Skip to main content
NCBI home page
Journal of Medical Entomology logoLink to Journal of Medical Entomology
. 2017 Mar 7;54(4):1013–1018. doi: 10.1093/jme/tjx043

piRNA-3312: A Putative Role for Pyrethroid Resistance in Culex pipiens pallens (Diptera: Culicidae)

Juxin Guo 1, Wenyun Ye 1, Xianmiao Liu 1, Xueli Sun 1, Qin Guo 1, Yun Huang 1, Lei Ma 1, Yan Sun 1, Bo Shen 1, Dan Zhou 1, Changliang Zhu 1,1
PMCID: PMC5850355  PMID: 28399266

Abstract

Piwi-interacting RNAs (piRNAs) are a newly identified class of small noncoding RNAs. They are associated with chromatin organization, messenger RNA stability, and genome structure. Although the overexpression of piRNA-3312 in deltamethrin-susceptible (DS) strain of Culex pipiens pallens (L.) was observed in our previous large-scale transcriptome data, the roles of piRNA in insecticide resistance have not been clearly defined. The aim of the present study was to investigate how piRNA-3312 is involved in insecticide resistance. The lower expression level of piRNA-3312 in deltamethrin-resistant (DR) strain of Cx. pipiens pallens was confirmed by quantitative real time polymerase chain reaction (qRT-PCR). Overexpression of piRNA-3312 in the DR strain made the mosquitoes more sensitive to deltamethrin, whereas inhibiting the expression of piRNA-3312 in the DS strain made the mosquitoes more resistant to deltamethrin. Piwi-interacting RNA-3312 was also found to bind 3ʹ UTR (Untranslated Regions) of gut esterase 1 gene and could induce its degradation. In addition, knockdown of gut esterase 1 gene increased the sensitivity of DR strain to deltamethrin. In conclusion, we found that piRNA-3312 targeted the gut esterase 1 gene to negatively regulate the insecticide resistance. This finding facilitates the understanding of various functions of piRNAs and their association with insecticide resistance.

Keywords: Culex pipiens pallens, Piwi-interacting RNA, pyrethroid resistance, esterase

Mosquitoes are insects of huge medical importance, as they can cause a large number of severe diseases such as malaria, dengue fever, Japanese encephalitis, West Nile fever, Chikungunya, and lymphatic filariasis (Andriessen et al. 2015, Fortuna et al. 2015, Paradkar et al. 2015). Mosquito-borne diseases have led to enormous environmental, economic, and social loss. As there are still no commercially available vaccines or specific treatments for these diseases, vector control remains the most important means of reducing the spread of mosquito-borne diseases. Conventional vector control measures rely primarily on chemical insecticides, as they are simple, rapid, and economical (Abilio et al. 2015, Scott et al. 2015). Unfortunately, the widespread and improper use of insecticides results in the evolution of insecticide resistance, which makes vector control approach more challenging (Shi et al. 2015).

Insecticide resistance arises from complex polygenic inheritance and several mechanisms are involved. Target resistance is caused by mutations in the voltage-gated sodium channel target sites (Soderlund and Knipple 2003). Another recognized mechanism occurs via increases in either expression or the activity of detoxification enzymes, also called metabolic resistance (Lumjuan et al. 2011, Wu et al. 2011). Three large detoxification enzyme families, the cytochrome P450s, Glutathione S-transferases, and carboxy/cholinesterases have been implicated in metabolic resistance. In addition, microRNA (miRNA) has been shown to display regulation in insecticide resistance (Lei et al. 2015, Liu et al. 2016). Unfortunately, there is limited knowledge about the molecular mechanism of insecticide resistance formation and progression.

Piwi-interacting RNA (piRNA) is a type of small RNA with a typical length of 24–32 nucleotides, which appears to function primarily in the regulation of transposons in both the germ line and somatic tissues (Hale et al. 2014, Yan et al. 2015). Recently, emerging evidences showed that transposons are not the only genomic targets of piRNAs. In Aedes aegypti (L.), the majority of piRNAs appear to be targeted to protein coding genes rather than the transposons (Arensburger et al. 2011). Piwi-interacting RNA also can regulate the expression of target messenger RNA (mRNA) in a way similar to miRNAs (Peng et al. 2016).

According to our previous study, many differently expressed miRNAs and piRNAs in deltamethrin-resistant (DR) strain and deltamethrin-susceptible (DS) strain of Culex pipiens pallens (L.) were identified using high throughput Solexa sequencing (Hong et al. 2014). Although several above miRNAs have been experimentally proved to be relevant with pyrethroid resistance (Hong et al. 2014, Liu et al. 2016), whether piRNAs are involved in insecticide resistance in mosquitoes is largely unknown. Among these differentially expressed piRNAs, piRNA-3312 (5ʹ TCCTTGG CTGCACTCTGGCATTTAACTGG 3ʹ) is downregulated in the DR strain (Hong et al. 2014). This paper was designed to investigate the relationship between piRNA-3312 and deltamethrin resistance.

In this experiment, the expression level of piRNA-3312 from DS and DR Cx. pipiens pallens was confirmed by quantitative real time polymerase chain reaction (qRT-PCR). Next, we up- and down regulated the expression of piRNA-3312 to verify its contribution to pyrethroid resistance. Besides, we identified the target of piRNA-3312, gut esterase 1, and investigated its potential role in pyrethroid resistance.

Materials and Methods

Mosquito Strains

Two laboratory strains of Cx. pipiens pallens were used in this study. The larvae and pupae of DS strain were picked up from Tangkou County of Shandong Province in 2009 and then transported to the insectary of Nanjing Medical University, for more than 7 yr without exposure to any insecticides. The DR strain was selected from DS strain of early fourth-stage larvae with pyrethroid insecticide deltamethrin. Selection has been performed for >65 generations. The 50% larval lethal concentrations (LC50) of DS and DR strains were 0.04 and 7.30 mg/l, respectively. Mosquitoes were reared at 28 °C and 70–80% relative humidity, with a constant photoperiod of 14:10 (L:D) h.

RNA Isolation and cDNA Synthesis

Total RNA from female mosquitoes was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA) following the manufacturer’s protocol. The integrity of total RNA was analyzed using denaturing agarose gel electrophoresis. The purity and concentration of RNA was verified using the NanoDrop spectrophotometer. The cDNAs for piRNA and mRNAs were reverse transcribed using the miScript II RT Kit (Qiagen, Dusseldorf, Germany) and PrimeScript RT Reagent Kit (TAKARA, Tokyo, Japan), according to the manufacturer’s protocol, respectively.

qRT-PCR Analysis

The expression levels of piRNA-3312 were performed using the miScript SYBR Green PCR Kit (Qiagen, Dusseldorf, Germany). The amplification condition was 95 °C for 15 min, followed by 40 amplification cycles of 94 °C for 15 s, 55 °C for 30 s, and 70 °C for 34 s. U6 small nuclear (U6) was used to calculate relative expression level of piRNA-3312 as an internal control. The expression of gut esterase 1 gene was performed using the Light Cycler FastStart DNA Master SYBR Green I (Applied Biosystems, Forster City, CA). The amplification condition was as follows: 50 °C for 2 min, 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s, and 60 °C for 1 min. The relative expression level of mRNAs was normalized to β-actin expression. After each PCR reaction, the melting curves were analyzed to ensure the desired amplification products. The relative expression levels were calculated using the 2-ΔΔCt method. According to the Bulge-loop miRNA qRT-PCR method (Fulci et al. 2007), the forward primer of piRNA-3312 was designed based on the sequence and the reverse primer was the universal primer, as mentioned in the previous article (Liu et al. 2016). The forward and reverse primers of gut esterase 1 gene were designed based on its cDNA sequence of Cx. pipiens pallens (NCBI accession number: KY402272). The primers of the internal controls (U6 and β-actin) were obtained from our previously published work (Liu et al. 2016). The primer sequences used in this study and lengths of PCR products are listed in Supp. Table 1 (online only). The qRT-PCR analysis was performed in triplicate on an ABI Prism 7300 HT system (Applied Biosystems, Forster City, CA).

Luciferase Assay

The region of gut esterase 1 3ʹ UTR was a 142-bp-long fragment sequence covering the potential piRNA-3312 binding site (GCCAAGG). The region of gut esterase 1 3ʹ MUT included the same sequence, but with four changed bases (CCGATGC). Polymerase chain reaction was performed using the following conditions: initial denaturation for 5 min at 94 °C, followed by 35 cycles of 94 °C for 30 s, 56 °C for 30 s, and 72 °C for 30 s, and a final extension at 72 °C for 7 min. The primers designed to amplify gut esterase 1 3ʹ UTR and 3ʹ MUT were list in Supp. Table 1 (online only). The PCR products were verified by sequencing in Invitrogen (Shanghai, China). The 3ʹ UTR and 3ʹ MUT of gut esterase 1 gene were then cloned into the pMIR-REPORT miRNA Expression Reporter Vector (Applied Biosystems, Forster City, CA) using Sac I and Hind III restriction sites (TAKARA, Tokyo, Japan). The 293T cells were seeded at a density of 1×105 cells per well in 24-well plates and were cultured for 24 h to 80% confluence. Subsequently, the cells were transfected with 100 ng recombinant plasmids, 50 ng pGL4.74 plasmids (control reporter), and 600 ng piRNA-3312 mimic or 600 ng negative control per well. Luciferase activity was assayed 24 h after the transfection using the Dual-Luciferase Assay System (Promega, WI, USA), according to the manufacturer’s protocols.

Microinjection and CDC Bottle Bioassay

Before microinjection, piRNA-3312 mimic/inhibitor, dsRNA of gut esterase 1 gene and negative control were designed and purchased from GePharma (GenePharma, Shanghai, China). The details of the above sequences are listed in Supp. Table 2 (online only). About 0.31 μg piRNA-3312 mimic or 0.30 μg dsRNA of gut esterase 1 were injected into the thorax of 1-d-old DR female mosquitoes, respectively. Piwi-interacting RNA-3312 inhibitor (0.31 μg) was injected into the thorax of 1-d-old DS female mosquitoes. The equivalent volume of both DEPC water and negative control served as control. After 3 d, the transcript abundance was examined by qRT-PCR.

The resistance of microinjected mosquitoes to insecticides was detected by the CDC bottle bioassay (http://www.cdc.gov/malaria). Deltamethrin was first dissolved in acetone (10 mg/ml), and then diluted to the final concentration of 7 mg/ml for DR strain and 2 μg/ml for DS strain. In each bottle, 20 female mosquitoes were exposed to deltamethrin, and a bottle coated with acetone only was used as control. Every 15 min, the numbers of dead female mosquitoes were recorded, until to 2 h. The experiment was repeated three times.

Statistical Analysis

All experiments were carried out for three replicates, and the results were means of three experiments. Data are presented as mean ± SEM. Data were analyzed using Student’s t-test or chi-square test, with a P value < 0.05 considered significant.

Results

Differentially Expressed piRNA-3312 in DS and DR Strains

To confirm previous transcriptome data, qRT-PCR was used to detect the expression level of piRNA-3312 in DS and DR strains of Cx. pipiens pallens. Piwi-interacting RNA-3312 showed relatively higher expression (2.7-fold) in the DS strains compared with the DR strain (Fig. 1). This data indicated that the expression of piRNA-3312 might be inversely associated with deltamethrin resistance.

Fig. 1.

Fig. 1

Open in a new tab

Expression levels of piRNA-3312 in laboratory DS strain and DR strain of Cx. pipiens pallens. Data are presented as mean ± standard error (SE) of three independent experiments. *P < 0.05.

Regulation of piRNA-3312 in the Deltamethrin Resistance

To validate the potential biological function of piRNA-3312 in the deltamethrin resistance, the mimic was injected to elevate the expression of piRNA-3312 in DR strain. The relative expression of piRNA-3312 was 37-fold higher compared with the control (Fig. 2a). The results of CDC bottle bioassay showed that compared with the control, the mortality rates were significantly higher after injecting piRNA-3312 mimic at 105 and 120 min (Fig. 2b). Furthermore, we inhibited piRNA-3312 in DS strains by microinjecting its inhibitor. The qRT-PCR results showed that piRNA-3312 was knockdown about 42% compared with the other groups (Fig. 2c). In contrast, the results presented in Fig. 2d showed that the DS strain injected with inhibitor were more resistant than the other groups at 60, 75, 90, 105, and 120 min. These results demonstrated that piRNA-3312 could modulate deltamethrin resistance of mosquitoes by changing its expression level.

Fig. 2.

Fig. 2

Open in a new tab

Piwi-interacting RNAs-3312 modulates deltamethrin resistance of mosquito. (a) Expression levels of piRNA-3312 postinjecting piRNA-3312 mimic. (b) Morality of mimic-microinjected mosquitoes observed after 2-h exposure to deltamethrin in CDC bottles. (c) Expression levels of piRNA-3312 postinjecting piRNA-3312 inhibitor. (d) Morality of inhibitor-microinjected mosquitoes observed after 2-h exposure to deltamethrin in CDC bottles. *P < 0.05, **P < 0.01, ***P < 0.001.

Identification of gut esterase 1 Gene as Potential Target of piRNA-3312

The function of piRNA-3312 in insecticide resistance may have to do with its ability to regulate target gene expression. To explore the putative molecular targets of piRNA-3312 in deltamethrin resistance, we screened the sequences of 3ʹ UTR of known mRNAs. A potential binding site was found to be located in the 3′ UTR of gut esterase 1 mRNA (Fig. 3a). According to the prediction results, we first tested the effects of piRNA-3312 on gut esterase 1 expression in vivo. As expected, the piRNA-3312 mimic decreased the expression levels of gut esterase 1 (Fig. 3b), whereas piRNA-3312 inhibitor resulted in significant increase of gut esterase 1 (Fig. 3c). Next, we sought to determine whether piRNA-3312 directly interact with gut esterase 1, the luciferase assay was performed. The luciferase assay showed that piRNA-3312 greatly inhibited the activity of the constructs with the wild-type 3′ UTR sequences of gut esterase 1 by ∼30%, but not the mutant constructs (Fig. 3d). Collectively, these findings confirmed that piRNA-3312 could interfere with expression of gut esterase 1 by directly binding to the 3′UTRs.

Fig. 3.

Fig. 3

Open in a new tab

The gut esterase 1 gene is the target of piRNA-3312. (a) The binding sites of piRNA-3312 within gut esterase 1 mRNA 3ʹ UTR was shown. (b) Expression levels of gut esterase 1 postinjecting piRNA-3312 mimic. (c) Expression levels of gut esterase 1 postinjecting piRNA-3312 inhibitor. (d) The luciferase activity. **P < 0.01.

Gut esterase 1 Plays a Role in the Deltamethrin Resistance of Mosquitoes

The gut esterase 1 gene had a higher expression level, with 1.9-fold higher in the laboratory DR strain (Fig. 4a). To test the function of gut esterase 1 gene in mosquitoes, dsRNA of gut esterase 1 gene was injected into DR female mosquitoes. Quantitative real time polymerase chain reaction showed that the knockdown efficiency of gut esterase 1 gene was 46.8% compared with NC (negative control) group (Fig. 4b). As illustrated in Fig. 4c, the group injected with the dsRNA had a higher mortality rate than the other two groups at 60, 75, 105, and 120 min.

Fig. 4.

Fig. 4

Open in a new tab

Gut esterase 1 affects deltamethrin resistance of mosquito. (a) Expression levels of gut esterase 1 in laboratory DS strain and DR strain of Cx. Pipiens pallens. (b) The expression of gut esterase 1 after microinjection. (c) Morality of the microinjected mosquitoes observed after 2-h exposure to deltamethrin in CDC bottles. *P < 0.05, **P < 0.01.

Discussion

There are hundreds of thousands of unique piRNA sequences in each species. These piRNAs show poor conservation even among closely related species, which makes the deductions about their functions challenging (Zuo et al. 2016). Most of the evidences indicated piRNA pathway is the main protection mechanism against the activity of transposons in the germline development (Grivna et al. 2006). In addition to their function in germline cells, it is emerging that piRNAs also play important roles in the brain development (Lee et al. 2011), the epigenetic regulation of various somatic cell cancers (Yan et al. 2015, Peng et al. 2016), and in antiviral responses (Schnettler et al. 2013). Obviously, the functions of piRNAs are far more complicated than they have been expected. In this work, we provided new insights on the effects of piRNA in insecticide resistance. Our study revealed that the piRNA-3312-mimic-injected mosquitoes become more susceptible to deltamethrin, whereas the piRNA-3312-inhibitor-injected mosquitoes become more resistant to deltamethrin, suggesting that piRNA-3312 participates in the regulation of deltamethrin resistance. It is widely accepted that the development of insecticide resistance in mosquitoes occurs via multiple mechanisms. The role of piRNA-3312 in deltamethrin resistance offers a novel insight into the mechanisms of insecticide resistance, which would help to make more pertinent measures in controlling mosquito populations.

Present studies mainly focus on the functions of piRNAs in transposons silencing. In contrast, the role of piRNA in regulating the gene expression is less studied and there are relatively few reported examples of the piRNA targeting mRNAs. Peng et al. found that piRNAs could regulate the expression of target mRNA in a way similar to miRNA (Peng et al. 2016). Our luciferase assay showed that piRNA-3312 significantly inhibited target mRNA gut esterase 1 expression by directly binding its 3ʹ UTR, which supported the above observation. Moreover, expression of gut esterase 1 was also demonstrated inversely related to piRNA-3312 in vivo. Overall, these results indicate piRNA-3312 can directly inhibit gut esterase 1 in vitro and in vivo.

To better understand the potential mechanisms underlying the insecticide-resistant effects of piRNA-3312-mediated down-regulation of gut esterase 1 gene, the possible involvement of gut esterase 1 gene in insecticide resistance requires further investigation. This gene belongs to dipteran juvenile hormone esterases clade (clade F). Several other members in this clade have been reported to be associated with insecticide resistance (Montella et al. 2012). For example, microarray experiment has shown that COEJHE2 was upregulated in pyrethroid-resistant An. stephensi (Vontas et al. 2007). In this paper, gut esterase 1 gene exhibited a higher level of transcription in the DR strain of Cx. pipiens pallens. Interference RNA of gut esterase 1 gene showed that the sensitivity of the DR strain increased. These findings suggested that gut esterase 1 might play some roles in the development of deltamethrin resistance in Cx. pipiens pallens.

Our previous study had shown that some miRNAs were also involved in insecticide resistance by regulating the expression of resistance-related genes, such as P450s or a cuticle protein gene (Liu et al. 2016, Tian et al. 2016). These recent studies suggest broader posttranscriptional regulation of resistance-related genes by small regulatory noncoding RNAs than previously thought. These small noncoding RNA-target interactions enrich the complex gene regulatory network and could help elucidate the molecular mechanisms of insecticide resistance. Based on the above-mentioned research results, our future research will focus on evaluating the feasibility of using these identified resistance-related candidate molecules to predict and prevent pyrethroid resistance in field Cx. pipiens pallens populations.

In conclusion, our study provides evidence that piRNA-3312 participates in the regulation of pyrethroid resistance of mosquitoes by targeting gut esterase 1 gene. The role of piRNA in pyrethroid resistance may provide novel insights into the mechanism of insecticide resistance.

Supplementary Material

Supplementary Data
Click here for additional data file. (14.2KB, docx)

Acknowledgments

This work was supported by the National Institutes of Health of US (NIH; Grant 2R01AI075746), the National Natural Science Foundation of China (Grant 81171610 and 81301458), and Priority Academic Program Development of Jiangsu Higher Education Institutions.

Supplementary Data

Supplementary data are available at Journal of Medical Entomology online.

References Cited

  1. Abilio A. P., Marrune P., de Deus N., Mbofana F., Muianga P., Kampango A.. 2015. Bio-efficacy of new long-lasting insecticide-treated bed nets against Anopheles funestus and Anopheles gambiae from central and northern Mozambique. Malar. J. 14: 352.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Andriessen R., Snetselaar J., Suer R. A., Osinga A. J., Deschietere J., Lyimo I. N., Mnyone L. L., Brooke B. D., Ranson H., Knols B. G., et al. 2015. Electrostatic coating enhances bioavailability of insecticides and breaks pyrethroid resistance in mosquitoes. Proc. Natl. Acad. Sci. USA 112: 12081–12086. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Arensburger P., Hice R. H., Wright J. A., Craig N. L., Atkinson P. W.. 2011. The mosquito Aedes aegypti has a large genome size and high transposable element load but contains a low proportion of transposon-specific piRNAs. BMC Genomics 12: 606.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Fortuna C., Remoli M. E., Di Luca M., Severini F., Toma L., Benedetti E., Bucci P., Montarsi F., Minelli G., Boccolini D., et al. 2015. Experimental studies on comparison of the vector competence of four Italian Culex pipiens populations for West Nile virus. Parasit. Vectors 8: 463.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Fulci V., Chiaretti S., Goldoni M., Azzalin G., Carucci N., Tavolaro S., Castellano L., Magrelli A., Citarella F., Messina M., et al. 2007. Quantitative technologies establish a novel microRNA profile of chronic lymphocytic leukemia. Blood 109: 4944–4951. [DOI] [PubMed] [Google Scholar]
  6. Grivna S. T., Beyret E., Wang Z., Lin H.. 2006. A novel class of small RNAs in mouse spermatogenic cells. Genes Dev. 20: 1709–1714. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Hale B. J., Yang C. X., Ross J. W.. 2014. Small RNA regulation of reproductive function. Mol. Reprod. Dev. 81: 148–159. [DOI] [PubMed] [Google Scholar]
  8. Hong S., Guo Q., Wang W., Hu S., Fang F., Lv Y., Yu J., Zou F., Lei Z., Ma K., et al. 2014. Identification of differentially expressed microRNAs in Culex pipiens and their potential roles in pyrethroid resistance. Insect Biochem. Mol. Biol. 55: 39–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Lee E. J., Banerjee S., Zhou H., Jammalamadaka A., Arcila M., Manjunath B. S., Kosik K. S.. 2011. Identification of piRNAs in the central nervous system. RNA 17: 1090–1099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Lei Z., Lv Y., Wang W., Guo Q., Zou F., Hu S., Fang F., Tian M., Liu B., Liu X., et al. 2015. MiR-278-3p regulates pyrethroid resistance in Culex pipiens pallens. Parasitol. Res. 114: 699–706. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Liu B., Tian M., Guo Q., Ma L., Zhou D., Shen B., Sun Y., Zhu C.. 2016. MiR-932 regulates pyrethroid resistance in Culex pipiens pallens (Diptera: Culicidae). J. Med. Entomol. 53(5): 1205–1210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Lumjuan N., Rajatileka S., Changsom D., Wicheer J., Leelapat P., Prapanthadara L. A., Somboon P., Lycett G., Ranson H.. 2011. The role of the Aedes aegypti Epsilon glutathione transferases in conferring resistance to DDT and pyrethroid insecticides. Insect Biochem. Mol. Biol. 41: 203–209. [DOI] [PubMed] [Google Scholar]
  13. Montella I. R., Schama R., Valle D.. 2012. The classification of esterases: An important gene family involved in insecticide resistance–a review. Mem. Inst. Oswaldo Cruz 107: 437–449. [DOI] [PubMed] [Google Scholar]
  14. Paradkar P. N., Duchemin J. B., Rodriguez-Andres J., Trinidad L., Walker P. J.. 2015. Cullin4 is pro-viral during West Nile virus infection of Culex mosquitoes. PLoS Pathog. 11: e1005143.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Peng L., Song L., Liu C., Lv X., Li X., Jie J., Zhao D., Li D.. 2016. piR-55490 inhibits the growth of lung carcinoma by suppressing mTOR signaling. Tumour Biol. 37: 2749–2756. [DOI] [PubMed] [Google Scholar]
  16. Schnettler E., Donald C. L., Human S., Watson M., Siu R. W., McFarlane M., Fazakerley J. K., Kohl A., Fragkoudis R.. 2013. Knockdown of piRNA pathway proteins results in enhanced Semliki forest virus production in mosquito cells. J. Gen. Virol. 94: 1680–1689. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Scott J. G., Yoshimizu M. H., Kasai S.. 2015. Pyrethroid resistance in Culex pipiens mosquitoes. Pestic. Biochem. Physiol. 120: 68–76. [DOI] [PubMed] [Google Scholar]
  18. Shi L., Hu H., Ma K., Zhou D., Yu J., Zhong D., Fang F., Chang X., Hu S., Zou F., et al. 2015. Development of resistance to pyrethroid in Culex pipiens pallens population under different insecticide selection pressures. PLoS Negl. Trop. Dis. 9: e0003928.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Soderlund D. M., Knipple D. C.. 2003. The molecular biology of knockdown resistance to pyrethroid insecticides. Insect Biochem. Mol. Biol. 33: 563–577. [DOI] [PubMed] [Google Scholar]
  20. Tian M., Liu B., Hu H., Li X., Guo Q., Zou F., Liu X., Hu M., Guo J., Ma L., et al. 2016. MiR-285 targets P450 (CYP6N23) to regulate pyrethroid resistance in Culex pipiens pallens. Parasitol. Res. 115: 4511–4517. [DOI] [PubMed] [Google Scholar]
  21. Vontas J., David J. P., Nikou D., Hemingway J., Christophides G. K., Louis C., Ranson H.. 2007. Transcriptional analysis of insecticide resistance in Anopheles stephensi using cross-species microarray hybridization. Insect Mol. Biol. 16: 315–324. [DOI] [PubMed] [Google Scholar]
  22. Wu S., Yang Y., Yuan G., Campbell P. M., Teese M. G., Russell R. J., Oakeshott J. G., Wu Y.. 2011. Overexpressed esterases in a fenvalerate resistant strain of the cotton bollworm, Helicoverpa armigera. Insect Biochem. Mol. Biol. 41: 14–21. [DOI] [PubMed] [Google Scholar]
  23. Yan H., Wu Q. L., Sun C. Y., Ai L. S., Deng J., Zhang L., Chen L., Chu Z. B., Tang B., Wang K., et al. 2015. piRNA-823 contributes to tumorigenesis by regulating de novo DNA methylation and angiogenesis in multiple myeloma. Leukemia 29: 196–206. [DOI] [PubMed] [Google Scholar]
  24. Zuo L., Wang Z., Tan Y., Chen X., Luo X.. 2016. piRNAs and their functions in the brain. Int. J. Hum. Genet. 16: 53–60. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Data
Click here for additional data file. (14.2KB, docx)

Articles from Journal of Medical Entomology are provided here courtesy of Oxford University Press

RESOURCES