, AAATTCCTTGAAGTTTCAAGTTCAACTGT; Wfi1Δ, AAATTCCTTAAAGTTTAAAGTTCAACTGT). HsfA1a-DNA complexes were analyzed according to the instructions of the Light Shift Chemiluminescent EMSA kit (Thermo Fisher Scientific).

ChIP

ChIP experiments were performed according to a previously described method (Cai et al., 2017), and the EpiQuik Plant ChIP Kit (Epigentek) was used. Approximately 3 g of root tissue was harvested from HsfA1a-OE and wild-type plants after RKN infection. Chromatin was immunoprecipitated with an anti-HA antibody (Thermo Fisher Scientific); goat anti-mouse IgG (Cell Signaling Technology) was used as the negative control. Primers specific for Wfi1, RBOHA and RBOHC promoter are listed in Supplemental Table S3.

Immunofluorescence Analysis of Cellular Localization of HsfA1a

Immunofluorescence analysis of roots were performed according to (Rivière et al., 2008) with modification. Root tips were cut using Thermo Scientific CryoStar NX50 and then affixed to a slide using a coating of poly-l-Lysine (Invitrogen) and heated briefly (5 min) under room temperature. Sections were permeabilized for 5 min with 0.1% Triton X-100 (pH 8.0, PBS) and then incubated for 1 h in blocking solution (1% [w/v] BSA; PBS) in a wet box under room temperature. After washing with PBS solution three times, the root sections were incubated with primary antibody mouse anti-HA antibody (Thermo Fisher Scientific) at a 1:500 dilution in a wet box at 4°C overnight. Sections were then washed with PBS and incubated for 1 h with goat anti-mouse IgG H&L (Alexa Fluor594) secondary antibody (Abcam) diluted 1:1,000 in a dark-wet box at room temperature. All antibodies were diluted in 1% (w/v) BSA in PBS. Finally, the root sections were washed three times with PBS and observed under a Nikon A1 confocal microscope (Nikon) in a glycerin solution.

Phylogenetic Tree Building

The phylogenetic tree of the rice (Oryza sativa), Arabidopsis (Arabidopsis thaliana), and tomato HsfA protein sequences was constructed using MEGA (version 7.0; Kumar et al., 2016), using the neighbor-joining method, with the following parameters: Poisson correction, pairwise deletion, bootstrap (1,000 replicates; random seed).

Statistical Analysis

At least four independent replicates were used for each measurement. Statistical analysis of the bioassays was performed using the SAS statistical software package, and a P value of < 0.05 was considered statistically significant.

Accession Numbers

Sequence data from this article can be found in the Sol Genomics Network, the Arabidopsis Information Resource, and the Rice Genome Annotation Project databases under the following accession numbers: Actin, Solyc03g078400; AtHsfA1a, At4g17750; AtHsfA1b, At5g16820; AtHsfA1d, At1g32330; AtHsfA1e, At3g02990; AtHsfA2, At2g26150; AtHsfA3, At5g03720; AtHsfA4a, At4g18880; AtHsfA4c, At5g45710; AtHsfA5, At4g13980; AtHsfA6a, At5g43840; AtHsfA6b, At3g22830; AtHsfA7a, At3g51910; AtHsfA7b, At3g63350; AtHsfA8, At1g67970; AtHsfA9, At5g54070; HsfA1a, Solyc08g005170; HsfA1b, Solyc03g097120; HsfA1c, Solyc08g076590; HsfA1e, Solyc06g072750; HsfA2, Solyc08g062960; HsfA3, Solyc09g009100; HsfA4a, Solyc03g006000; HsfA4b, Solyc07g055710; HsfA4c, Solyc02g072000; HsfA5, Solyc012g098520; HsfA6a, Solyc09g082670; HsfA6b, Solyc06g053960; HsfA7, Solyc09g065660; HsfA8, Solyc09g059520; HsfA9, Solyc07g040680; Hsp90-1, Solyc12g015880; Mi-1.2, Solyc06g008790; OsHsfA1, Os03g63750; OsHsfA2a, Os03g58160; OsHsfA2b, Os07g08140; OsHsfA2e, Os03g53340; OsHsfA3, Os02g32590; OsHsfA4a, Os01g54550; OsHsfA4d, Os05g45410; OsHsfA5, Os02g29340; OsHsfA6a, Os10g28340; OsHsfA6b, Os03g06630; OsHsfA7a, Os01g39020; OsHsfA7b, Os06g36930; OsHsfA8, Os03g12370; RBOH1, Solyc08g081690; RBOHA, Solyc01g099620; RBOHC, Solyc05g025680; RBOHD, Solyc06g068680; RBOHE, Solyc06g075570; RBOHF, Solyc07g042460; RBOHH, Solyc11g072800; Sgt1-1, Solyc03g007670; and Wfi1, Solyc03g117980.

Supplemental Data

The following supplemental materials are available.

  • Supplemental Figure S1. Relative mRNA abundance of Mi-1.2, HsfA genes, and Wfi1 in virus-induced gene silencing plants.

  • Supplemental Figure S2. Time course of RKN colonization in susceptible MM empty vector plants (MM-TRV), resistant Mo empty vector plants (Mo-TRV), and Mi-1.2-silenced Mo plants (Mo-TRV-Mi-1.2) after RKN infection.

  • Supplemental Figure S3. Accumulation of ROS in the roots of Mo and Mo-TRV at 36 h after RKN infection.

  • Supplemental Figure S4. Phylogenetic relationship of the HsfA proteins from Arabidopsis, tomato, and rice.

  • Supplemental Figure S5. Transcript levels of HsfA genes in resistant Mo plants after RKN infection at different time points.

  • Supplemental Figure S6. Time course of RKN colonization in resistant Mo empty vector plants (Mo-TRV) and Mo-TRV-HsfA1a after RKN infection.

  • Supplemental Figure S7. Time course of the HR and RKN colonization in the roots of AC, AC-HsfA1a-OE, Mo, and Mo-HsfA1a-OE after RKN infection.

  • Supplemental Figure S8. Phenotype of the whole plants (top) and the roots (bottom) of AC, AC-HsfA1a-OE, AC-TRV, and AC-TRV-HsfA1a under normal condition.

  • Supplemental Figure S9. Accumulation of ROS and the Wfi1 transcript in the roots of AC, AC-HsfA1a-OE, Mo, and Mo-HsfA1a-OE under normal conditions.

  • Supplemental Figure S10. Accumulation of H2O2 after RKN infection in tomato roots silenced for HsfA genes.

  • Supplemental Figure S11. Time course of RKN colonization in resistant Mo empty vector plants (Mo-TRV) and HsfA1a-silenced Mo plants (Mo-TRV-Wfi1) after RKN infection.

  • Supplemental Figure S12. Immunofluorescence analysis of HsfA1a protein in the roots of Mo and Mo-HsfA1a-OE plants after RKN infection.

  • Supplemental Table S1. PCR primers and restriction sites for VIGS vectors.

  • Supplemental Table S2. Primers used for RT-qPCR assays.

  • Supplemental Table S3. Primers used for ChIP-qPCR assays.

Acknowledgments

We are grateful to the Tomato Genetics Resource Center at the University of California, Davis, for kind advice on the Solanum lycopersicum cv Motelle and Moneymaker seeds.

References

  1. Asai S, Ohta K, Yoshioka H (2008) MAPK signaling regulates nitric oxide and NADPH oxidase-dependent oxidative bursts in Nicotiana benthamiana. Plant Cell 20: 1390–1406 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Atamian HS, Eulgem T, Kaloshian I (2012) SlWRKY70 is required for Mi-1-mediated resistance to aphids and nematodes in tomato. Planta 235: 299–309 [DOI] [PubMed] [Google Scholar]
  3. Bhattarai KK, Atamian HS, Kaloshian I, Eulgem T (2010) WRKY72-type transcription factors contribute to basal immunity in tomato and Arabidopsis as well as gene-for-gene resistance mediated by the tomato R gene Mi-1. Plant J 63: 229–240 [DOI] [PubMed] [Google Scholar]
  4. Bhattarai KK, Li Q, Liu Y, Dinesh-Kumar SP, Kaloshian I (2007) The MI-1-mediated pest resistance requires Hsp90 and Sgt1. Plant Physiol 144: 312–323 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Biermann B, Linderman RG (1981) Quantifying vesicular-arbuscular mycorrhizae: a proposed method towards standardization. New Phytol 87: 63–67 [Google Scholar]
  6. Busch W, Wunderlich M, Schöffl F (2005) Identification of novel heat shock factor-dependent genes and biochemical pathways in Arabidopsis thaliana. Plant J 41: 1–14 [DOI] [PubMed] [Google Scholar]
  7. Cai SY, Zhang Y, Xu YP, Qi ZY, Li MQ, Ahammed GJ, Xia XJ, Shi K, Zhou YH, Reiter RJ, et al. (2017) HsfA1a upregulates melatonin biosynthesis to confer cadmium tolerance in tomato plants. J Pineal Res 62: e12387. [DOI] [PubMed] [Google Scholar]
  8. Couto D, Zipfel C (2016) Regulation of pattern recognition receptor signalling in plants. Nat Rev Immunol 16: 537–552 [DOI] [PubMed] [Google Scholar]
  9. Cui H, Tsuda K, Parker JE (2015) Effector-triggered immunity: from pathogen perception to robust defense. Annu Rev Plant Biol 66: 487–511 [DOI] [PubMed] [Google Scholar]
  10. de Ilarduya OM, Moore AE, Kaloshian I (2001) The tomato Rme1 locus is required for Mi-1-mediated resistance to root-knot nematodes and the potato aphid. Plant J 27: 417–425 [DOI] [PubMed] [Google Scholar]
  11. Djian-Caporalino C, Molinari S, Palloix A, Ciancio A, Fazari A, Marteu N, Ris N, Castagnone-Sereno P (2011) The reproductive potential of the root-knot nematode Meloidogyne incognita is affected by selection for virulence against major resistance genes from tomato and pepper. Eur J Plant Pathol 131: 431–440 [Google Scholar]
  12. Dropkin VH. (1969) Necrotic reaction of tomatoes and other hosts resistant to Meloidogyne. Reversal by temperature. Phytopathology 59: 1632–1637 [Google Scholar]
  13. Dubiella U, Seybold H, Durian G, Komander E, Lassig R, Witte CP, Schulze WX, Romeis T (2013) Calcium-dependent protein kinase/NADPH oxidase activation circuit is required for rapid defense signal propagation. Proc Natl Acad Sci USA 110: 8744–8749 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dunand C, Crèvecoeur M, Penel C (2007) Distribution of superoxide and hydrogen peroxide in Arabidopsis root and their influence on root development: possible interaction with peroxidases. New Phytol 174: 332–341 [DOI] [PubMed] [Google Scholar]
  15. Eitas TK, Dangl JL (2010) NB-LRR proteins: pairs, pieces, perception, partners, and pathways. Curr Opin Plant Biol 13: 472–477 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Elling AA, Davies LJ, Brown CR (2014) Calcium plays a key role in mediating the R Mc1(blb) resistance response against Meloidogyne chitwoodi in potato. Phytopathology 104: 37 [Google Scholar]
  17. Escobar C, Barcala M, Portillo M, Almoguera C, Jordano J, Fenoll C (2003) Induction of the Hahsp17.7G4 promoter by root-knot nematodes: involvement of heat-shock elements in promoter activity in giant cells. Mol Plant Microbe Interact 16: 1062–1068 [DOI] [PubMed] [Google Scholar]
  18. Gilroy S, Suzuki N, Miller G, Choi WG, Toyota M, Devireddy AR, Mittler R (2014) A tidal wave of signals: calcium and ROS at the forefront of rapid systemic signaling. Trends Plant Sci 19: 623–630 [DOI] [PubMed] [Google Scholar]
  19. Goverse A, Smant G (2014) The activation and suppression of plant innate immunity by parasitic nematodes. Annu Rev Phytopathol 52: 243–265 [DOI] [PubMed] [Google Scholar]
  20. Hahn A, Bublak D, Schleiff E, Scharf KD (2011) Crosstalk between Hsp90 and Hsp70 chaperones and heat stress transcription factors in tomato. Plant Cell 23: 741–755 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hosseini P, Matthews BF (2014) Regulatory interplay between soybean root and soybean cyst nematode during a resistant and susceptible reaction. BMC Plant Biol 14: 300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hu Y, Han YT, Wei W, Li YJ, Zhang K, Gao YR, Zhao FL, Feng JY (2015) Identification, isolation, and expression analysis of heat shock transcription factors in the diploid woodland strawberry Fragaria vesca. Front Plant Sci 6: 736. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Hwang CF, Williamson VM (2003) Leucine-rich repeat-mediated intramolecular interactions in nematode recognition and cell death signaling by the tomato resistance protein Mi. Plant J 34: 585–593 [DOI] [PubMed] [Google Scholar]
  24. Jain S, Chittem K, Brueggeman R, Osorno JM, Richards J, Nelson BD Jr (2016) Comparative transcriptome analysis of resistant and susceptible common bean genotypes in response to soybean cyst nematode infection. PLoS One 11: e0159338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Jones JDG, Dangl JL (2006) The plant immune system. Nature 444: 323–329 [DOI] [PubMed] [Google Scholar]
  26. Kadota Y, Shirasu K, Zipfel C (2015) Regulation of the NADPH oxidase RBOHD during plant immunity. Plant Cell Physiol 56: 1472–1480 [DOI] [PubMed] [Google Scholar]
  27. Kadota Y, Sklenar J, Derbyshire P, Stransfeld L, Asai S, Ntoukakis V, Jones JDG, Shirasu K, Menke F, Jones A, et al. (2014) Direct regulation of the NADPH oxidase RBOHD by the PRR-associated kinase BIK1 during plant immunity. Mol Cell 54: 43–55 [DOI] [PubMed] [Google Scholar]
  28. Kobayashi M, Ohura I, Kawakita K, Yokota N, Fujiwara M, Shimamoto K, Doke N, Yoshioka H (2007) Calcium-dependent protein kinases regulate the production of reactive oxygen species by potato NADPH oxidase. Plant Cell 19: 1065–1080 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Kotak S, Port M, Ganguli A, Bicker F, von Koskull-Döring P (2004) Characterization of C-terminal domains of Arabidopsis heat stress transcription factors (Hsfs) and identification of a new signature combination of plant class A Hsfs with AHA and NES motifs essential for activator function and intracellular localization. Plant J 39: 98–112 [DOI] [PubMed] [Google Scholar]
  30. Kumar S, Stecher G, Tamura K (2016) MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol 33: 1870–1874 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Li H, Liu SS, Yi CY, Wang F, Zhou J, Xia XJ, Shi K, Zhou YH, Yu JQ (2014a) Hydrogen peroxide mediates abscisic acid-induced HSP70 accumulation and heat tolerance in grafted cucumber plants. Plant Cell Environ 37: 2768–2780 [DOI] [PubMed] [Google Scholar]
  32. Li L, Li M, Yu L, Zhou Z, Liang X, Liu Z, Cai G, Gao L, Zhang X, Wang Y, et al. (2014b) The FLS2-associated kinase BIK1 directly phosphorylates the NADPH oxidase RbohD to control plant immunity. Cell Host Microbe 15: 329–338 [DOI] [PubMed] [Google Scholar]
  33. Li X, Zhang H, Tian L, Huang L, Liu S, Li D, Song F (2015) Tomato SlRbohB, a member of the NADPH oxidase family, is required for disease resistance against Botrytis cinerea and tolerance to drought stress. Front Plant Sci 6: 463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Liu HC, Liao HT, Charng YY (2011) AThe role of class A1 heat shock factors (HSFA1s) in response to heat and other stresses in Arabidopsis. Plant Cell Environ 34: 738–751 [DOI] [PubMed] [Google Scholar]
  35. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402–408 [DOI] [PubMed] [Google Scholar]
  36. Lukasik-Shreepaathy E, Slootweg E, Richter H, Goverse A, Cornelissen BJC, Takken FLW (2012) Dual regulatory roles of the extended N terminus for activation of the tomato MI-1.2 resistance protein. Mol Plant Microbe Interact 25: 1045–1057 [DOI] [PubMed] [Google Scholar]
  37. Martinez de Ilarduya O, Nombela G, Hwang CF, Williamson VM, Muñiz M, Kaloshian I (2004) Rme1 is necessary for Mi-1-mediated resistance and acts early in the resistance pathway. Mol Plant Microbe Interact 17: 55–61 [DOI] [PubMed] [Google Scholar]
  38. Melillo MT, Leonetti P, Bongiovanni M, Castagnone-Sereno P, Bleve-Zacheo T (2006) Modulation of reactive oxygen species activities and H2O2 accumulation during compatible and incompatible tomato-root-knot nematode interactions. New Phytol 170: 501–512 [DOI] [PubMed] [Google Scholar]
  39. Melillo MT, Leonetti P, Leone A, Veronico P, Bleve-Zacheo T (2011) ROS and NO production in compatible and incompatible tomato-Meloidogyne incognita interactions. Eur J Plant Pathol 130: 489–502 [Google Scholar]
  40. Milligan SB, Bodeau J, Yaghoobi J, Kaloshian I, Zabel P, Williamson VM (1998) The root knot nematode resistance gene Mi from tomato is a member of the leucine zipper, nucleotide binding, leucine-rich repeat family of plant genes. Plant Cell 10: 1307–1319 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Morales J, Kadota Y, Zipfel C, Molina A, Torres MA (2016) The Arabidopsis NADPH oxidases RbohD and RbohF display differential expression patterns and contributions during plant immunity. J Exp Bot 67: 1663–1676 [DOI] [PubMed] [Google Scholar]
  42. Nombela G, Williamson VM, Muñiz M (2003) The root-knot nematode resistance gene Mi-1.2 of tomato is responsible for resistance against the whitefly Bemisia tabaci. Mol Plant Microbe Interact 16: 645–649 [DOI] [PubMed] [Google Scholar]
  43. Nühse TS, Bottrill AR, Jones AME, Peck SC (2007) Quantitative phosphoproteomic analysis of plasma membrane proteins reveals regulatory mechanisms of plant innate immune responses. Plant J 51: 931–940 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Phillips JM, Hayman DS (1970) Improved procedure for cleaning roots and staining parasitic and vesicular-arbuscular mycorrhizal fungi for rapid assessment of infection. Trans Br Mycol Soc 55: 158–161 [Google Scholar]
  45. Rivière MP, Marais A, Ponchet M, Willats W, Galiana E (2008) Silencing of acidic pathogenesis-related PR-1 genes increases extracellular beta-(1->3)-glucanase activity at the onset of tobacco defence reactions. J Exp Bot 59: 1225–1239 [DOI] [PubMed] [Google Scholar]
  46. Sagi M, Davydov O, Orazova S, Yesbergenova Z, Ophir R, Stratmann JW, Fluhr R (2004) Plant respiratory burst oxidase homologs impinge on wound responsiveness and development in Lycopersicon esculentum. Plant Cell 16: 616–628 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Sagi M, Fluhr R (2006) Production of reactive oxygen species by plant NADPH oxidases. Plant Physiol 141: 336–340 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Sarris PF, Duxbury Z, Huh SU, Ma Y, Segonzac C, Sklenar J, Derbyshire P, Cevik V, Rallapalli G, Saucet SB, et al. (2015) A plant immune receptor detects pathogen effectors that target WRKY transcription factors. Cell 161: 1089–1100 [DOI] [PubMed] [Google Scholar]
  49. Scharf KD, Berberich T, Ebersberger I, Nover L (2012) The plant heat stress transcription factor (Hsf) family: structure, function and evolution. Biochim Biophys Acta 1819: 104–119 [DOI] [PubMed] [Google Scholar]
  50. Shirasu K. (2009) The HSP90-SGT1 chaperone complex for NLR immune sensors. Annu Rev Plant Biol 60: 139–164 [DOI] [PubMed] [Google Scholar]
  51. Song LX, Xu XC, Wang FN, Wang Y, Xia XJ, Shi K, Zhou YH, Zhou J, Yu JQ (2017) Brassinosteroids act as a positive regulator for resistance against root-knot nematode involving RESPIRATORY BURST OXIDASE HOMOLOG-dependent activation of MAPKs in tomato. Plant Cell Environ http://dx.doi.org/ [DOI] [PubMed] [Google Scholar]
  52. Stael S, Kmiecik P, Willems P, Van Der Kelen K, Coll NS, Teige M, Van Breusegem F (2015) Plant innate immunity--sunny side up? Trends Plant Sci 20: 3–11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Takahashi A, Casais C, Ichimura K, Shirasu K (2003) HSP90 interacts with RAR1 and SGT1 and is essential for RPS2-mediated disease resistance in Arabidopsis. Proc Natl Acad Sci USA 100: 11777–11782 [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Tameling WIL, Elzinga SDJ, Darmin PS, Vossen JH, Takken FLW, Haring MA, Cornelissen BJC (2002) The tomato R gene products I-2 and MI-1 are functional ATP binding proteins with ATPase activity. Plant Cell 14: 2929–2939 [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Teixeira MA, Wei L, Kaloshian I (2016) Root-knot nematodes induce pattern-triggered immunity in Arabidopsis thaliana roots. New Phytol 211: 276–287 [DOI] [PubMed] [Google Scholar]
  56. von Koskull-Döring P, Scharf KD, Nover L (2007) The diversity of plant heat stress transcription factors. Trends Plant Sci 12: 452–457 [DOI] [PubMed] [Google Scholar]
  57. Vos C, Schouteden N, van Tuinen D, Chatagnier O, Elsen A, De Waele D, Panis B, Gianinazzi-Pearson V (2013) Mycorrhiza-induced resistance against the root-knot nematode Meloidogyne incognita involves priming of defense gene responses in tomato. Soil Biol Biochem 60: 45–54 [Google Scholar]
  58. Wang Y, Cai S, Yin L, Shi K, Xia X, Zhou Y, Yu J, Zhou J (2015) Tomato HsfA1a plays a critical role in plant drought tolerance by activating ATG genes and inducing autophagy. Autophagy 11: 2033–2047 [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Wesemael WML, Viaene N, Moens M (2011) Root-knot nematodes (Meloidogyne spp.) in Europe. Nematology 13: 3–16 [Google Scholar]
  60. Willekens H, Chamnongpol S, Davey M, Schraudner M, Langebartels C, Van Montagu M, Inzé D, Van Camp W (1997) Catalase is a sink for H2O2 and is indispensable for stress defence in C3 plants. EMBO J 16: 4806–4816 [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Xia XJ, Zhou YH, Shi K, Zhou J, Foyer CH, Yu JQ (2015) Interplay between reactive oxygen species and hormones in the control of plant development and stress tolerance. J Exp Bot 66: 2839–2856 [DOI] [PubMed] [Google Scholar]
  62. Yi C, Yao K, Cai S, Li H, Zhou J, Xia X, Shi K, Yu J, Foyer CH, Zhou Y (2015) High atmospheric carbon dioxide-dependent alleviation of salt stress is linked to RESPIRATORY BURST OXIDASE 1 (RBOH1)-dependent H2O2 production in tomato (Solanum lycopersicum). J Exp Bot 66: 7391–7404 [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Yoshioka H, Numata N, Nakajima K, Katou S, Kawakita K, Rowland O, Jones JDG, Doke N (2003) Nicotiana benthamiana gp91phox homologs NbrbohA and NbrbohB participate in H2O2 accumulation and resistance to Phytophthora infestans. Plant Cell 15: 706–718 [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Zhou J, Jia F, Shao S, Zhang H, Li G, Xia X, Zhou Y, Yu J, Shi K (2015) Involvement of nitric oxide in the jasmonate-dependent basal defense against root-knot nematode in tomato plants. Front Plant Sci 6: 193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Zhou J, Wang J, Li X, Xia XJ, Zhou YH, Shi K, Chen Z, Yu JQ (2014a) H2O2 mediates the crosstalk of brassinosteroid and abscisic acid in tomato responses to heat and oxidative stresses. J Exp Bot 65: 4371–4383 [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Zhou J, Xia XJ, Zhou YH, Shi K, Chen Z, Yu JQ (2014b) RBOH1-dependent H2O2 production and subsequent activation of MPK1/2 play an important role in acclimation-induced cross-tolerance in tomato. J Exp Bot 65: 595–607 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Plant Physiology are provided here courtesy of Oxford University Press

RESOURCES