Abstract
Ascites is a multi-faceted disease commonly observed in fast growing broilers, which is initiated when the body is insufficiently oxygenated. A series of events follow, including an increase in pulmonary artery pressure, right ventricle hypertrophy, and accumulation of fluid in the abdominal cavity and pericardium. Advances in management practices along with improved selection programs have decreased ascites incidence in modern broilers. However, ascites syndrome remains an economically important disease throughout the world, causing estimated losses of $100 million per year. In this study, a 60 K Illumina SNP BeadChip was used to perform a series of genome wide association studies (GWAS) on the 16th and 18th generation of our relaxed (REL) line descended from a commercial elite broiler line beginning in 1995. Regions significantly associated with ascites incidence were identified on chromosome 2 around 70 megabase pairs (Mbp) and on chromosome Z around 60 Mbp. Five candidate single nucleotide polymorphisms (SNP) were evaluated as indicators for these 2 regions in order to identify association with ascites and right ventricle to total ventricle weight (RVTV) ratios. Chromosome 2 SNP showed an association with RVTV ratios in males phenotyped as ascites resistant and ascites susceptible (P = 0.02 and P = 0.03, respectively). The chromosome Z region also indicates an association with resistant female RVTV values (P = 0.02). Regions of significance identified on chromosomes 2 and Z described in this study will be used as proposed candidate regions for further investigation into the genetics of ascites. This information will lead to a better understanding of the underlying genetics and gene networks contributing to ascites, and thus advances in ascites reduction through commercial breeding schemes.
Keywords: ascites, GWAS, broiler, cardiac hypertrophy
INTRODUCTION
Ascites, or pulmonary hypertension syndrome, encompasses a cascade of adverse effects that begins with the impaired ability to adequately oxygenate tissues throughout the body of a fast growing broiler and ultimately leads to death (Wideman, 1999; Balog et al., 2000; Decuypere et al., 2005; Wideman et al., 2013). The development of ascites is credited to both the genetics of the broiler and external environmental factors (Owen et al., 1990; Lubritz et al., 1995; Wideman and French, 2000; Balog et al., 2003). The response of the body to the increase in oxygen demand is increased blood flow, which leads to overloading of the heart and lungs (Julian et al., 1986). Chickens in chronic hypoxic environments will experience cardiac hypertrophy of the right ventricle (Burton and Smith, 1967). Calculation of the subsequent right ventricle to total ventricle (RVTV) weight ratio indicates an increase in this value associated with cardiac hypertrophy. Amplified pressure in the cardiovascular system will advance to eventual right ventricle hypertrophy and concludes with right ventricle failure (Huchzermeyer and Deruyck, 1986). Subsequent failure of the liver due to inadequate portal blood flow leads to plasma transudation into the body cavity (Wideman et al., 2013). Death of the bird follows soon after. Selection schemes and management techniques have been implemented to reduce the overall incidence of ascites; however, it remains an economically important disease causing an estimated economic loss of $100 million per year as recently as 2015 (M. Cooper and S. Gustin personal communication, Cobb-Vantress, Inc.).
Inducing ascites in an experimental setting can be achieved by altering the environment's temperature (Wideman et al., 1998; Sato et al., 2002), air quality (Chineme et al., 1995), and altitude (Balog et al., 2000). The first documentation of ascites occurred in La Paz, Bolivia, where birds were being raised at an altitude of 3,300 m above sea level (Hall and Machicao, 1968). An inverse correlation exists between elevation and the partial pressure of O2. Increasing elevation leads to hypoxia, or the reduction of O2 inspired and transferred to the tissues. In broiler chickens the depletion of oxygen in this manner leads to ascites syndrome (Ruiz-Feria and Wideman, 2001). At the University of Arkansas we have used a hypobaric chamber to simulate a high altitude environment as a non-invasive technique to reliably induce ascites (Owen et al., 1990; Balog et al., 2000).
Wideman et al. (2013) proposed that the moderate to high heritabilites of ascites reported from multiple studies (Lubritz et al., 1995; Wideman and French, 2000; de Greef, et al., 2001; Moghadam et al., 2001; Druyan et al., 2007) are likely due to multiple genes. Recently, a genome wide association study (GWAS) using a 3.4 K SNPChip (Muira, et al., 2008) was conducted to scan the genome for candidate single nucleotide polymorphisms (SNP) associated with ascites in a reciprocal cross between divergently selected ascites resistant and ascites susceptible lines developed at the University of Arkansas (Krishnamoorthy et al., 2014). Identification of potential genes relevant to sex biased ascites incidence were identified on chromosome 9. With advances in high throughput SNP genotyping assays, followed by the development of a moderate density 60 K Illumina SNP BeadChip (Groenen et al., 2011), GWAS can be used to more comprehensibly evaluate the broiler genome for ascites associated regions. Here, we report 2 GWAS for ascites phenotype conducted on 2 different generations of a pedigreed research line derived from a commercial elite broiler line and maintained at the University of Arkansas. Single regions were identified on 2 chromosomes that were significantly associated with phenotype for both generations. SNP for these regions were then used for additional genotyping.
METHODS
Genome Data
All chromosomal positions are relative to the November 2011 ICGSC Gallus-gallus-4.0/galGal4 (GCA_000002315.2) assembly.
Bird Stocks and Hypobaric Chamber Trials
All animal procedures were approved by the University of Arkansas Institutional Animal Care and Use Committee under protocol 12039. Within the hypobaric chamber are 4 batteries that house 40 identical cages measuring 0.6 × 0.6 × 0.3 m. Each cage has access to nipple waterers and trough feeders. The chamber is designed to control simulated altitude, ventilation, and temperature. For the duration of the trial the elevation was set to simulate approximately 2,900 m above sea level, or 533 mm of Hg. Daily, the elevation was observed with any adjustments being made to maintain the set altitude. Chamber airflow was set at 17 m3/min and air filters were changed daily. The chamber was warmed to 92°C prior to introducing the chicks and the temperature was decreased weekly. The birds used for this study are from 2 different years spanning 3 generations. The chicks hatched were the offspring of the 15th and 17th generation of the pedigreed elite broiler line that has remained under relaxed (REL) selection since 1995 (Pavlidis et al., 2007). The parents were aritifically inseminated using pooled semen and the eggs were pedigreed according to the hen. We will refer to these 2 hatches as the 16th and 18th generation of the REL line. Chicks were hatched at the University of Arkansas hatchery, wing banded, and immediately transferred randomly to cages in the hypobaric chamber. For the next 6 wk mortality was recorded and necropsies were completed to record: probable cause of death, overt visual signs of ascites symptoms, total body weight, heart shape, right and total ventricle weight, and gender. At the end of the 6-week trial all remaining birds were euthanized by cervical dislocation and scored as above. Final decision of ascites phenotype was based on the presence or absence of water belly, which represents the final stage of ascites progression prior to death. Additional evaluation of heart morphology was measured as the proportion of the right ventricle weight in grams to the total weight of both ventricles in grams.
DNA Isolation
At 4 d of age, 10 μl of blood was extracted from birds via a lancet puncture between the toes. A rapid DNA isolation method was used to isolate the DNA (Bailes, et al., 2007). For GWAS submission crude genomic DNA was purified further using Mackery-Nagel Plasmid prep plates for gDNA cleanup kit and quantified using a DyNA Quant from Hoefer and Hoechst 33258 fluorescent stain (Thermo Fisher Scientific, Waltham, MA).
Genome Wide Association Study
A female gender bias was observed in data from a previously published GWAS on chromosome 9 (Krishnamoorthy et al., 2014). For this reason, we decided to focus on elucidating possible male bias in the current study. A total of 2 GWAS was completed on 15 resistant and 22 susceptible males from the 16th generation, and 39 resistant and 22 susceptible males from generation 18 REL line birds that were phenotyped as described above in a 6-week hypobaric chamber challenge. Variation in sample size was due to bird availability, although preference was made for birds phenotyped as ascites susceptible early in the trial. The GWAS was conducted by DNA Landmarks (Quebec, Canada) using an Illumina 60 K SNPChip on REL line males.
SNP allele frequencies were calculated independently for resistant and susceptible individuals using Microsoft Excel (Microsoft Corp., Redmond, WA). Loci with a minor allele frequency of less than 0.05 were excluded. Allele frequencies were used to calculate expected genotype counts. Deviations from Hardy-Weinberg were computed for each locus based on observed vs. expected genotype counts. Loci with a P-value less than 0.05 were excluded. Genotypic frequencies were calculated for resistant and susceptible subpopulations following Krishnamoorthy et al. (2014). Actual frequencies were then used to calculate expected frequencies. A chi-square test was performed comparing the actual and expected frequencies for genotypes independently for resistant and susceptible phenotype groups. The P-values obtained from this chi-square test were log transformed plotted as 1-Log10(P) for visualization. For each locus an average 1-Log10(P) was calculated for a sliding window of 10 flanking SNP, which covers approximately 375,000 bp. The purpose of the window is to account for linkage disequilibrium in closely positioned SNP, while the use of 10 SNPs is directly related to an increase in power of ascites association detection for a small sample size as seen in this study (Gao et al., 2012). We then completed further investigation into regions that surpassed a threshold of 1-Log10(P) > 2.5 in both generations due to a lack of largely significant peaks normally seen in GWAS completed on other livestock species.
Real-time PCR
Specific SNP were used to develop exonuclease (Taqman® probe, Thermo Fisher Scientific, Waltham, MA) assays for quantitative real-time PCR genotyping. PCR primers and probes, along with optimized annealing temperatures are presented in Table 1. Genotyping was competed using a CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories, Inc., Richmond, CA). Reaction volume totaled 20 μL including 1× Taq-Buffer (50 mM Tris-Cl pH 8.3, one mM MgCl2, 30 μg/mL of BSA), 0.2 mM MgCl2, 0.2 mM dNTP, 0.2 μM each forward and reverse primers, 0.05 μM each probe, 2.5 units of Taq polymerase, and 2 μL of DNA. A 2-step PCR procedure was used as follows: 90°C for 30 s, 10 cycles of 90°C for 15 s, and SNP-specific annealing temperature for 30 s, followed by 90°C for 15 s, SNP-specific annealing temperature for 30 s, and a plate read for a total of 30 cycles. Verification of each primer set was completed on controls prior to genotyping birds used in this study.
Table 1.
Location of SNP identified from GWAS. Annealing temperature, forward and reverse primers, and probes also included for each SNP.
| SNP | SNP | Reference | Reference/alternative | Annealing temp | |||||
|---|---|---|---|---|---|---|---|---|---|
| ID | Chr | position | SNP | allele (strand) | (°C) | Primer | Probe | ||
| 2.708 | 2 | 70835627 | rs14203518 | T/C (Fwd) | 56.4 | F | CTCAGCTGGTCCTGCTAACAT | Probe 1 | CTAAAGTATGAGTAtCCAAGTCTT1 |
| R | TCTGAGGGAGGGAAAAAGGT | Probe 2 | CTAAAGTATGAGTAcCCAAGTC | ||||||
| 2.713 | 2 | 71320330 | rs14203691 | A/G (Fwd) | 52 | F | TAATGGAAACAACCTCTGTGCTCTGGA | Probe 1 | TCCTAtCCTGAAGAAAGAGCAAATAAAT |
| R | GCCTCCCATGTCTTTGGCTTGGA | Probe 2 | TCCTAcCCTGAAGAAAGAGCAAATA | ||||||
| Z.591 | Z | 59169596 | rs10723172 | C/T (Fwd) | 67 | F | GGGGGATAGAGGAGGCTGGTGT | Probe 1 | TAcGACACAATAGGCTTTTCCATAAG |
| R | TCACCCTGTCATCGTTTTTGAAACATG | Probe 2 | TAtGACACAATAGGCTTTTCCATAAGT | ||||||
| Z.600 | Z | 60058344 | rs14748694 | T/C (Rev) | 68 | F | GTCCGGCTCTGTGTCTGCCCTGA | Probe 1 | ACaAAGAGTGGAAATATGGATTTCCAGCATC |
| R | TCCAACAGAACTCCCTGGTGTTTCACC | Probe 2 | ACgAAGAGTGGAAATATGGATTTCCAGCAT | ||||||
| Z.611 | Z | 61154772 | rs16774018 | C/T (Rev) | 59 | F | AGGCATTGCTTCCTTCTGGGAGAAC | Probe 1 | TGcTTGGATATTCATAAAGTTCTCCC |
| R | CAGCTGTTAGTTTGGTGGGGGCTTT | Probe 2 | TGtTTGGATATTCATAAAGTTCTCCCA |
1Lower case letters indicate loci specific for SNP.
Statistical Methods
Individuals genotyped for all SNP include 145 resistant and 123 susceptible males, and 98 resistant and 115 susceptible females. Birds were evaluated by ascites phenotype and RVTV ratio. Genotype frequency was calculated for ascites resistant and susceptible individuals by gender. A chi-square test was performed on expected vs. observed counts, with a P-value of <0.05 indicating significance.
The right ventricle to total ventricle ratio was calculated based on associated weights recorded during necropsy. For each SNP locus a Student's t-test was used to compare RVTV ratios for each corresponding genotype, in which resistant and susceptible individuals were compared independently. Male and female ratios were calculated independently of each other, and RVTV ratios were considered significant with a P-value of <0.05.
RESULTS
After application of quality control filtering the 60 K Illumina SNP BeadChip analysis resulted in a total of 37,109 informative SNP. Using 1-Log10P threshold of greater than 2.5, informative regions on chromosomes 2 and Z were identified as candidates for investigation into the genetic causes of ascites in broilers (P ≤ 0.0316). Out of a total of 4,779 SNPs on chromosome 2, 4,215 SNPs were polymorphic in the REL line (Figure 1). A region around 70 megabase pairs (Mbp) appears to show significant association in ascites resistant individuals in both generations by meeting the threshold chosen of 2.5. Interestingly, the GWAS of susceptible individuals did not indicate any such significance. Similarly, 1,178 of 1,385 SNP were informative on the Z chromosome, for which a region of significance was observed around 60 Mbp and detectable in both generations in susceptible individuals, but does not surpass the threshold in ascites resistant individuals (Figure 2).
Figure 1.
Genome wide association study results indicate a region of interest around 70 Mbp on chromosome 2 in resistant males comparing 2 generations of REL line individuals. Single nucleotide polymorphism loci are identified as the corresponding Mbp along the chromosome 2. Association of SNP loci to ascites resistance is visualized as a 1-LOGP value.
Figure 2.
Genome wide association results indicating a region of interest around 60 Mbp on chromosome Z in susceptible males comparing 2 generations of REL line individuals. Single nucleotide polymorphism loci are identified as the corresponding Mbp along the Z chromosome. Association of SNP loci to ascites susceptibility is visualized as a 1-LOGP value.
Significant SNP regions were first identified by visualization of regions associated with ascites phenotype using the 1-Log10(P) values completed after application of a sliding SNP window. Two to 3 SNP per significant region were identified to be used as candidate SNP for these regions for further evaluation into association with ascites incidence. Two SNP were selected from chromosome 2 and 3 SNP were selected from chromosome Z as indicators for regions associated with ascites resistance and susceptibility, respectively. SNP were selected that passed quality control, had an individual 1-Log10(P) at the threshold of 2.5, and whose genotypes were segregating in both generations. SNP were used for further genotype assays on a larger collection of DNA that had been isolated from hypobaric chamber trials completed with the offspring from the 18th generation of the REL line (Table 2). For both SNP on chromosome 2 in male individuals there were no significant differences detected between the frequencies of the resistant and susceptible individuals. In the susceptible males on SNP 2.708 the TT (0.44) and CC (0.44) genotypes both have RVTV averages higher than the heterozygous susceptible individuals (0.41; P = 0.03). The greater RVTV values in susceptible males equate to a higher ascites incidence seen in both the TT genotyped males and in the lower frequency CC genotyped susceptible males. The average RVTV for SNP 2.713 for resistant males varied significantly among genotypes (P = 0.02). Homozygous AA genotyped birds sustain a significantly lower RVTV ratio (0.28) when compared to AG (0.30) individuals. The largest RVTV value in the GG genotype was not detected as being significantly different from AA or AG genotypes, likely because of the small frequency in the population. Differences detected in the RVTV of resistant birds evaluated on the 2.713 SNP indicate ascites percent was negligible, except for the GG genotype (AA-44% vs. AG-45%, GG-30%). While the lowest ascites percentage is evaluated on the GG SNP, the frequency of this SNP is low, and may not be adequately represented in the population to draw definitive conclusions as to the RVTV and ascites incidence relationship.
Table 2.
Data collected from single nucleotide polymorphisms from 145 resistant and 123 susceptible male individuals on chromosomes 2 and Z. Included are SNP identification names, location, individual counts, percent incidence of ascites susceptible birds, observed genotypic frequencies, and corresponding P-values calculated for chi-squared tests. Additionally, RVTV averaged ratios for resistant and susceptible individuals are included. Information for males and females presented separately.
| SNP ID | SNP location (Chr:Mbp) | Genotype | Ascites (%) | R* Freq | S* Freq | Pval | R RVTV Avg | S RVTV Avg | |
|---|---|---|---|---|---|---|---|---|---|
| 2.708 | Gga2:70.83 | TT | 46% | 0.55 | 0.58 | 0.78 | 0.29 | 0.44a | |
| TC | 42% | 0.36 | 0.33 | 0.69 | 0.31 | 0.41b | |||
| CC | 45% | 0.09 | 0.09 | 0.93 | 0.30 | 0.44a,b | |||
| 2.713 | Gga2:71.32 | AA | 44% | 0.48 | 0.48 | 0.98 | 0.28b | 0.45 | |
| AG | 45% | 0.48 | 0.49 | 0.82 | 0.30a,b | 0.43 | |||
| GG | 30% | 0.04 | 0.03 | 0.37 | 0.34a | 0.44 | |||
| Z.591 | GgaZ:59.169 | CC | 50% | 0.26 | 0.31 | 0.43 | 0.28 | 0.44 | |
| CT | 46% | 0.45 | 0.45 | 0.94 | 0.30 | 0.43 | |||
| TT | 40% | 0.29 | 0.24 | 0.36 | 0.29 | 0.44 | |||
| Z.600 | GgaZ:60.058 | TT | 50% | 0.15 | 0.17 | 0.63 | 0.32 | 0.43 | |
| TC | 46% | 0.45 | 0.46 | 0.99 | 0.30 | 0.43 | |||
| CC | 45% | 0.40 | 0.37 | 0.75 | 0.29 | 0.44 | |||
| Z.611 | GgaZ:61.154 | CC | 33% | 0.26 | 0.21 | 0.46 | 0.29 | 0.43 | |
| CT | 38% | 0.32 | 0.33 | 0.90 | 0.30 | 0.43 | |||
| TT | 40% | 0.42 | 0.46 | 0.66 | 0.20 | 0.45 | |||
*R indicates birds that were phenotyped as ascites resistant following a high-altitude challenged hypobaric chamber trial; S indicates birds that were phenotyped as ascites susceptible following a high-altitude challenged hypobaric chamber trial.
a,bMeans within the same column and with no common superscript differ significantly (P < 0.05).
Right ventricle to total ventricle ratios did vary significantly among genotypes on 2.708 in susceptible females (Table 3). Interestingly, the heterozygous genotype associated with the lowest RVTV in males has the highest RVTV values in females, which indicates the source of ascites genetics may vary based on sex. On SNP 2.718 the difference in resistant and susceptible genotypic frequency calculation approaches significance in females for the AA (P = 0.07) and AG (P = 0.09) genotypes. Further, the genotype with the highest ascites incidence, AA, is higher in frequency in susceptible females (0.38 resistant vs. 0.55 susceptible), while the lowest ascites incidence genotype, AG, is present at a higher frequency in resistant females (0.59 resistant vs. 0.42 susceptible).
Table 3.
Data collected from single nucleotide polymorphisms from 98 resistant and 115 susceptible female individuals on chromosomes 2 and Z. Included are SNP identification names, location, individual counts, percent incidence of ascites susceptible birds, observed genotypic frequencies, and corresponding P-values calculated for chi-squared tests. Additionally, RVTV averaged ratios for resistant and susceptible individuals are included. Information for males and females presented separately.
| SNP ID | SNP location (Chr:Mbp) | Genotype | Ascites (%) | R* Freq | S* Freq | Pval | R RVTV Avg | S RVTV Avg |
|---|---|---|---|---|---|---|---|---|
| 2.708 | Gga2:70.83 | TT | 55% | 0.52 | 0.63 | 0.36 | 0.30 | 0.43b |
| TC | 41% | 0.40 | 0.27 | 0.13 | 0.30 | 0.46a | ||
| CC | 56% | 0.08 | 0.10 | 0.65 | 0.28 | 0.44a,b | ||
| 2.713 | Gga2:71.32 | AA | 62% | 0.38 | 0.55 | 0.07 | 0.29 | 0.43 |
| AG | 44% | 0.59 | 0.42 | 0.09 | 0.29 | 0.44 | ||
| GG | 50% | 0.03 | 0.03 | 0.89 | 0.32 | 0.44 | ||
| Z.591 | GgaZ:59.169 | CW | 50% | 0.44 | 0.55 | 0.92 | 0.30 | 0.43 |
| TW | 51% | 0.56 | 0.45 | 0.92 | 0.29 | 0.43 | ||
| Z.600 | GgaZ:60.058 | TW | 47% | 0.40 | 0.33 | 0.36 | 0.27b | 0.43 |
| CW | 55% | 0.60 | 0.60 | 0.49 | 0.31a | 0.44 | ||
| Z.611 | GgaZ:61.154 | CW | 48% | 0.63 | 0.55 | 0.46 | 0.29 | 0.45 |
| TW | 57% | 0.37 | 0.45 | 0.37 | 0.31 | 0.43 |
*R indicates birds that were phenotyped as ascites resistant following a high-altitude challenged hypobaric chamber trial; S indicates birds that were phenotyped as ascites susceptible following a high-altitude challenged hypobaric chamber trial.
a,bMeans within the same column and with no common superscript differ significantly (P < 0.05).
For all 3 chromosome Z SNP, females (the heterogametic sex) have only 2 possible genotypes, vs. the 3 possible genotypes found in males. All Z chromosome SNP in males appear to be statistically similar in RVTV ratio averages across all genotypes. Yet, the TT genotype from the Z.600 SNP approaches a significantly higher RVTV value in resistant males compared to TC and TT genotypes (P = 0.06). This scenario is also seen in the TT genotype in susceptible males at Z.611 (P = 0.09). In both cases, the larger RVTV values are associated with higher percentages of ascites incidence within each SNP. In the case of SNP Z.600 resistant females, the CW genotyped individuals have a significantly higher RVTV value (0.31) than TW genotype individuals (0.27). For the Z.611 locus, susceptible females have higher RVTV values in the TW genotype compared to CW females if the threshold of significance is evaluated at P = 0.07. The variation seen in the susceptible female RVTV values on Z.611 is inversely related to the ascites incidence among the genotypic populations. No significant differences were detected in chi-square analyses of observed vs. expected counts for any genotype from males and females of all 5 SNP.
DISCUSSION
Multiple GWAS have been conducted, spanning 2 generations in a randomly mated control broiler line (REL), to detect loci that showed association with ascites phenotype in both generations to identify loci that are robust and consistent in association with ascites. Evaluation of ascites resistant and susceptible individuals occurred on 29 chromosomes using a 60 K SNP chip. Evaluation of P-values at each SNP locus as an averaged sliding window reduced the overall significance seen in SNP associations. For this reason, genotyping on candidate regions to evaluated associations with ascites outcome was completed at 5 loci. It is important to note that the regions previously identified on chromosome 9 in REL line broilers were not significant in these analyses focused on association in male individuals (Krishnamoorthy et al., 2014). The prior GWAS used an F2 cross of the resistant and susceptible lines, which were divergently selected from the predecessor of the REL line. This suggests that epistasis can play a major role in ascites genetics since the F2 cross GWAS identified regions different from a GWAS in the REL line. Genome-wide association studies provide powerful insight into the genetic basis for complex diseases; however, this genotyping technology is subject to Type 1 and Type 2 errors, depending on correction techniques used (Johnson et al., 2010). Through use of a sliding window, GWAS P-values are corrected to account for data sets with high levels of linkage disequilibrium in a method less labor intensive than permutation corrections (Gao, 2011). Ultimately, GWAS information from multiple generations provides a better understanding of the chromosomal regions that are influencing disease occurrence, rather than focusing on generation-specific loci whose associations are merely artifacts of chance in a relaxed-selected line.
Utilizing the sliding window analysis method, 2 GWAS conducted on 2 generations of the relaxed selection REL line indicated regions on an autosomal chromosome (2) and a sex chromosome (Z) associated with ascites phenotype or cardiac hypertrophy. Although these regions were initially identified as indicators for ascites, their influence on RVTV values, as an indicator of heart health, is equally informative. The region of significance on chromosome 2 in male and female broilers indicates that a variation exists in the RVTV ratio among genotypes of candidate SNP. When the oxygen demand of the body increases in a fast growing broiler the right ventricle experiences an increase in workload as the cardiac output being transferred to the lungs for future oxygenation increases (Peacock et al., 1989). This results in morphologic changes to the right ventricle that leads to ventricle hypertrophy (Burton et al., 1968). Right ventricle hypertrophy serves as a precursor for the development of ascites (Julian et al., 1986). Single nucleotide polymorphisms whose RVTV values are positively correlated to ascites incidence in susceptible individuals may play a larger role in a bird's ascites phenotype, relative to SNP that do not show such a trend. Right ventricle to total ventricle values calculated for females genotyped at SNP 2.708 are not directly correlated to ascites susceptibility. Rather, these loci, and their associated RVTV ratios, may be artifacts of linkage disequilibrium.
The region of significance identified on chromosome 2 contains 2 candidate genes, MC4R and CDH6. MC4R encodes the melanocortin-4 receptor that acts as a key regulator in appetite and body size (Huszar et al., 1997). Mouse knockouts for MC4R have elevated food intake and maturity-onset obesity (Huszar et al., 1997; Chen et al., 2000). Additionally, despite being associated with obesity, MC4R deficient mice have lower mean arterial pressure and are not hypertensive (Tallam et al., 2005; Tallam et al., 2006). Further, chronic hypothalamic stimulation of MC4R in rats increased arterial pressure regardless of food intake and weight gain (Kuo et al., 2003). Therefore, MC4R could play an integral role in regulation of arterial pressures associated with ascites in broilers. CDH6 encodes cadherin 6, critical for the development of the renal vesicle and proximal tubule through promotion of mesenchymal to epithelial transition during embryogenesis (Cho et al., 1998). CDH6 is also found as a surface receptor protein on platelets (Elrod et al., 2003) and can function in regulating platelet aggregation (Edwards et al., 2007). Inhibition of CDH6 results in a reduction in thrombus formation (Dunne et al., 2012). Therefore, dysregulation of CDH6 could contribute to abnormalities in clotting or vascular lesions observed in the lungs during ascites progression in broilers (Wideman et al., 2011). Extremes in ascites incidence evaluated from female resistant and susceptible frequencies on SNP 2.713 may provide insight into genotypic-based incidence in females.
Within the Z chromosome region that we identified in the GWAS is the gene for myocyte enhancer factor 2C (MEF2c), a member of the family of MADS-box transcription factors involved in myogenesis and morphogenesis of skeletal, smooth, and cardiac muscle cells (Black and Olson, 1998). MEF2c is the earliest of the MEF2 family to be expressed in the chick, which occurs at the beginning of cardiac and skeletal muscle differentiation during embryogenesis (Edmondson et al., 1994). Embryonic inactivation of MEF2c in mice inhibits formation of the right ventricle and leads to embryonic lethality (Lin et al., 1997). MEF2C is a key regulator for reprogramming fibroblasts to the myocyte lineage (Song et al., 2012) and is known to up-regulate other genes known for cardiocyte formation, GATA4 and NKX2.5 (Dodou et al., 2004; Skerjanc et al., 1998). While significance did not reach the P-value standard set in this study, resistant and susceptible males in this region identified in both GWAS indicate this location may be critical to the development of ascites. Preliminary data suggests that SNP Z.611 homozygous T male individuals phenotyped as ascites susceptible approach statistical significance for higher RVTV ratios compared to other genotypes (P = 0.07), while also retaining a higher ascites incidence. Overall, the variation in genotypic frequency, coupled with the variable incidence of ascites, exhibited by the SNP 2.713 AA and AG genotyped females, and TT susceptible males exhibiting high RVTV values and high ascites incidence on SNP 2.708, indicate these regions may be useful for further investigation into ascites incidence.
Previously, Krishnamoorthy et al. (2014) used a genome wide association analysis to identify weakly associated regions on chromosome 9 from an F2 generation from a cross of an ascites-selected resistant line and an ascites-selected susceptible line cross. Importantly, a female sex effect was detected in Krishnamoorthy et al. (2014). The same region evaluated in Krishnamoorthy et al. (2014) showed nothing of interest in the multi-generational GWAS completed in this study. Rabie et al. (2005) cited many chromosomal regions as responsible for ascites incidence including chromosomes 2, 5, 8, 10, 27, and 28. Notably, chromosome 9 was not implicated as a causal source. Rabie et al. (2005) did find an association with RVTV ratio and a region on chromosome 2, but this region was located at position 105.8–126.9 Mb, compared to the region at 70 Mb and 71 Mb detected through this study. Combined with data analyzed by Krishnamoorthy et al. (2014) and Rabie et al. (2005), the current study has introduced additional information as to potential regions associated with ascites phenotype, and has evaluated the usefulness in utilizing an RVTV parameter in evaluation of ascites outcome for future studies.
Ascites is the manifestation of multiple symptoms (Olkowski et al., 1999), and thus, is a complex disease whose occurrence is subject to many genetic factors. In order to aid commercial selection programs in the reduction of ascites, and increase overall heart health, information from studies such as the one presented here will elucidate genetic causes to adverse attributes evaluated in fast-growing broilers.
Acknowledgments
This work was supported by NIFA grant 2014-06315 to NA and DR. Funding for RK was from the Arkansas INBRE program, with grants from the National Center for Research Resources - NCRR (P20RR016460) and the National Institute of General Medical Sciences NIGMS (P20 GM103429) National Institutes of Health.
REFERENCES
- Bailes S. M., Devers J. J., Kirby J. D., Rhoads D. D.. 2007. An inexpensive, simple protocol for DNA isolation from blood for high-throughput genotyping by polymerase chain reaction or restriction endonuclease digestion. Poult. Sci. 86:102–106. [DOI] [PubMed] [Google Scholar]
- Balog J. M., Anthony N. B., Cooper M. A., Kidd B. D., Huff G. R., Huff W. E., Rath N. C.. 2000. Ascites syndrome and related pathologies in feed restricted broilers raised in a hypobaric chamber. Poult. Sci. 79:318–323. [DOI] [PubMed] [Google Scholar]
- Balog J. M., Kidd B. D., Huff W. E., Huff G. R., Rath N. C., Anthony N. B.. 2003. Effect of cold stress on broilers selected for resistance or susceptibility to ascites syndrome. Poult. Sci. 82:1383–1387. [DOI] [PubMed] [Google Scholar]
- Black B. L., Olson E. N.. 1998. Transcriptional control of muscle development by myocyte enhancer factor-2 (MEF2) proteins. Annu. Rev. Cell Dev. Bio. 14:167–196. [DOI] [PubMed] [Google Scholar]
- Burton R. R., Smith A. H.. 1967. Effect of polycythemia and chronic hypoxia on heart mass in chicken. J. Appl. Physiol. 22:782–785. [DOI] [PubMed] [Google Scholar]
- Burton R. R., Besch E. L., Smith. A. H. 1968. Effect of chronic hypoxia on the pulmonary arterial blood pressure of the chicken. Am. J. Physiol. 214:1438–1442. [DOI] [PubMed] [Google Scholar]
- Chen A. S., Metzger J. M., Trumbauer M. E., Guan X. M., Yu H., Frazier E. G., Marsh D. J., Forrest M. J., Gopal-Truter S., Fisher J., Camacho R. E., Strack A. M., Mellin T. N., MacIntyre D. E., Chen H. Y., Van der Ploeg L. H. T.. 2000. Role of the melanocortin-4 receptor in metabolic rate and food intake in mice. Transgenic Res. 9:145–154. [DOI] [PubMed] [Google Scholar]
- Chineme C. N., Buyse J., Buys N., Hassanzadeh Lademakhi M., Albers G. A. A, Decuypere E.. 1995. Interaction of genotype, egg-shell conductance and dietary T3 supplementation in the development of heart-failure syndrome and ascites in broiler-chicken. Arch. Geflugelkunde. 59:129–134. [Google Scholar]
- Cho E. A., Patterson L. T., Brookhiser W. T, Mah S., Kintner C., Dressler G. R. 1998. Differential expression and function of cadherin-6 during renal epithelium development. Development. 125:30–312. [DOI] [PubMed] [Google Scholar]
- de Greef K. H., Janss L. L. G., Vereijken A. L. J., Pit R., Gerritsen C. L. M.. 2001. Disease-induced variability of genetic correlations: Ascites in broilers as a case study. J. Anim. Sci. 79:1723–1733. [DOI] [PubMed] [Google Scholar]
- Decuypere E., Hassanzadeh M., Buys N.. 2005. Further insights into the susceptibility of broilers to ascites. Vet. J. 169:319–320. [DOI] [PubMed] [Google Scholar]
- Dodou E., Verzi M. P., Anderson J. R., Xu S. M., Black B. L.. 2004. Mef2c is a direct transcriptional target of ISL1 and GATA factors in the anterior heart field during mouse embryonic development. Development. 131:3931–3942. [DOI] [PubMed] [Google Scholar]
- Druyan S., Ben-David A., Cahaner A.. 2007. Development of ascites-resistant and ascites-susceptible broiler lines. Poult. Sci. 86:811–822. [DOI] [PubMed] [Google Scholar]
- Dunne E., Spring C., Reheman A., Jin W., Berndt M. C., Newman D. K., Newman P. J., Ni. H., Kenny D.. 2012. Cadherin 6 has a functional role in platelet aggregation and thrombus formation. Arterioscler. Thromb. Vasc. Biol. 32:1724–1731. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Edmondson D. G., Lyons G. E., Martin J. F., Olson E. N.. 1994. Mef2 gene-expression marks the cardiac and skeletal-muscle lineages during mouse embryogenesis. Development. 120:1251–1263. [DOI] [PubMed] [Google Scholar]
- Edwards R. J., Moran N., Devocelle M., Kiernan A., Meade G., Signac W., Foy M., Park S. D. E., Dunne E, Kenny D., Shields D. C.. 2007. Bioinformatic discovery of novel bioactive peptides. Nat. Chem. Biol. 3:108–112. [DOI] [PubMed] [Google Scholar]
- Elrod J. W., Park J. H, Oshima T., Sharp C. D, Minagar A, Alexander. J. S.. 2003. Expression of junctional proteins in human platelets. Platelets. 14:247–251. [DOI] [PubMed] [Google Scholar]
- Gao Q., Yuan Z., He Y., Zhang J. Z. X., Zhang B., Xue F.. 2012. Exhaustive sliding-window scan strategy for genome-wide association study via PCA-based logistic model. GJSFR Bio-Tech & Genetics 12. [Google Scholar]
- Gao X. Y. 2011. Multiple testing corrections for imputed SNPs. Genet. Epidemiol. 35:154–158. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Groenen M. A. M., Megens H.-J., Zare Y., Warren W. C., Hillier L. W., Crooijmans R. P. M. A., Vereijken A., Okimoto R., Muir W. M., Cheng H. H.. 2011. The development and characterization of a 60 K SNP chip for chicken. BMC Genomics 12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hall S. A., Machicao N.. 1968. Myocarditis in broiler chickens reared at high altitude. Avian Dis. 12:75. [PubMed] [Google Scholar]
- Huchzermeyer F. W., Deruyck A. M. C.. 1986. Pulmonary-hypertension syndrome associated with ascites in broilers. Vet. Rec. 119:94–94. [DOI] [PubMed] [Google Scholar]
- Huszar D., Lynch C. A., FairchildHuntress V., Dunmore J. H., Fang Q., Berkemeier L. R., Gu W., Kesterson R. A., Boston B. A., Cone R. D., Smith F. J., Campfield L. A., Burn P., Lee F.. 1997. Targeted disruption of the melanocortin-4 receptor results in obesity in mice. Cell. 88:131–141. [DOI] [PubMed] [Google Scholar]
- Johnson R. C., Nelson G. W, Troyer J. L., Lautenberger J. A., Kessing B. D., Winkler C. A., S. J. O’Brien. 2010. Accounting for multiple comparisons in a genome-wide association study (GWAS). BMC Genomics 11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Julian R. J., Summers J., Wilson J. B.. 1986. Right ventricular failure and ascites in brioler-chickens caused by phosphorus-deficient diets. Avian Dis. 30:453–459. [PubMed] [Google Scholar]
- Krishnamoorthy S., Smith C. D., Al-Rubaye A. A., Erf G. F., Wideman R. F., Anthony N. B., Rhoads D. D.. 2014. A quantitative trait locus for ascites on chromosome 9 in broiler chicken lines. Poult. Sci. 93:307–317. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kuo J. J., Silva A. A., Hall J. E.. 2003. Hypothalamic melanocortin receptors and chronic regulation of arterial pressure and renal function. Hypertension. 41:768–774. [DOI] [PubMed] [Google Scholar]
- Lin Q., Schwarz J., Bucana C., Olson E. N.. 1997. Control of mouse cardiac morphogenesis and myogenesis by transcription factor MEF2C. Science. 276:1404–1407. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lubritz D. L., Smith J. L., McPherson B. N.. 1995. Heritability of ascites and the ratio of right to total ventricle weight in broiler breeder males lines. Poult. Sci. 74:1237–1241. [DOI] [PubMed] [Google Scholar]
- Moghadam H. K., McMillan I., Chambers J. R., Julian R. J.. 2001. Estimation of genetic parameters for ascites syndrome in broiler chickens. Poult. Sci. 80:844–848. [DOI] [PubMed] [Google Scholar]
- Muira W. M., Wong G. K.-S., Zhang Y., Wang J., Groenen M. A. M., Crooijmans R. P. M. A., Megens H.-J., Zhang H., Okimoto R., Vereijken A., Jungerius A., Albers G. A. A., Lawley C. T., Delany M. E., MacEachern S., Cheng H. H.. 2008. Genome-wide assessment of worldwide chicken SNP genetic diversity indicates significant absence of rare alleles in commercial breeds. Proc. Natl. Acad. Sci. USA. 105:17312–17317. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Olkowski A. A., Korver D., Rathgeber B., Classen H. L.. 1999. Cardiac index, oxygen delivery, and tissue oxygen extraction in slow and fast growing chickens, and in chickens with heart failure and ascites: A comparative study. Avian Pathol. 28:137–146. [DOI] [PubMed] [Google Scholar]
- Owen R. L., Wideman R. F., Hattel A. L., Cowen B. S.. 1990. Use of a hypobaric chamber as a model system for investigating ascites in broilers. Avian Dis. 34:754–758. [PubMed] [Google Scholar]
- Pavlidis H. O., Balog J. M., Stamps L. K., Hughes J. D., Huff W. E., Anthony N. B.. 2007. Divergent selection for ascites incidence in chickens. Poult. Sci. 86:2517–2529. [DOI] [PubMed] [Google Scholar]
- Peacock A. J., Pickett C., Morris K., Reeves J. T.. 1989. The relationship between rapid growth and pulmonary hemodynamics in the fast-growing broiler chicken. Am. Rev.Respir. Dis. 139:1524–1530. [DOI] [PubMed] [Google Scholar]
- Rabie T., Crooijmans R., Bovenhuis H., Vereijken A. L. J., Veenendaal T., van der Poel J. J., Van Arendonk J. A. M., Pakdel A., Groenen M. A. M.. 2005. Genetic mapping of quantitative trait loci affecting susceptibility in chicken to develop pulmonary hypertension syndrome. Anim. Genet. 36:468–476. [DOI] [PubMed] [Google Scholar]
- Ruiz-Feria C. A., Wideman R. F.. 2001. Taurine, cardiopulmonary hemodynamics, and pulmonary hypertension syndrome in broilers. Poult. Sci. 80:1607–1618. [DOI] [PubMed] [Google Scholar]
- Sato T., Tezuka K., Shibuya H., Watanabe T., Kamata H., Shirai W.. 2002. Cold-induced ascites in broiler chickens and its improvement by temperature-controlled rearing. Avian Dis. 46:989–996. [DOI] [PubMed] [Google Scholar]
- Skerjanc I. S., Petropoulos H., Ridgeway A. G., Wilton S.. 1998. Myocyte enhancer factor 2C and Nkx2-5 up-regulate each other's expression and initiate cardiomyogenesis in P19 cells. J. Biol.Chem. 273:34904–34910. [DOI] [PubMed] [Google Scholar]
- Song K., Nam Y.-J., Luo X., Qi X., Tan W., Huang G. N., Acharya A., Smith C. L., Tallquist M. D., Neilson E. G., Hill J. A., Bassel-Duby R., Olson E. N.. 2012. Heart repair by reprogramming non-myocytes with cardiac transcription factors. Nature. 485:599–604. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tallam L. S., da Silva A. A., Hall J. E.. 2006. Melanocortin-4 receptor mediates chronic cardiovascular and metabolic leptin. Hypertension. 48:58–64. [DOI] [PubMed] [Google Scholar]
- Tallam L. S., Stec D. E., Willis M. A., da Silva A. A., Hall J. E.. 2005. Melanocortin-4 receptor-deficient mice are not hypertensive or salt-sensitive despite obesity, hyperinsulinemia, and hyperleptinemia. Hypertension. 46:326–332. [DOI] [PubMed] [Google Scholar]
- Wideman R. F. 1999. Cardiac output in four-, five-, and six-week-old broilers, and hemodynamic responses to intravenous injections of epinephrine. Poult. Sci. 78:392–403. [DOI] [PubMed] [Google Scholar]
- Wideman R. F., French H.. 2000. Ascites resistance of progeny from broiler breeders selected for two generations using chronic unilateral pulmonary artery occlusion. Poult. Sci. 79:396–401. [DOI] [PubMed] [Google Scholar]
- Wideman R. F., Hamal K. R., Bayona M. T., Lorenzoni A. G., Cross D., Khajali F., Rhoads D. D., Erf G. F., Anthony N. B.. 2011. Plexiform lesions in the lungs of domestic fowl selected for susceptibility to pulmonary arterial hypertension: Incidence and histology. Anat. Rec. 294:739–755. [DOI] [PubMed] [Google Scholar]
- Wideman R. F., Rhoads D. D., Erf G. F., Anthony N. B.. 2013. Pulmonary arterial hypertension (ascites syndrome) in broilers: A review. Poult. Sci. 92:64–83. [DOI] [PubMed] [Google Scholar]
- Wideman R. F., Wing T., Kirby Y. K., Forman M. F., Marson N., Tackett C. D., Ruiz-Feria C. A.. 1998. Evaluation of minimally invasive indices for predicting ascites susceptibility in three successive hatches of broilers exposed to cool temperatures. Poult. Sci. 77:1565–1573. [DOI] [PubMed] [Google Scholar]


