Dramatic Response to Crizotinib in a Patient With Lung Cancer Positive for an HLA-DRB1-MET Gene Fusion

INTRODUCTION

Non–small-cell lung cancer (NSCLC) is a disease in which tumor growth is commonly driven by alterations along the receptor tyrosine kinase–RAS-RAF–mitogen-activated protein kinase pathway. Consequently, activated kinases along this axis represent attractive therapeutic targets. Activation of kinases can occur via multiple mechanisms at the genetic level, including mutation, amplification, and rearrangement/fusion with other genes. The two best-characterized gene fusion classes in NSCLC are those that involve ALK and ROS1—accounting for approximately 5% and 2% of patients, respectively—and inhibition of these fusion proteins is now a standard of care.^1,2 Gene fusions that involve RET, NTRK1/2/3, BRAF, FGFR1/2/3, EGFR, and NRG1 have also been identified in lung cancer samples—an approximately 2% frequency for RET, < 1% for others—and strategies to target these aberrations are in development.^3-8

Crizotinib, the first US Food and Drug Administration–approved drug for patients with NSCLC who harbor ALK rearrangements and currently the only approved drug for patients with NSCLC who harbor ROS1 rearrangements was originally designed to be an inhibitor of the MET gene product hepatocyte growth factor receptor (HGFR) (c-Met).⁹ Activation of HGFR-mediated signaling—most commonly via MET amplification and/or MET mutations that result in exon 14 skipping—is well described in NSCLC, and crizotinib is currently being investigated in these settings.^10-12 Recently, gene fusions that involve MET have been described in various cancers, including NSCLC, and a pediatric patient with glioblastoma who harbored a MET fusion was reported to have achieved a partial response to crizotinib.^13-15 In this study, we report the first case of a MET fusion in lung cancer identified and treated during course of clinical care and the dramatic response of the patient’s tumor to crizotinib treatment.

CASE REPORT

A 74-year-old white female never smoker had a right lower lobe wedge resection for a stage I adenocarcinoma of the lung. Nine years later, she developed a new left upper lobe lung mass, presumed to be a distinct primary tumor. A left upper lobectomy and lymph node sampling confirmed stage II lung adenocarcinoma. The second tumor sample was negative for EGFR mutation and ALK rearrangement. The patient declined adjuvant chemotherapy.

Eighteen months after diagnosis, surveillance imaging with a fluorodeoxyglucose positron emission tomography/computed tomography (CT) scan demonstrated new lesions within the right and left lower lung lobe, as well as a pericardiac nodule and an enlarged precarinal lymph node. A core needle biopsy of one of the right lung lesions confirmed adenocarcinoma that was morphologically similar to the previous sampling. This sample was negative for ALK and ROS1 rearrangements. There was insufficient sample for additional molecular testing.

Treatment with carboplatin and pemetrexed was commenced for four cycles, followed by continuation maintenance pemetrexed with stable disease as best response. Chemotherapy was held as a result of fatigue. Surveillance CT scans showed slow growth of a dominant right lower lobe nodule and a right hemidiaphragm nodule over the next 4 months. At her second opinion appointment, tissue from the patient’s second lung resection was subjected to additional molecular analysis.

METHODS

Anchored Multiplex Polymerase Chain Reaction

Total nucleic acid was extracted from formalin-fixed, paraffin-embedded processed material from the resection sample by using the Agencourt FormaPure Kit (Beckman Coulter, Brea, CA). Total nucleic acid was then processed via the Archer FusionPlex Solid Tumor library preparation kit (ArcherDx, Boulder, CO). The resulting library was sequenced on an Illumina MiSeq instrument using v3 chemistry (Illumina, San Diego, CA). Raw sequence data were then analyzed by using the Archer Analysis software package (version 4.1.1.7; ArcherDx).

Reverse Transcriptase Polymerase Chain Reaction

Primers were designed toward exon 4 of HLA-DRB1 [GACCTTCCAGACCCTGGTGATG] and exon 15 of MET [GTCTGTCAGAGGATACTGCAC]. Reverse transcriptase polymerase chain reaction and Sanger sequencing were performed as previously described.¹⁶

Proximity Ligation Assay

Proximity ligation assay (PLA) was performed as previously described.¹⁷ Antibodies used were as follows: MET/HGFR (Cell Signaling Technology, Danvers, MA) and Gab1 (Abnova, Taipei, Taiwan, Republic of China).

RESULTS

The resection sample was analyzed by an anchored multiplex PCR (AMP)–based next-generation sequencing (NGS) assay. This RNA-based assay allows for fusion gene detection without a priori knowledge of the fusion partner.¹⁸ The assay detected a previously undescribed fusion of HLA-DRB1 exon 5 (NM_002124) to MET exon 15 (NM_000245), which was predicted to be in-frame and to preserve the MET kinase domain (Fig 1A). This finding was confirmed on a separate extraction and repeat analysis of the resection sample. Attempts to perform this assay on the initial resection sample were uninformative because of poor-quality RNA. Whereas the 5′ fusion partner is novel, previously described fusions to MET, including fusions to C8orf34, BAIAP2L1, TFG, and CLIP2, have also been reported to occur at exon 15.^13,14 A reverse transcriptase polymerase chain reaction assay, followed by Sanger sequencing of the product confirmed the existence of this fusion transcript (Fig 1A).

Fig 1.

(A) Schematic of the detected fusion with breakpoints between exons indicated (transcript fusion breakpoints map to the following genomic coordinates [hg19]: HLA-DRB1, chromosome 6: 32548024; MET, chromosome 7: 116414935; top). Black arrow indicates the binding site for the GSP2 primer used in the anchored multiplex polymerase chain reaction (AMP) assay. Example reads from the AMP assay that supports the fusion (middle). Sequence trace from reverse transcriptase polymerase chain reaction (RT-PCR) assay that supports the fusion (bottom). (B) Image of immunohistochemical staining using an antibody to HLA class II (DR). Green circle indicates an area of tumor cells; blue circle indicates an area of macrophages. Magnification ×40.

Expression of any fusion gene relies on the activity of the promoter of the 5′ partner. As the expression of HLA-DRB1—a gene involved in antigen presentation—would not intuitively be expected in a tumor of epithelial origin, immunohistochemistry using an antibody to HLA class II (DR) was performed. This analysis demonstrated robust staining in tumor cells (Fig 1B). Although this does not directly demonstrate activity of the HLA-DRB1 promoter—as other β-subunit genes can also form the heterodimer in this protein complex—it suggests the general expression of the gene class, which tends to be coordinately expressed. The observation of high HLA class II (DR) expression is in accordance with a previous study that demonstrated robust major histocompatibility class II expression specifically in lung adenocarcinoma.¹⁹

To demonstrate the activation of HGFR-mediated signaling in the sample, we performed a PLA.²⁰ PLA measures the formation of protein complexes, in this case, between HGFR and the adaptor GAB1, which occurs upon HGFR activation. This assay demonstrated HGFR-GAB1 complex formation at levels similar to samples that were positive for MET exon 14 skipping, which suggests that HGFR is activated (Fig 2).

Fig 2.

(A) MET-GAB1 proximity ligation assay (PLA) analysis of formalin-fixed, paraffin-embedded samples from the HLA-DRB1-MET patient, two different MET exon 14 (ex14) skipping–positive patients, and an ALK rearrangement–positive patient (negative control). Scale bar is 50 microns. (B) Quantification of PLA analysis displayed as the average number of dots per nucleus. Data are expressed as means ± SEM. The HLA-DRB1-MET sample displayed a significantly higher PLA score than did the ALK sample, as determined by analysis of variance followed by Bonferroni’s post hoc analysis. (*) P < .001.

Of importance, the sample was found to be negative for other known oncogenic drivers of lung cancer, including ALK and ROS1 fusions, as well as MET exon 14 skipping. Any of these three aberrations would be expected to confer sensitivity to crizotinib; however, if present in this sample, they would have been detected by the AMP-based assay. Lack of ROS1 rearrangement—and lack of RET rearrangement—was confirmed by fluorescent in situ hybridization. Lack of ALK rearrangement was confirmed by immunohistochemistry. MET amplification may also promote sensitivity to crizotinib; however, MET fluorescent in situ hybridization did not reveal an increase in MET copy number. An NGS-based mutational assay (Illumina TruSight Tumor 26) that covers commonly mutated regions in 26 genes, including EGFR, KRAS, and BRAF, revealed no nonsynonymous coding mutations.

The patient began treatment with off-label oral crizotinib 250 mg twice daily. After 6 weeks of therapy, repeat CT showed complete resolution of the previously observed left upper lobe perihilar and right lower lobe lung nodules with no new lesions (Fig 3). Moderate cardiomegaly, a small-to-moderate pericardial effusion, and small bilateral pleural effusions were unchanged compared with her pretreatment scan. The patient experienced grade 1 fatigue, grade 1 dysgeusia, grade 2 anorexia, grade 1 visual disturbance, grade 1 transaminitis, grade 1 creatinine increase, grade 1 hyponatremia, and grade 3 hypokalemia (grade 1 hypokalemia at baseline). She did not experience nausea, diarrhea, or skin rash. This robust response remains at 8 months on therapy.

Fig 3.

Contrast-enhanced computed tomography scans of the chest of the patient (A) before and (B) approximately 6 weeks and (C) 3 months after starting crizotinib 250 mg twice daily. Arrows highlight lung lesions before and after therapy. Shown are four of 14 lesions; the remaining 10 lesions had regressed by 6 weeks, with an ongoing response at 3 months.

DISCUSSION

In this study, we described the discovery of a novel fusion gene that involves MET in a tumor sample from a patient with NSCLC who was negative for other known oncogenic drivers, and, in particular, other known targets of crizotinib. The patient demonstrated a dramatic response to off-label treatment with crizotinib, a US Food and Drug Administration–approved small-molecule tyrosine kinase inhibitor with activity against HGFR. This finding suggests that the MET fusion gene product serves as an oncogenic driver in the patient’s tumor. Future studies are needed to determine the specific mechanism of action of this novel fusion gene, although overexpression of the MET kinase domain may be sufficient to activate HGFR-mediated signaling. It is also tempting to speculate that, as the fusion occurred to MET exon 15, the lack of the ubiquitination motif that is found in exon 14 results in impaired degradation—similar to the MET exon 14 skipping isoform.²¹

For clinical purposes, it is now imperative to know the driver oncogene status of patients with NSCLC. Until recently, it was sufficient to test a small number of genes to guide clinical decision making, and this could be achieved by using single-gene assays.²² However, the recent rapid expansion in the number of characterized driver oncogenes, the increase in the number of approved therapies, and the large number of clinical studies now available that are testing drugs that target these novel oncogenes necessitates the evaluation of multiple genes simultaneously. NGS-based assays are well suited to meet this requirement because of the ability to sequence in massively parallel fashion. In this study, we used AMP, an NGS-based assay designed specifically for gene fusion detection. The ability of this assay to detect fusions without prior knowledge of the fusion partner was critical in this case, as fusion of MET to HLA-DRB1 has not been reported previously.

In conclusion, we provide evidence that MET fusions may be another class of actionable alteration in NSCLC. As a result of the success in targeting other receptor tyrosine kinase fusions in this disease, MET fusion screening and HGFR inhibition in positive cases should be further clinically investigated.

AUTHOR CONTRIBUTIONS

Conception and design: Kurtis D. Davies, Terry L. Ng, D. Ross Camidge, Robert C. Doebele, Dara L. Aisner

Provision of study materials or patients: Terry L. Ng, Peter R. Ennever, D. Ross Camidge, Robert C. Doebele

Collection and assembly of data: All authors

Data analysis and interpretation: Kurtis D. Davies, Terry L. Ng, Adriana Estrada-Bernal, D. Ross Camidge, Robert C. Doebele, Dara L. Aisner

Manuscript writing: All authors

Final approval of manuscript: All authors

Accountable for all aspects of the work: All authors

AUTHORS' DISCLOSURES OF POTENTIAL CONFLICTS OF INTEREST

The following represents disclosure information provided by authors of this manuscript. All relationships are considered compensated. Relationships are self-held unless noted. I = Immediate Family Member, Inst = My Institution. Relationships may not relate to the subject matter of this manuscript. For more information about ASCO's conflict of interest policy, please refer to www.asco.org/rwc or po.ascopubs.org/site/ifc.

Kurtis D. Davies

No relationship to disclose

Terry L. Ng

Honoraria: ARIAD Pharmaceuticals, Takeda

Consulting or Advisory Role: Boehringer Ingelheim

Adriana Estrada-Bernal

No relationship to disclose

Anh T. Le

Patents, Royalties, Other Intellectual Property: Royalties from Abbott Molecular for a patent

Peter R. Ennever

No relationship to disclose

D. Ross Camidge

Honoraria: Roche, G1 Therapeutics, Mersana, Takeda

Research Funding: Takeda

Robert C. Doebele

Honoraria: Pfizer, AstraZeneca, ARIAD Pharmaceuticals, Guardant Health

Consulting or Advisory Role: Pfizer, OncoMed, Trovagene, Ignyta, Green Peptide, AstraZeneca

Research Funding: Mirati Therapeutics (Inst), Abbott Molecular, Loxo Oncology (Inst), Ignyta (Inst)

Patents, Royalties, Other Intellectual Property: Licensing fees from Abbott Molecular for Patent PCT/US2013/057495, licensing fees for biologic material from ARIAD Pharmaceuticals (Inst), licensing fees for biologic materials from GVKbio, licensing fees for biologic materials from Loxo Oncology (Inst)

Travel, Accommodations, Expenses: Ignyta, ARIAD Pharmaceuticals

Dara L. Aisner

Honoraria: AstraZeneca, Clovis Oncology

Consulting or Advisory Role: Inivata

Research Funding: Genentech (Inst)

Patents, Royalties, Other Intellectual Property: Patent pending for pneumatic cell collection device

Travel, Accommodations, Expenses: SeraCare