Controlled dimerization of insulin-like growth factor-1 and insulin receptors reveals shared and distinct activities of holo and hybrid receptors

Abstract

Breast cancer development and progression are influenced by insulin-like growth factor receptor 1 (IGF1R) and insulin receptor (InsR) signaling, which drive cancer phenotypes such as cell growth, proliferation, and migration. IGF1R and InsR form IGF1R/InsR hybrid receptors (HybRs) consisting of one molecule of IGF1R and one molecule of InsR. The specific signaling and functions of HybR are largely unknown, as HybR is activated by both IGF1 and insulin, and no cellular system expresses HybR in the absence of holo-IGF1R or holo-InsR. Here we studied the role of HybR by constructing inducible chimeric receptors and compared HybR signaling with that of holo-IGF1R and holo-InsR. We cloned chemically inducible chimeric IGF1R and InsR constructs consisting of the extracellular domains of the p75 nerve growth factor receptor fused to the intracellular β subunit of IGF1R or InsR and a dimerization domain. Dimerization with the drugs AP20187 or AP21967 allowed specific and independent activation of holo-IGF1R, holo-InsR, or HybR, resulting in activation of the PI3K pathway. Holo-IGF1R and HybR both promoted cell proliferation and glucose uptake, whereas holo-InsR only promoted glucose uptake, and only holo-IGF1R showed anti-apoptotic effects. We also found that the three receptors differentially regulated gene expression: holo-IGF1R and HybR up-regulated EGR3; holo-InsR specifically down-regulated JUN and BCL2L1; holo-InsR down-regulated but HybR up-regulated HK2; and HybR specifically up-regulated FHL2, ITGA6, and PCK2. Our findings suggest that, when expressed and activated in mammary epithelial cells, HybR acts in a manner similar to IGF1R and support further investigation of the role of HybR in breast cancer.

Introduction

Breast cancer is the most common cancer among women worldwide, excluding skin cancer, and it remains a significant cause of morbidity and mortality (1). The insulin-like growth factor (IGF)³/insulin system, consisting of three ligands (IGF-1, IGF-2, and insulin), six ligand-binding proteins (IGFBP1–6), and five receptors (insulin-like growth factor 1 receptor (IGF1R), insulin-like growth factor 2 receptor (IGF2R), insulin receptor A and B (InsR-A and InsR-B), and IGF-1/insulin hybrid receptor (HybR)) (2–4) play a crucial role in normal mammary gland development and physiology (5).

IGF1R and InsR are both tetrameric proteins composed of two extracellular α subunits covalently linked to two intracellular β subunits that contain the tyrosine kinase domains (6, 7). The binding of ligands to IGF1R and InsR leads to conformational changes in structure and transphosphorylation that trigger the activation of two main cascades: the phosphatidylinositol 3-kinase/AKT kinase (PI3K/AKT) pathway and the RAF kinase/mitogen activated protein kinase pathway (4). Although IGF1R and InsR share common downstream pathways, their biological roles are not completely identical. IGF1R mainly mediates proliferation, migration, transformation, and anti-apoptotic events, whereas InsR mainly controls the metabolism of glucose (8). Nevertheless, there is cross-talk between IGF1R and InsR. IGF-1 can also bind InsR, and insulin can bind IGF1R, but with a lower affinity compared with their own targeted receptors (9).

Here we focus on the role of three receptors: holo-IGF1R, holo-InsR, and HybR. HybRs consisting of one α/β subunit of IGF1R and one α/β subunit of InsR have been reported (10–12). Assays for determination of HybR activity have shown that it responds with much greater potency to IGF1 than insulin (13) and that it has a different binding affinity compared with holo-receptors (14). However, as most cells express a combination of IGF1R, InsR, and HybR, and few methods exist to specially examine activated HybR in living cells (15), attributing specific effects to HybR has been challenging. HybR content exceeds IGF1R content in more than 75% of breast cancer specimens (16).

To directly study the function of HybR, we used a method that has been used to demonstrate the function of ErbB1/ErbB2 heterodimers (17). We cloned chimeric holo-IGF1R, holo-InsR, and HybR, which have a low affinity for growth factors, and took advantage of a chemically induced system to activate them and compare their different biological roles in a breast cancer cell line. Although we understand that the chimeric system is artificial and highly engineered, it is a powerful tool to systematically isolate the signaling cascades of each receptor individually and provides novel insight into the potential biological effects of the holo and hybrid chimeric receptors. Additionally, although we cannot directly compare the signaling and biological effects of the chimeric receptors with the native receptors in this study because of factors such as differing potencies of the dimerizing agent and endogenous ligand(s), the inability of chimeric receptor to cross-talk with endogenous receptors or other receptor tyrosine kinase (RTK) family members, and altered molecular conformation of the chimeric receptor (further details are outlined under “Discussion”), we have included endogenous receptor action to observe whether the directional trend in response is similar.

Results

Cloning and expression of chimeric dimerizable holo-IGF1R, holo-InsR, and HybR

To construct chimeric IGF1R and InsR and allow for chemically induced dimerization, 4 parts were cloned into the pBabe retroviral vector: the extracellular domain of the low-affinity nerve growth factor receptor (p75), the β subunit of IGF1R or InsR, a binding site for a dimerizing agent (one FRB or two FKBP domains), and an epitope tag (HA or Glu-Glu) (Fig. 1A). The role of p75 is to replace the ligand-binding α subunit of IGF1R or InsR and prevent chimeric receptors from being activated by IGF-1 or insulin. p75 has a low affinity for nerve growth factor (which is not expressed by breast cancer cells) and, thus, has no ligand and/or activity. AP20187 was used to dimerize FKBP domains together to activate holo-IGF1R or holo-InsR, whereas AP21967 was used to dimerize an FRB and an FKBP domain to activate HybR (Fig. 1A). After transient transfection and viral infection, stable cell lines were generated, and immunoblotting was performed. As shown in Fig. 1B, compared with WT MCF7, holo-IGF1R-, holo-InsR-, and HybR-transfected cells expressed endogenous proteins, and chimeric receptors were also detected with a larger molecular weight (Fig. S1). All three transfected cell lines expressed HA tags as expected; however, different expression levels were noted, with holo-IGF1R expressing higher levels. For IGF1R, all cells expressed endogenous IGF1R, but chimeric IGF1R was only detected in the holo-IGF1R and HybR cells as expected. For InsR, endogenous levels were low but increased in the holo-InsR and HybR cells as expected. However, the chimeric holo-InsR had a slightly higher molecular weight. The detection of the Glu-Glu tag was challenging because of lack of sensitivity of the antibody; however, it was repeatedly detected in HybR cells. Of note, we observed a slight increases in native receptor expression with the addition of chimeric receptor expression, potentially because of changes in the stability of the native receptor; however, we did not test this in this study. In summary, we generated stable cells lines expressing vectors that allow chemical activation of holo-IGF1R, holo-InsR, and HybR. We attempted to obtain clones with equal expression of the respective components, but this was not possible.

Figure 1.

Gene modification of IGF1R and InsR used to create the chimeric expression system. A, chimeric IGF1R was cloned by linking p75, the β subunit of endogenous IGF1R, two FKBP domains, and one HA tag together. Chimeric InsR was cloned in two ways: by linking p75, the β subunit of endogenous InsR, two FKBP domains, and one HA tag or by linking p75, the β subunit of endogenous InsR, one FRB domain, and one Glu-Glu tag. Dimerization of chimeric holo-IGF1R and holo-InsR was induced by the homodimerizer AP20187, and HybR was induced by the heterodimerizer AP21967. B, immunoblot showing expression of chimeric receptors in MCF7 cells. Stable MCF7 cell lines were generated by viral infection, and immunoblotting was performed for anti-IGF1R, anti-HA, anti-InsR, anti-Glu-Glu, and anti-β-actin as a loading control (n = 3).

Cells were serum-starved to maintain a low level of activation of endogenous IGF1R, InsR, and HybR and then treated with increasing concentrations of dimerizing agent (0 to 2.5 μm), and activation of the PI3K and Erk1/2 pathways was detected by immunoblotting (Fig. 2, A–C, and Figs. S1 and S2). In all three cell model systems (holo-IGF1R (Fig. 2A), holo-InsR (Fig. 2B), and HybR (Fig. 2C)), as little as 10 nm of dimerizer resulted in an increase in p-Akt with a dose-response increase up to 2.5 μM. IGF1 and insulin were used as positive controls for signaling activation; however, insulin had only minor effects, reflecting the low levels of endogenous InsR in these cells. Phosphorylation of Erk1/2 was minimally increased by dimerizer compounds but was not as robust as Akt activation (Fig. 2, A–C, and Fig. S2). Additionally, we did a time course analysis (30 min to 8 h) in holo-IGF1R and HybR cells treated with 500 nm dimerizing agent (Fig. S3). As expected, the signaling (p-Akt and p-Erk1/2) declines over time; however, the holo-IGF1R signaling appears to be more potent and sustained than the HybR signaling. As a control, stimulating untransfected wildtype MCF7 with dimerizing agents did not have any effect on p-IGF1R or p-Akt levels (Fig. S4) and also did not alter cell proliferation (Fig. S5).

Figure 2.

Chemically induced dimerization of chimeric receptors activates Akt. A–C, holo-IGF1R (A), holo-InsR (B), and HybR MCF7 chimeric cells (C) were plated, serum-starved overnight, and treated with vehicle (EtOH) and increasing doses of AP20187 (A and B) or AP21967 (C). IGF-1 (100 ng/ml) and insulin (75 ng/ml) were used as positive controls. Immunoblot was performed to detect p-Akt and p-ERK pathways. Quantification was performed using ImageJ. All experiments were performed two to three times, with variable dosing per replicate experiment.

Activated chimeric holo-IGF1R does not transphosphorylate endogenous IGF1R, but activated endogenous IGF1R can transphosphorylate chimeric holo-IGF1R

To ensure that any results obtained with chimeric dimerizable receptors are due to specific activation of chimeric receptors and not any interference or cross-talk with endogenous receptors, we examined whether chimeric holo-IGF1R is able to cross-phosphorylate endogenous IGF1R and vice versa. We treated cells expressing holo-IGF1R with IGF-1 or dimerizer. We then used an antibody to the α subunit of IGF1R to specifically isolate endogenous IGF1R by immunoprecipitation because this domain is not expressed in the chimeric receptors. We observed that immunoprecipitated endogenous IGF1R was only phosphorylated by IGF-1 treatment and not by the dimerizing compound (Fig. 3A). Conversely, when we specifically immunoprecipitated the holo-IGF1R using the HA tag antibody, we found that both the dimerizer compound and IGF-1 induced phosphorylation of chimeric IGF1R (Fig. 3B). This indicates that endogenous IGF1R can cross-phosphorylate chimeric holo-IGF1R but that chimeric holo-IGF1R stimulated with AP20187 does not induce phosphorylation of endogenous IGF1R. Therefore, we postulate that any results we obtained using the dimerizer compound can be attributed directly to activation of the chimeric IGF1R without any interference with the endogenous IGF1R.

Figure 3.

Endogenous IGF1R transphosphorylates chimeric holo-IGF1R but not vice versa. Holo-IGF1R MCF7 cells were treated with vehicle (EtOH), AP20187 (5 μm), and IGF-1 (100 ng/ml). A, the anti-IGF1R α subunit antibody was used to immunoprecipitate (IP) endogenous IGF1R, and immunoblotting (IB) was performed for anti-pIGF1R and total IGF1R. B, anti-HA was used to immunoprecipitate chimeric IGF1R, and immunoblotting was performed for anti-pIGF1R and anti-HA.

Effect of holo-IGF1R, holo-InsR, and HybR on cellular phenotypes

Holo-IGF1R, but not holo-InsR, regulates cell proliferation

We investigated the role of holo-IGF1R, holo-InsR, and HybR in cell proliferation. Treatment with 100 nm homodimer AP20187 promoted holo-IGF1R-mediated proliferation (Fig. 4A), but proliferation was not affected by activation of holo-InsR (Fig. 4B). Interestingly, activation of HybR significantly promoted cell proliferation (Fig. 4C). As expected, as a positive control, 100 ng/ml IGF-1 (13.3 nm) or 75 ng/ml insulin (13.3 nm) both exhibited strong effects on cell proliferation. As a control, stimulation of WT MCF7 cells with dimerizer compounds had no effect on cell proliferation (Fig. S5).

Figure 4.

Holo-IGF1R and HybR but not holo-InsR induce cell proliferation. A–C, effects on cell proliferation following activation of holo-IGF1R (A), holo-InsR (B), or HybR (C). Growth curves were generated with the FluoReporter Blue Fluorometric dsDNA Quantification Kit, and relative fluorescent units (RFUs) were measured every 2 days. Error bars represent the mean ± S.D. (n = 6). *, p < 0.05; **, p < 0.005; ***, p < 0.001; ****, p < 0.0001. Two-tailed t test was used to compare the AP20187- or AP21967-treated group versus the EtOH-treated group on day 4 and day 6.

Holo-IGF1R and holo-InsR cause increased glucose uptake

As an indirect measure of glucose uptake, we collected medium and measured the decrease in concentration of glucose every 2 days. The amount of glucose reduction in medium was normalized to cell number (see “Experimental procedures”). Activation of both endogenous IGF1R and InsR reduced glucose in medium (Fig. S6). For the chimeric system, holo-IGF1R (Fig. 5A), holo-InsR (Fig. 5B), and HybR (Fig. 5C) all induced glucose uptake, but the uptake was greatest with holo-IGF1R, likely because of high expression of the chimeric receptor in this cell line. Similar to proliferation, dimerizer compounds did not affect glucose uptake in WT MCF7 cells, indicating that endogenous receptors are not activated by the dimerizer compound (Fig. S6).

Figure 5.

Holo-IGF1R, Holo-InsR, and HybR all increase glucose uptake. A–C, effects of glucose uptake following activation of holo-IGF1R (A), holo-InsR (B), or HybR (C). Cells were plated, serum-starved overnight, and treated with vehicle (EtOH), 100 nm drug (AP20187 or AP21967), 100 ng/ml IGF, or 75 ng/ml insulin. Medium was collected on day 0 and day 6, and glucose concentrations were measured with Accutrend® Plus and Roche Diagnostics glucose test strips. The amount of glucose uptake was calculated and normalized to cell number (RFUs were measured as described previously (Fig. 4)). Two-tailed t test was used for statistical analysis. Error bars represent the mean ± S.D. (n = 3). *, p < 0.05; **, p < 0.005; ***, p < 0.001.

Holo-IGF1R, but not holo-InsR or HybR, causes anti-apoptotic effects

Previous reports demonstrated that IGF1R protects cells from a variety of apoptotic injuries (18), mainly via the PI3K pathway. To examine this, we first induced apoptosis in MCF7 cells by treatment with 0.1 μm staurosporine (STS), which induced a 2.50-fold increase in apoptosis in holo-IGF1R, 1.40-fold in holo-InsR, and 1.53-fold in HybR (Fig. 6A). Next, we induced apoptosis with 0.1 μm STS and treated cells with ethanol, 100 nm dimerizer, 100 ng/ml IGF, or 75 ng/ml insulin and measured apoptosis. Although both IGF1 and insulin were able to inhibit apoptosis, only holo-IGF1R (not holo-InsR or HybR) was able to inhibit apoptosis (Fig. 6, B–D).

Figure 6.

Holo-IGF1R but not holo-InsR or HybR decrease cell apoptosis. A–D, effects on apoptosis following STS treatment alone in the chimeric cells (A) and following activation of holo-IGF1R (B), holo-InsR (C), or HybR (D). 10,000 cells were plated in 96 wells on day 0 in DMEM (10% fetal bovine serum), washed with PBS twice, and replaced with serum-free medium and 2× CellTox^TM Green dye on day 1. 0.1 μm STS and dimerizer drugs were added on day 2. Fluorescence (RFU) was measured immediately after adding drugs and 48 h later. One-way ANOVA (Dunnett: compare all columns versus the control column) was used for statistics analysis. Error bars represent the mean ± S.E. (n = 6). *, p < 0.05; **, p < 0.005; ***, p < 0.001; ****, p < 0.0001.

Holo-IGF1R, holo-InsR, and HybR show differential gene regulation

Because holo-IGF1R, holo-InsR, and HybR have different effects on proliferation, glucose uptake, and apoptosis, we investigated whether they exhibit unique gene regulation. We examined genes that were shown previously to be differentially regulated by IGF-1 (EGR3, FHL2, and ITGA6) (19) and insulin (JUN, BCL2L1, HK2, and PCK2). qRT-PCR was used to measure mRNA levels. Cells were treated with ethanol, 100 nm dimerizer (Fig. 7), 100 ng/ml IGF-1, or 75 ng/ml insulin (Fig. S7). EGR3 (Fig. 7A) was up-regulated by both holo-IGF1R (p = 0.019) and HybR (p = 0.026) but not holo-InsR. In contrast, JUN (Fig. 7B) and BCL2L1 (Fig. 7C) were specifically down-regulated by holo-InsR (p = 0.036 and p = 0.028) and not by holo-IGF1R or HybR. Interestingly, HK2 (Fig. 7D), which encodes the enzyme that catalyzes the first committed step of glycolysis, was down-regulated by holo-InsR (p = 0.041) but up-regulated by HybR (p = 0.015). FHL2 (Fig. 7E) and PCK2 (Fig. 7F) were induced by HybR (p = 0.048, p = 0.049, and p = 0.025) but not by holo-IGF1R or HybR. Therefore, holo-IGF1R, holo-InsR, and HybR show differential gene regulation.

Figure 7.

Differential gene regulation by chimeric receptors. A–F, differential gene regulation by activation of holo-IGF1R, holo-InsR, and HybR with 100 nm AP20187 or AP21967 for 5 h. mRNA levels of EGR3 (A), JUN (B), BCL2L1 (C), HK2 (D), FHL2 (E), and PCK2 (F) were measured by qRT-PCR and are represented as -fold change over vehicle control (normalized to RPL19 expression levels). Two-tailed t test was used for statistical analysis of the effect of treatment on chimeric receptors. Error bars represent mean ± S.E. (n = 3). *, p < 0.05. Two-way ANOVA was used for analyzing the interaction between receptors.

Discussion

To directly compare signaling by holo-IGF1R, holo-InsR, and HybR, we used a chemically inducible system to activate holo-IGF1R, holo-InsR, and HybR individually and specifically in the absence of endogenous receptor activation. This method has been used in similar studies to study homodimer versus heterodimer effects of ErbB1/ErbB2 (17, 20) and fibroblast growth factor receptor 1 and 2 (21, 22). We found that holo-IGF1R activated the PI3K pathway, induced proliferation, promoted glucose uptake, and reduced apoptosis. Holo-InsR promoted glucose uptake but did not affect proliferation or apoptosis. HybR had effects that were more similar to holo-IGF1R than holo-InsR by inducing proliferation and promoting glucose uptake. However, HybR did not block apoptosis. Analysis of gene expression showed genes that were differentially regulated by holo-IGF1R, InsR, and HybR.

Important to our study, we showed that the chimeric receptors act independently of the endogenous receptor, with dimerizer compounds having no effect on control cells that do not express chimeric receptors and activation of chimeric IGF1R not affecting activation of endogenous IGF1R. Interestingly, however, we found that endogenous IGF1R transphosphorylated chimeric IGF1R. Although this does not affect the validity or interpretation of any of our results (as we focus solely on the specific effects of the dimerizer compounds), it will be interesting to determine how endogenous IGF1R confers this transphosphorylation, as this may have broader implications. For example, this may explain why activation of endogenous IGF1R is able to transphosphorylate the single-chain ErbB1 and 2, whereas activation of ErbB1/2 is incapable of transphosphorylating endogenous IGF1R.

To study the mechanism underlying the biological differences between holo-IGF1R, holo-InsR, and HybR, we examined how these receptors affected gene expression. Because there was no previous research about genes specifically activated or repressed by HybR, we started with genes that were previously shown to exhibit regulation by IGF1 or insulin (19). We found genes that were specifically increased by holo-IGF1R and HybR (EGR3) and specifically repressed by holo-InsR (JUN, BCL21, and HK2). HybR specifically induced HK2, FHL2, and PCK2. These results indicate that, although these three receptors share common pathways, their downstream targets are not completely similar.

We noted in most experiments that the endogenous system of ligands and receptors appeared to activate signaling and downstream phenotypes greater than the chimeric system. There are several potential explanations for this result. First, the chimeric nature of the receptors puts them in a molecular conformation that is distinct from endogenous receptors. This new conformation may inhibit interaction with potential substrate molecules such as IRS1 and 2, which bind close to the transmembrane domain, or other proteins that simply require the heterotetrameric conformation. Future studies will address this by assessing the ability of activated chimeric receptors to induce phosphorylation of IRS1 and 2. Second, the difference in signaling might be an inability of chimeric receptors to cross-talk with other endogenous receptors, as discussed above. Thus, endogenous IGF1R may cross-phosphorylate ErbB1/2, and the chimeric receptor may not be able to do this. Third, the potency of endogenous IGF-1 and insulin ligand may be greater than the dimerizer agent in the ability to activate the target receptors. Despite these pitfalls, it is important to note that we only compare the results between different chimeric receptors (holo-InsR, holo-IGF1R, and HybR), thus eliminating any confounding results between the endogenous and chimeric receptors.

When making the stably transfected MCF-7 cell lines, we attempted to isolate cells with similar expression of chimeric receptor. It is evident, though, that the holo-InsR is expressed at a much lower expression level than the holo-IGF1R. We estimate that holo-IGF1R expression is approximately double that of holo-InsR expression. However, it seems that even when generally correcting for expression level, holo-IGF1R is a more potent inducer (more than 2×) of proliferation, glucose uptake, and survival compared with holo-InsR and that the two receptors have distinct gene expression profiles in the panel we tested. In summary, based on the data, we do not think that the reduction in chimeric InsR expression compared with chimeric IGF1R would change the overall result(s) of this study.

A weakness of our study is that we could not differentiate between InsR A and B isoforms, as the intracellular β subunit we cloned is downstream of the skipped exon of InsR A. A previous study indicated differences between HybR-A and -B (14), and, therefore, further studies are required to study this difference using the chimeric receptor system.

In conclusion, the data presented here show similarities and differences between holo-IGF1R, holo-InsR, and HybR. The similarity between HybR and holo-IGF1R is consistent with previous studies (16). Given the overexpression of HybR in breast cancer cell lines and tumors, strategies to inhibit IGF1 and insulin action in cancer need to consider blocking this form of the receptor.

Experimental procedures

DNA constructs

To create chemically inducible receptors, we used a system based on rapamycin-induced dimerization of FK506-binding protein 12 with the FKBP rapamycin-binding (FRB) domain of mammalian target of rapamycin and small peptide tags for identification, consisting of HA and Glu-Glu (17). Three chimeric receptor expression vectors were constructed as follows: pBabe puro (p75-FRB-Glu-Glu), pBabe G418 (p75-IGF1R-FKBP-FKBP-HA), and pBabe G418 (p75-InsR-FKBP-FKBP-HA). Chimeric InsR with the Glu-Glu tag was constructed by inserting the β-subunit InsR into pBabe puro (p75-FRB-Glu-Glu). InsR was amplified by primers 5′ AATTACTAGTAGAAAGAGGCAGCCA 3′ and 5′ AATTACTAGTGGAAGGATTGGACC 3′ from pcDNA3.1-InsR and engineered to have SpeI sites on both ends. Then it was cloned into the pCR^TM4-TOPO® vector. After digestion with SpeI enzyme, InsR with cohesive ends was separated and purified by gel extraction. InsR was cloned into pBabe puro (p75-FRB-Glu-Glu) by ligation. Chimeric InsR with the HA tag was constructed by replacing p75-FRB-Glu-Glu with p75-InsR-FKBP-FKBP-HA. p75-InsR-FKBP-FKBP-HA was amplified by primers 5′ TAATAGGATCCGGGGCCATGG 3′ and 5′ CTCGAGGATCCTCACTTTTCT 3′, purified by gel extraction, digested with BamHI, and ligated to the pBabe puro backbone, which was also digested with BamHI and purified. SpeI and BamHI were bought from New England Biolabs Inc. The MinElute Gel Extraction Kit (Qiagen, 28604) was used for gel extraction.

Cell culture and generating stable cell lines

PT67 retro-packaging cells were cultured in DMEM (Life Technologies, 11965-118) supplemented with 10% fetal bovine serum and 1 mm sodium pyruvate (HyClone, SH30239.01). MCF7 breast cancer cells were cultured in DMEM supplemented with 10% fetal bovine serum. On day 0, 1.3 × 10⁶ PT67 cells were seeded in 60-mm dishes. On day 1, cells were transfected with chimeric receptor plasmids using Lipofectamine LTX (Life Technologies, 15338100) according to the instructions of the manufacturer. On day 2, 1.3 × 10⁶ MCF7 cells were plated in 60-mm dishes. On day 3, the retrovirus-containing supernatants were harvested, centrifuged briefly (500 × g for 10 min) to remove debris, filtered through a 0.45-μm syringe filter (Fisher, 09-754–21), and added to MCF7 cells. On day 5, the cells were separated into 10-cm dishes with serial dilutions (1:5, 1:10, and 1:20) and 1 mg/ml Geneticin (Invitrogen, 10131-035) or 2 μg/ml puromycin (Life Technologies, A11138-03) added as selection drugs. After ∼2 weeks, single colonies were isolated and expanded.

Immunoblotting

Cells were lysed in buffer containing 5% SDS, 1× EDTA (5 mm), and 1× protease and phosphatase inhibitor mixture (Thermo Scientific, 78442). Protein concentration was measured with the Pierce BCA Protein Assay Kit (Thermo Scientific, 23225). 30 μg of protein was separated by 8% SDS-PAGE. PageRuler Plus Prestained Protein Ladder (Thermo Scientific, 26619) was used as a marker. After SDS-PAGE, proteins were transferred onto a polyvinylidene difluoride membrane (Fisher, IPVH00010), blocked with Odyssey blocking buffer (Li-Cor, 927-40000) for 1 h, and blotted with primary antibodies overnight. This was followed by washing with PBST (phosphate-buffered saline + 0.1% Tween 20) three times for half an hour and blotting with secondary antibodies for 1 h. Then the membranes were washed with PBST three times for half an hour and PBS twice for 20 min. Proteins were detected with the Odyssey infrared imaging system (version 3.0). Antibodies for immunoblots were as follows: anti-HA (1:1000, Cell Signaling Technology, 3724), anti-IGF1R (1:1000, Cell Signaling Technology, 9750S), anti-InsR (1:1000, Cell Signaling Technology, 3025S), anti-pAkt (1:1000, Cell Signaling Technology, 9271S), anti-Akt (1:1000, Cell Signaling Technology, 9272), anti-pERK (1:1000, Cell Signaling Technology, 9101S), anti-ERK (1:1000, Cell Signaling Technology, 4695), anti-pIGF1R/InsR (1:1000, Cell Signaling Technology, 3021S), anti-β-actin (1:5000, Sigma, A5441), anti-mouse IRDye 680LT (Odyssey, 1:8000, 827-11080), anti-mouse IRDye 800CW (1:8000, Odyssey, 827-08364), and anti-rabbit IRDye 800CW (1:8000, Odyssey, 827-08365).

Serum starvation and chemically induced dimerization

Chimeric MCF-7 cells were plated in normal growth media on day 0, washed twice with PBS on day 1, and placed in serum-free media (minimum Eagle's medium (Invitrogen, A10488-01) with 1 μg/ml fibronectin (Sigma, F4759) and 1 μg/ml transferrin). AP20187 (Clontech, 635060) was used to induce dimerization of holo-IGF1R and holo-InsR, whereas AP21967 (Clontech, 635057) was used to induce dimerization of HybR. 0.02% ethanol was used as a vehicle control. 100 ng/ml IGF-1 (Gropep, CU100) and 75 ng/ml insulin (Sigma, I2643) were used to activate endogenous receptors. After the treatment time point (30 min to 8 h), cells were washed with PBS and harvested for immunoblots, immunoprecipitation, or qRT-PCR.

Immunoprecipitation

Holo-IGF1R MCF7 cells were cultured in full serum medium to about 80% confluence in three 10-cm plates, and dimerization was induced as described previously. Cell lysates in each plate were extracted with 0.8 ml of lysis buffer (25 mm Tris-HCl (pH 8), 140 mm NaCl, 0.4% Nonidet P-40, 0.5 μg/ml leupeptin, 0.5 μg/ml aprotinin, and 2 mm activated sodium orthovanadate). 30 μl of normal mouse IgG (Santa Cruz Biotechnology, sc-2025) was added to 0.6 mg of protein lysates. After incubation on ice for 1 h, 60 μl of protein G–agarose beads (Invitrogen, 10-1243) was added, agitated for 0.5 h at 4 °C, and centrifuged at 14,000 rpm at 4 °C for 10 min, and the supernatant harvested. To the supernatant we added 3 μl anti-IGF1Rα (Abcam, 80548) and agitated overnight at 4 °C. The next day, 70 μl of protein G–agarose beads was added and agitated for 3 h. The supernatant was centrifuged at 12,000 rcf for 3 min and then discarded, the pellet was washed four times with cell lysis buffer at 3000 rcf for 1 min, and then the proteins were denatured in sample buffer for SDS/PAGE and analyzed by immunoblotting.

Proliferation and glucose metabolism assays

5000 MCF7 cells/100 μl/well were plated in four 96-well plates with six replicates. After serum starvation and drug-induced dimerization as described previously, one plate was harvested every other day. Medium was collected for glucose measurements. The proliferation assay was performed with the FluoReporter® Blue Fluorometric dsDNA Quantitation Kit (Molecular Probes, F-2962). Glucose concentration was measured with Accutrend® Plus and Roche Diagnostics glucose test strips (Fisher Scientific, 22-045-871).

CellTox^TM Green cytotoxicity assay

10,000 MCF7 cells/100 μl/well were plated in 96-well plates with six replicates on day 0. Serum starvation was performed as described previously on day 1, with 2× CellTox^TM Green dye (Promega, G8752). 0.2 μm staurosporine was diluted in serum-free medium and 100 μl was added to the medium, 200 nm dimerizer, 200 ng/ml IGF-1, or 150 ng/ml insulin into each well. RFUs were measured immediately and 48 h thereafter.

qRT-PCR

Total RNA was isolated from treated MCF7 cells using RNAspin Mini (Illustra, 25-0500-72) in a 6-well plate. iScript^TM Reverse Transcription Supermix (Bio-Rad, 170-8841) was used for reverse transcription. SsoAdvanced^TM Universal SYBR® Green Supermix (Bio-Rad, 172-5274) was used for quantitative PCR, and Bio-Rad CFX Manager 3.1 was used for analyzing data. Gene expression was normalized to the housekeeper RPL19 and plotted as -fold change for each treatment over vehicle. Primers were as follows: JUN (5′ AGCCCAAACTAACCTCACG 3′ and 5 TGCTCTGTTTCAGGATCTTGG 3′), EGR3 (5′ TCGGTAGTCCATTACAATCAGATG 3′ and 5′ CTTTCCCAAGTAGGTCACGG 3′), RPL19 (5′ ATGCCAGAGAAGGTCACATG 3′ and 5′ ACACATTCCCCTTCACCTTC 3′), HK2 (5′ GGGACAATGGATGCCTAGATG 3′ and 5′ GTTACGGACAATCTCACCCAG 3′), BCL2L1 (5′ GACATCCCAGCTCCACATC 3′ and 5′ GTTCCCATAGAGTTCCACAAAAG 3′), PCK2 (5′ GAGAATACTGCCACACTGACC 3′ and 5′ CCGCTGAGAAGGAGTTACAATC 3′), and FHL2 (5′ ACTTTGCCTACTGCCTGAAC 3′ and 5′ AGTCGTTATGCCACTGCC 3′).

Statistical analysis

Proliferation and glucose metabolism assay results are presented as mean ± S.D., and statistical analyses were performed by t test, comparing drug-treated group with the EtOH-treated group on day 4 and day 6. For the CellTox^TM Green cytotoxicity assay, the results are presented as mean ± S.E., with n representing the number of replicates in each group, and statistical analyses were performed with one-way ANOVA (Dunnett: compare all columns versus the control column). The qPCR results are presented as mean ± S.E., and statistical analyses were performed with two-tailed t test for the effect of treatment on chimeric receptors. Two-way ANOVA was used for analyzing the interaction between receptors. p < 0.05 was required for statistical significance.

Author contributions

J. C., A. M. N., Y.-F. W., D. N. B., and A. V. L. provided substantial contributions to conception and design. J. C. and A. M. N. acquired data. J. C., A. M. N., Y.-F. W., D. N. B., and A. V. L. analyzed and interpreted data. J. C., A. M. N., Y.-F. W., D. N. B., and A. V. L. drafted the article and/or revised it critically for important intellectual content, gave final approval of the version to be published, and agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.