Skip to main content
BioMed Research International logoLink to BioMed Research International
. 2018 Feb 26;2018:8607647. doi: 10.1155/2018/8607647

Molecular Characterization of Antimicrobial Resistance in Escherichia coli from Rabbit Farms in Tai'an, China

Xiaonan Zhao 1, Jie Yang 1, Zijing Ju 1, Weishan Chang 1,, Shuhong Sun 1,
PMCID: PMC5846384  PMID: 29682565

Abstract

To investigate the prevalence and resistance against antimicrobials of Escherichia coli (E. coli) in Tai'an, March 2016, a total of 55 E. coli strains were isolated from 60 faecal samples of diarrheic rabbits collected from three rabbit farms in Tai'an. The E. coli isolates were assayed for antimicrobial susceptibility and prevalence of resistance genes and Class I integrons and genotyped using Multilocus Sequence Typing (MLST). All the E. coli isolates were sensitive to ceftazidime, ceftriaxone, imipenem, and amikacin, while 78.2% of the isolates showed resistance against tetracycline, and 65.5% were resistant against ampicillin. The most common resistance gene detected was blaTEM, present in 98.2% of isolates, followed by blaCTX-M (94.6%) and sul2 (58.2%). Class I integrons were detected in 17 out of the 55 (30.9%) E. coli strains. Seven kinds of gene cassette were detected: dfrA17 + aadA5, dfrA1 + catB3 + aacA4, aadA2 + LinF, dfrA1 + aadA1, aadA22, dfrA12 + orfF + addA2, and aadA16 + dfrA27 + arr-3. All the 55 E. coli strains were identified and classified as 13 sequence types (STs); ST302 (22/55, 40.0%) was the most prevalent type, followed by ST370 (12/55, 21.8%). This study showed that E. coli isolated from diarrheic farmed rabbits in the Tai'an area exhibit sometimes very frequent resistance to antimicrobials important to human medicine, which further highlights the need for reasonable use of antibiotics.

1. Introduction

Antimicrobials, which play a crucial part in animal and human health care, are commonly used to treat bacterial infections and to prevent further spread of the infections within animal groups [1, 2]. E. coli are commensal bacteria colonizing the intestinal tract of rabbits and other warm-blooded animal species [3]. They may frequently be exposed to selection pressure caused by antimicrobial treatments and may contribute considerably to the emergence of antimicrobial resistant bacteria and the spread of antimicrobial resistance [4]. Furthermore, antimicrobial resistant bacteria can be transferred to the humans through the food chain, thus affecting human health.

There are many kinds of molecular mechanisms underlying antimicrobial resistance in bacteria. The mechanisms mediated by integrons are an example of the most studied ones. Integrons, one kind of genetic element, are able to capture exogenous genes and disseminate them through plasmids or transposons in both interspecific and intraspecific ways [5].

Genotyping methods of bacteria have been important in surveillance and analysis, and they enable determination of sources of outbreaks. MLST is based on DNA sequencing data, which makes it specific, repeatable, comparable, and suitable for detecting the evolution of the strains and genetic analysis of microbial populations [6, 7].

Most previous studies were focused on the prevalence of antimicrobial resistance of E. coli in the main food animal species such as chicken and pigs, but there is a lack of research on antimicrobial resistance in rabbits. Therefore, in this study, we collected faecal samples from rabbit farms in the Tai'an area and isolated E. coli strains and then analyzed their drug resistance characteristics and the genotypes, in order to provide information to determine reasonable use of antibiotics.

2. Materials and Methods

2.1. Description of Sampling Sites

From February to May 2016, 60 faecal samples (20 samples per farm) were randomly collected from diarrhea rabbits on farms in Ningyang, Xintai, and Dongping regions in Tai'an, China. The samples were independently collected from individual animals and the farms were chosen based on their scale (the breeding stock was >1500 heads). According to current statistics, there are about 15 relatively large rabbit farms in Tai'an, and each farm presumably produces >4000 heads annually. Because the sampling process did not harm the animals, ethical approval was not required for the study.

2.2. Samples and E. coli Isolation

Isolation and identification of E. coli were performed as described previously [8], with some modifications. Briefly, about 0.5 g faecal samples were added to a tube containing 5 mL of LB (Luria-Bertani) medium and cultured at 37°C for 12 h. The bacteria solution was then streaked onto eosin-methylene blue agar (EMB; Hope, Qingdao, China) plates. After incubation at 37°C for 18~24 h, typical colonies on the plate were streaked on MacConkey's agar (MAC; Hope, Qingdao, China) plates. Positive colonies were chosen for further biochemical identification using the API 20E system (Sysmex bioMérieux, Tokyo, Japan).

2.3. Antimicrobial Susceptibility Testing

Antimicrobial susceptibility was tested by the Minimal Inhibition Concentration (MIC) method. Bacteria were cultured at 37°C in the LB broth medium for 6 h. The concentration of E. coli was adjusted to 1.5 × 108 colony forming unit (CFU)/mL in sterile saline. The susceptibility of the E. coli isolates was tested to 14 commonly used antimicrobial agents, including ciprofloxacin (CIP), chloramphenicol (C), nalidixic acid (NA), amoxicillin/clavulanic acid (AML), tobramycin (TB), ceftazidime (CAZ), ceftriaxone (CRO), gentamicin (GEN), sulfamethoxazole/trimethoprim (SXT), imipenem (IMP), tetracycline (TET), ampicillin (AMP), cefoxitin (FOX), and amikacin (AMK). The results were interpreted based on the Clinical and Laboratory Standards Institute (CLSI) standard guidelines [9]. In this study, the E. coli strain ATCC25922 was used as the quality control strain. E. coli isolates that were resistant to more than three classes of antimicrobials were defined as multidrug-resistant (MDR) isolates.

2.4. Detection of Resistance Genes

The E. coli DNA was extracted using Bacterial Genomic DNA Extraction Kit (Tiangen, Beijing, China) and then the resistance genes associated with beta-lactams (blaTEM, blaSHV, blaOXA, blaPSE, and blaCTX-M), the quinolone-resistance genes (qnrA, qnrB, qnrS, aac(6)-Ib-cr, and qepA), the aminoglycosides-resistance genes (aac(3)-I, aac(3)-II, aac(3)-III, aac(3)-IV, ant(2), and aac(6)-Ib), the tetracycline-resistance genes (tetA and tetB), the sulfonamides-resistance genes (sul1, sul2, and sul3), and the chloramphenicol-resistance genes (cmlA and flor) were amplified by PCR, using the previously reported [1012] primers and conditions, and the gene sequences were listed in Table 1. In addition, the PCR procedure was repeated twice for all the isolates, and PCR products were analyzed by 1.5% agarose gel electrophoresis at 100 V for 1 h. Photos were taken with a gel imaging system (Tanon-2500, Shanghai, China).

Table 1.

Primers for PCR in this study.

Primer name Sequence (5′→ 3′) Reference
bla TEM F: ATTCTTGAAGACGAAAGGGC [10]
R: ACGCTCAGTGGAACGAAAAC
bla SHV F: CACTCAAGGATGTATTGTG [10]
R: TTAGCGTTGCCAGTGCTCG
bla OXA F: ACACAATACATATCAACTTCGC [10]
R: AGTGTGTTTAGAATGGTGATC
bla PSE F: TTT GGT TCCGCG CTA TCT G [10]
R: TAC TCC GAG CAC CAA ATC CG
bla CTX-M F: CGCTTTGCGATGTGCAG [11]
R: ACCGCGATATCGTTGGT
qnrA F: ATTTCTCACGCCAGGATTTG [12]
R: TGCCAGGCACAGATCTTGAC
qnrB F: CGACCTKAGCGGCACTGAAT [12]
R: GAGCAACGAYGCCTGGTAGYTG
qnrS F: ATGGAAACCTACAATCATAC [12]
R: AAAAACACCTCGACTTAAGT
acc(6′)-Ib-cr F: TTGCGATGCTCTATGAGTGGCTA [12]
R: CTCGAATGCCTGGCGTGTTT
qepA F: GCAGGTCCAGCAGCGGGTAG [12]
R: CTTCCTGCCCGAGTATCGTG
aac(3)-I F: ACCTACTCCCAACATCAGCC [10]
R: ATATAGATCTCACTACGCGC
aac(3)-II F: ACTGTGATGGGATACGCGTC [10]
R: CTCCGTCAGCGTTTCAGCTA
aac(3)-III F: CACAAGAACGTGGTCCGCTA [10]
R: AACAGGTAAGCATCCGCATC
aac(3)-IV F: CTTCAGGATGGCAAGTTGGT [10]
R: TCATCTCGTTCTCCGCTCAT
ant(2) F: ATGTTACGCAGCAGGGCAGTCG [10]
R: CGTCAGATCAATATCATCGTGC
acc(6′)-Ib F: TTGCGATGCTCTATGAGTGGCTA [10]
R: CTCGAATGCCTGGCGTGTTT
tetA F: GCGCCTTTCCTTTGGGTTCT [10]
R: CCACCCGTTCCACGTTGTTA
tetB F: CATTAATAGGCGCATCGCTG [10]
R: TGAAGGTCATCGATAGCAGG
sul1 F: TGGTGACGGTGTTCGGCATTC [10]
R: GCGAGGGTTTCCGAGAAGGTG
sul2 F: CGGCATCGTCAACATAACC [10]
R: GTGTGCGGATGAAGTCAG
sul3 F: CATTCTAGAAAACAGTCGTAGTTCG [10]
R: CATCTGCAGCTAACCTAGGGCTTTGGA
cmlA F: TGTCATTTACGGCATACTCG [10]
R: ATCAGGCATCCCATTCCCAT
flor F: CTGAGGGTGTCGTCATCTAC [10]
R: GCTCCGACAATGCTGACTAT

2.5. Detection of Integrons

The universal primers for the amplification of Class I integron gene cassette genes were detected by PCR. The primers of cassette FP and cassette RP were designed according to reference: 5′-TCATGGCTTGTTATGACTGT-3′ and 5′-GTAGGGCTTATTATGCACGC-3′. The amplification consisted of an initial denaturation at 94°C for 5 min, 30 cycles of denaturation at 94°C for 60 s, annealing at 56°C for 55 s, and extension at 68°C for 6 min. A final extension for 10 min at 72°C was also applied. PCR products were purified and sequenced for the further analysis [13].

2.6. MLST

According to http://bigsdb.pasteur.fr/ecoli/primers_used.html, 8 pairs of primers for housekeeping genes (dinB, icdA, pabB, polB, putP, trpA, trpB, and uidA) were designed and then used for PCR. The products of PCR amplification were sequenced by Shanghai Sangon Biotech Co., Ltd. and the results were amended using the Chromas and DNA Star software and then submitted to the Pasteur online database (http://bigsdb.pasteur.fr/perl/bigsdb/bigsdb.pl?db=pubmlst_ecoli_seqdef_public&page=sequenceQuery) for processing. Then the allele number of each housekeeping gene was obtained and the sequence type (ST type) of each strain was acquired.

3. Results

3.1. Isolation of E. coli

A total of 55 E. coli strains were isolated from 60 samples: 18 strains were from Ningyang, 20 strains were from Xintai, and 17 strains were from Dongping (Table 3).

Table 3.

Resistance phenotype, ST, incidence of Class I integrons, and resistance gens in E. coli isolated from rabbit farms.

Number Location ST Resistance phenotype Integrons/resistance
(1) Ningyang ST302 AMP-NA-TET bla CTX-M, blaTEM, sul2
(2) Ningyang ST302 AMP-TET bla CTX-M, blaTEM, sul2
(3) Ningyang ST302 AMP-NA-TET Class 1 (dfrA17 + aadA5), blaCTX-M, blaTEM, sul2
(4) Ningyang ST302 AMP-TET bla CTX-M, blaTEM, sul2
(5) Ningyang ST468 AMP-C-NA-SXT-TET Class 1 (dfrA17 + aadA5), blaCTX-M, blaTEM, flor
(6) Ningyang ST302 AMP-CIP-NA-SXT-TET bla CTX-M, blaTEM, sul2
(7) Ningyang ST468 AMP-C-NA-SXT-TET Class 1 (dfrA17 + aadA5), blaCTX-M, blaTEM, sul2
(8) Ningyang ST302 AMP-TET bla CTX-M, blaTEM, sul2
(9) Ningyang ST302 AMP-TET bla CTX-M, blaTEM, sul2
(10) Ningyang ST468 AMP-CIP-NA-SXT-TET bla CTX-M, blaTEM, sul2
(11) Ningyang ST302 AMP-TET Class 1 (dfrA1 + aadA1), blaCTX-M, blaTEM, sul2
(12) Ningyang ST370 bla CTX-M, blaTEM
(13) Ningyang ST370 bla CTX-M, blaTEM, sul1
(14) Ningyang ST302 AMP-TET bla CTX-M, blaTEM, sul1, sul2
(15) Ningyang ST370 bla CTX-M, blaTEM
(16) Ningyang ST302 AMP-NA-TET bla CTX-M, blaTEM, sul1, sul2
(17) Ningyang ST302 AMP-TET bla CTX-M, blaTEM, sul2
(18) Ningyang ST370 bla CTX-M, blaTEM
(19) Xintai ST370 SXT bla CTX-M, blaTEM, sul1
(20) Xintai ST87 GEN-SXT Class 1 (dfrA17 + aadA5), blaCTX-M, blaTEM, qnrS, sul1
(21) Xintai ST302 AMP-GEN-SXT-TET bla CTX-M, blaTEM, sul2
(22) Xintai ST302 AMP-NA-TET bla CTX-M, blaTEM, sul2
(23) Xintai ST370 bla CTX-M, blaTEM
(24) Xintai ST302 bla CTX-M, blaTEM, sul1
(25) Xintai ST314 NA-TET Class 1 (dfrA1 + catB3 + aacA4), blaCTX-M, blaTEM, sul1, sul2
(26) Xintai ST302 AMP-C-NA-SXT-TET bla CTX-M, blaTEM, flor, sul2
(27) Xintai ST302 AMP-FOX-NA-TET bla CTX-M, blaTEM, sul2
(28) Xintai ST302 TET bla CTX-M, blaTEM, sul2
(29) Xintai ST302 AMP-NA-SXT Class 1 (aadA16 + dfrA27 + arr-3), acc(6′)-Ib-cr, blaCTX-M, blaTEM, sul2
(30) Xintai ST636 bla CTX-M, blaTEM, sul1
(31) Xintai ST370 AMP-NA-TET bla CTX-M, blaTEM, sul2
(32) Xintai ST468 AMP-NA-TET bla CTX-M, blaTEM, sul2
(33) Xintai ST468 AMP-C-NA-SXT Class 1 (dfrA1 + catB3 + aacA4), blaCTX-M, blaTEM, flor
(34) Xintai ST302 AMP-NA-TET bla CTX-M, blaTEM, sul2
(35) Xintai ST302 AMP-NA-TET bla CTX-M, blaTEM, sul2
(36) Xintai ST302 AMP-NA-TET bla CTX-M, blaTEM, sul2
(37) Xintai ST302 AMP -TET Class 1 (dfrA1 + catB3 + aacA4), blaCTX-M, blaTEM, sul2
(38) Xintai ST370 NA-TET Class 1 (dfrA1 + catB3 + aacA4), blaCTX-M, blaTEM, sul1
(39) Dongping ST461 AMP-NA-SXT bla TEM, qnrS, sul1
(40) Dongping ST731 TET bla TEM
(41) Dongping ST739 AMP-NA-TET acc(6′)-Ib-cr, blaCTX-M, blaTEM
(42) Dongping ST370 TET bla CTX-M, blaTEM
(43) Dongping ST739 AMP-CIP- NA-SXT-TET acc(6′)-Ib-cr, blaCTX-M, blaTEM
(44) Dongping ST370 TET bla CTX-M, blaTEM
(45) Dongping ST88 AML-AMP-C-CIP-GEN- NA-SXT-TET Class 1 (aadA2 + LinF), blaCTX-M, blaTEM, cmlA, flor, sul2, sul3, tetB
(46) Dongping ST370 TET bla CTX-M, blaTEM, sul1
(47) Dongping ST739 AMP-CIP-NA-SXT-TET acc(6′)-Ib-cr, blaCTX-M, blaTEM
(48) Dongping ST88 AMP-C-CIP-GEN-NA-SXT-TET bla CTX-M, blaTEM, cmlA, flor, sul2, sul3, tetB
(49) Dongping ST2 AMP-C-CIP-NA-SXT-TET bla CTX-M, blaTEM, cmlA, flor, sul3
(50) Dongping ST88 AMP-C-CIP-GEN-NA-SXT-TET Class 1 (aadA2 + LinF), blaCTX-M, blaTEM, cmlA, flor, sul2, sul3, tetB
(51) Dongping ST353 C-TET Class 1 (aadA22), blaTEM, flor, qnrS, sul2
(52) Dongping ST370 NA-TET Class 1 (dfrA12 + orfF + addA2), blaCTX-M, sul1
(53) Dongping ST88 C-CIP-NA-TET Class 1 (aadA2 + LinF), blaCTX-M, blaTEM, flor, sul2, sul3, tetB
(54) Dongping ST24 AML-AMP-TET Class 1 (aadA22), blaCTX-M, blaTEM, flor, sul1
(55) Dongping ST88 AMP-C-CIP-GEN-NA-SXT-TB-TET Class 1 (aadA2 + LinF), blaCTX-M, blaTEM, cmlA, flor, sul2, sul3, tetB

3.2. Antimicrobial Susceptibility Test

From Table 2, all the strains were sensitive to ceftazidime, ceftriaxone, imipenem, and amikacin. The highest resistance rate was shown against tetracycline (46/55, 78.2%) and ampicillin (36/55, 65.5%). The two most common antimicrobial resistance profiles of the isolates were AMP-NA-TET (n = 10, 18.1%) and AMP-TET (n = 8, 14.5%). In addition, 6 strains were sensitive to all the 14 kinds of antibiotics, while there were 50.9% (28/55) multidrug-resistant strains (Table 3).

Table 2.

Susceptibility of E. coli to 14 commonly used antibiotics (S: susceptible; I: intermediate; R: resistant).

Antibiotics Disk diffusion [n (%)]
S I R
AML 53 (96.4%) 0 2 (3.6%)
AMK 55 (100%) 0 0
AMP 15 (27.3%) 4 (7.3%) 36 (65.5%)
C 41 (74.5%) 3 (5.5%) 11 (20.0%)
CAZ 0 0 0
CIP 43 (78.2%) 2 (3.6%) 10 (18.2%)
CRO 0 0 0
FOX 54 (98.2%) 0 1 (1.8%)
GEN 46 (83.6%) 3 (5.5%) 6 (10.9%)
IMP 0 0 0
NA 10 (18.2%) 15 (27.3%) 30 (54.5%)
SXT 35 (63.6%) 2 (3.6%) 18 (32.7%)
TB 46 (83.6%) 8 (14.5%) 1 (1.8%)
TET 8 (14.5%) 4 (7.3%) 43 (78.2%)

3.3. Detection of Resistance Genes

Two kinds of β-lactamase genes, blaTEM and blaCTX-M, were the most frequently detected genes at 98.2% and 94.5% respectively, followed by sul2, a kind of sulfa drug-resistant gene, with the detection rate of 58.18%. 5 (9.1%) strains had tetB, a tetracycline-resistance gene. 3 strains (5.5%) had shown resistance to qnrS and 4 strains (7.5%) to aac(6)-Ib-cr, which were quinolone-resistance genes (Table 3).

3.4. Detection of Integrons

Class I integrons were detected in 17 E. coli isolates out of 55 strains, as the detection rate was 30.9%. Seven kinds of drug-resistance gene cassette were found in those Class I integrons as follows: dfrA17 + aadA5, dfrA1 + catB3 + aacA4, aadA2 + LinF, dfrA1 + aadA1, aadA22, dfrA12 + orfF + addA2, and aadA16 + dfrA27 + arr-3. The most prevalent gene cassettes were dfrA1 + catB3 + aacA4 and aadA2 + LinF (Table 3).

3.5. MLST

13 different kinds of STs were identified among all the 55 strains, including 3 STs (ST302, ST468, and ST370) from samples derived from Ningyang, 6 STs (ST87, ST302, ST314, ST370, ST468, and ST636) from samples derived from Xintai, and 8 STs (ST2, ST24, ST88, ST353, ST370, ST461, ST731, and ST739) from samples derived from Dongping. It was shown that ST302 (22/55, 40.0%) was the most prevalent type, followed by ST370 (12/55, 21.8%) (Table 3).

4. Discussion

Colibacillosis of rabbits, a common disease in rabbits breeding, had become one of the major infectious diseases that endanger the rabbit breeding industry [14, 15]. In this study, the highest resistance rates of 55 E. coli strains were against tetracycline and ampicillin (78.2% and 65.5%, resp.), higher than those reported from wild rabbits in Portugal, in which the tetracycline and ampicillin resistance rates were both 11.4% [16]. This coincided with the fact that tetracycline and ampicillin have been widely used to control and prevent rabbit disease in the Tai'an area. In this study, all the strains were sensitive to ceftazidime, ceftriaxone, imipenem, and amikacin; this may be due to the less frequent use of these antibiotics in rabbit farms. The occurrence of MDR strains is a potential threat to the public health. Our data showed that the proportion of MDR strains among all the E. coli strains was 50.9%, which was lower than that observed from wild rabbits (71.4%) [16], which may be due to the fact that wild rabbits and hares are commonly found in areas inhabited by human beings and livestock and consequently may share common sources of exposure to antibiotics.

bla TEM, one kind of β-lactamase genes, is the most common mechanism of ampicillin resistance in E. coli, and it was previously shown in ampicillin-resistant E. coli isolates from foods, humans, and healthy animals in Spain [17]. In this study, 98.2% of E. coli isolates carried blaTEM, whereas only 61.8% were resistant to ampicillin; this may be associated with the expression status of blaTEM genes and is needed to be further studied. Extended-spectrum cephalosporins are critically important antibiotics in human medicine [18], which are also used to treat food-producing animals. The acquirement of extended-spectrum cephalosporins resistance was mainly mediated by extended-spectrum β-lactamases in E. coli, while the predominant ones were the CTX-M [19]. In this study, 94.5% of E. coli isolates carried blaCTX-M, whereas no strains were resistant to cephalosporins; the reason may be that the resistance genes had not yet led to the resistance phenotype. Phenotype could be controlled and verified with the MIC methods. In addition, the quinolone-resistance genes, qnrS (5.5%) and aac(6)-Ib-cr (7.5%), were much less frequent than the report in Sichuan, where aac(6)-Ib-cr (80.4%) and qnrS (59.8%) were observed [20]; the difference may be the result of the less frequent use of fluoroquinolone in the Tai'an area, while the detection of the quinolone-resistance genes in this study may come from other sources, such as the contaminated water and food. It has been reported that tetA and tetB are associated with tetracycline resistance from human and animal sources [21], but our results differed in that tetracycline-resistant E. coli in our rabbit were not all carrying tetA or tetB; this may be related to regional differences and different breeding conditions. With regard to chloramphenicol-resistant strains, most of them were carrying flor genes; however, cmlA genes were not very common among chloramphenicol-resistant strains, which was different from other reports, where the flor and cmlA genes occurred with the same percentage [10]; this difference may be the result of the fact that only partial genes were expressed. The sul1 and/or sul2 and/or sul3 genes were detected in all of the sulfamethoxazole/trimethoprim-resistant E. coli isolates obtained from rabbits.

In this study, Class I integrons were detected in 17 E. coli isolates out of 55 strains (30.91%), which was similar to the percentage (31.5%) of a previous study conducted by Hai et al. [22] but is lower than that of a previous study observed by Dotto et al. (2014) who detected 61.1% of E. coli strains isolated from domestic and wild Lagomorphs in northern Italy between 2006 and 2008 carrying Class I integrons [23]. Of note, Class I integrons are often associated with MDR E. coli isolates, consistent with the result of the present study.

In this study, the highest isolation rate of 40% (22/55) was found for ST302 which had not yet been reported related to infections. It was different from that of previous studies which found that ST40 is the most common ST from rabbits in Italy [23].

5. Conclusions

Our findings exhibit the molecular characterization of antimicrobial resistance in Escherichia coli from rabbit farms in Tai'an, China. The rabbits in farms are contaminated with MDR E. coli, which may originate from farms further up the food chain or from horizontal contamination. The high detection rates of MDR E. coli, Class I integrons, and antibiotic-resistance genes suggested that measures should be taken to reduce the harm to public health, such as the reasonable use of antimicrobials in animal husbandry and culling the reservoirs of pathogens from the slaughter process.

Acknowledgments

This work was supported by the National Key R&D Project of China (2017YFD0500105 and 2016YFD0501608), Taishan Scholars Program (201511023), and Funds of Shandong “Double Tops” Program.

Contributor Information

Weishan Chang, Email: changweishan@yeah.net.

Shuhong Sun, Email: jqybfkyjs@163.com.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

Authors' Contributions

Xiaonan Zhao and Jie Yang have contributed equally to this work.

References

  • 1.Ben Said L., Jouini A., Klibi N., et al. Detection of extended-spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae in vegetables, soil and water of the farm environment in Tunisia. International Journal of Food Microbiology. 2015;203:86–92. doi: 10.1016/j.ijfoodmicro.2015.02.023. [DOI] [PubMed] [Google Scholar]
  • 2.Reuland E. A., Naiemi N., Raadsen S. A., et al. Prevalence of ESBL-producing Enterobacteriaceae in raw vegetables. European Journal Clinical Microbiology & Infections Diseases. 2014;33:1843–1846. doi: 10.1007/s10096-014-2142-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Van den Bogaard A. E., Stobberingh E. E. Epidemiology of resistance to antibiotics: links between animals and humans. International Journal of Antimicrobial Agents. 2000;14(4):327–335. doi: 10.1016/S0924-8579(00)00145-X. [DOI] [PubMed] [Google Scholar]
  • 4.Guardabassi L., Schwarz S., Lloyd D. H. Pet animals as reservoirs of antimicrobial-resistant bacteria. Journal of Antimicrobial Chemotherapy. 2004;54(2):321–332. doi: 10.1093/jac/dkh332. [DOI] [PubMed] [Google Scholar]
  • 5.Wright G. D. Antibiotic resistance in the environment: a link to the clinic? Current Opinion in Microbiology. 2010;13(5):589–594. doi: 10.1016/j.mib.2010.08.005. [DOI] [PubMed] [Google Scholar]
  • 6.Kitchel B., Rasheed J. K., Patel J. B., et al. Molecular epidemiology of KPC-producing Klebsiella pneumoniae isolates in the United States: clonal expansion of multilocus sequence type 258. Antimicrobial Agents and Chemotherapy. 2009;53(8):3365–3370. doi: 10.1128/AAC.00126-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Salerno A., Delétoile A., Lefevre M., et al. Recombining population structure of Plesiomonas shigelloides (Enterobacteriaceae) revealed by multilocus sequence typing. Journal of Bacteriology. 2007;189(21):7808–7818. doi: 10.1128/JB.00796-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Gao L., Hu J., Zhang X., et al. Application of swine manure on agricultural fields contributes to extended- spectrum ß-lactamase producing Escherichia coli spread in Tai'an, China. Frontiers in Microbiology. 2015;6:p. 313. doi: 10.3389/fmicb.2015.00313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.CLSI. Wayne, PA, USA: Clinical and Laboratory Standards Institute; 2013. Performance standards for antimicrobial susceptibility testing: twentieth-third informational supplement M100-S23. [Google Scholar]
  • 10.Navajas-Benito E. V., Alonso C. A., Sanz S., et al. Molecular characterization of antibiotic resistance in Escherichia coli strains from a dairy cattle farm and its surroundings. Journal of the Science of Food and Agriculture. 2017;97(1):362–365. doi: 10.1002/jsfa.7709. [DOI] [PubMed] [Google Scholar]
  • 11.Valat C., Forest K., Billet M., et al. Absence of co-localization between pathovar-associated virulence factors and extended-spectrum β-lactamase (blaCTX-M) genes on a single plasmid. Veterinary Microbiology. 2016;192:163–166. doi: 10.1016/j.vetmic.2016.07.011. [DOI] [PubMed] [Google Scholar]
  • 12.Moawad A. A., Hotzel H., Omnia A., et al. Occurrence of Salmonella enterica and Escherichia coli in raw chicken and beef meat in northern Egypt and dissemination of their antibiotic resistance markers. Gut Pathogens. 2017;9(1):57. doi: 10.1186/s13099-017-0206-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.White P. A., McIver C. J., Deng Y.-M., Rawlinson W. D. Characterisation of two new gene cassettes, aadA5 and dfrA17. FEMS Microbiology Letters. 2000;182(2):265–269. doi: 10.1016/S0378-1097(99)00600-X. [DOI] [PubMed] [Google Scholar]
  • 14.Agnoletti F. Sharm El-Sheikh, Egypt: Proc. 10th World Rabbit Congr; 2012. Update on rabbit enteric diseases: despit improved diagnostic capacity, where does disease control and prevention stand? pp. 1113–1127. [Google Scholar]
  • 15.Boullier S., Milon A. Rabbit colibacillosis. In: Maertens L., Coudert P., editors. Recent advances in rabbit sciences , ILVO. Melle: Belgium; 2006. pp. 171–179. [Google Scholar]
  • 16.Silva N., Igrejas G., Figueiredo N., et al. Molecular characterization of antimicrobial resistance in enterococci and Escherichia coli isolates from European wild rabbit (Oryctolagus cuniculus) Science of the Total Environment. 2010;408(20):4871–4876. doi: 10.1016/j.scitotenv.2010.06.046. [DOI] [PubMed] [Google Scholar]
  • 17.Briñas L., Zarazaga M., Sáenz Y., Ruiz-Larrea F., Torres C. β-Lactamases in ampicillin-resistant Escherichia coli isolates from foods, humans, and healthy animals. Antimicrobial Agents and Chemotherapy. 2002;46(10):3156–3163. doi: 10.1128/aac.46.10.3156-3163.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.WHO. Critically Important Antimicrobials for Human Medicine. Geneva, Switzerland: World Health Organization; 2011. [Google Scholar]
  • 19.Naseer U., Sundsfjord A. The CTX-M conundrum: dissemination of plasmids and Escherichia coli clones. Microbial Drug Resistance. 2011;17(1):83–97. doi: 10.1089/mdr.2010.0132. [DOI] [PubMed] [Google Scholar]
  • 20.Qing F. K., Yi G., Ze H. Y., et al. Detection of quinolone resistance and plasmid mediated quinolone gene in Escherichia coli isolated from rabbit. Chinese Journal of Preventive Veterinary Medicine. 2006;38:944–948. [Google Scholar]
  • 21.Bryan A., Shapir N., Sadowsky M. J. Frequency and distribution of tetracycline resistance genes in genetically diverse, nonselected, and nonclinical escherichia coli strains isolated from diverse human and animal sources. Applied and Environmental Microbiology. 2004;70(4):2503–2507. doi: 10.1128/AEM.70.4.2503-2507.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Hai S. W., Qi R. P., Gao Y. M., et al. Study on molecular characterization of Class I integron and integron-associated antimicrobial resistance in Escherichia coli from beef cattle. China Animal Husbandry Veterinary Medicine. 2014;41:63–67. [Google Scholar]
  • 23.Dotto G., Giacomelli M., Grilli G., et al. High prevalence of oqxAB in escherichia coli isolates from domestic and wild lagomorphs in Italy. Microbial Drug Resistance. 2014;20(2):118–123. doi: 10.1089/mdr.2013.0141. [DOI] [PubMed] [Google Scholar]

Articles from BioMed Research International are provided here courtesy of Wiley

RESOURCES