Skip to main content
PMC home page
Journal of Medical Entomology logoLink to Journal of Medical Entomology
. 2016 Oct 22;54(2):476–480. doi: 10.1093/jme/tjw175

Rickettsia parkeri and “Candidatus Rickettsia andeanae” in Questing Amblyomma maculatum (Acari: Ixodidae) From Mississippi

J K Lee 1, G M Moraru 1, J V Stokes 1, R W Wills 2, E Mitchell 1, E Unz 1, B Moore-Henderson 1, A B Harper 1, A S Varela-Stokes 1,3
PMCID: PMC5850715  PMID: 27773866

Abstract

Amblyomma maculatum Koch (Acari: Ixodidae), the primary vector for Rickettsia parkeri, may also be infected with a rickettsia of unknown pathogenicity, “Candidatus Rickettsia andeanae.” Infection rates with these rickettsiae vary geographically, and coinfected ticks have been reported. In this study, infection rates of R. parkeri and “Ca. R. andeanae” were evaluated, and rickettsial DNA levels quantified, in 335 questing adult A. maculatum collected in 2013 (n = 95), 2014 (n = 139), and 2015 (n = 101) from Oktibbeha County, MS. Overall infection rates of R. parkeri and “Ca. R. andeanae” were 28.7% and 9.3%, respectively, with three additional A. maculatum (0.9%) coinfected. While R. parkeri-infected ticks were detected all three years (34.7% in 2013; 13.7% in 2014; 43.6% in 2015), “Ca. R. andeanae” was not detected in 2013, and was detected at rates of 10.8% in 2014, and 15.8% in 2015. Interestingly, rickettsial DNA levels in singly-infected ticks were significantly lower in “Ca. R. andeanae”-infected ticks compared to R. parkeri-infected ticks (P < 0.0001). Thus, both infection rates and rickettsial DNA levels were higher for R. parkeri than “Ca. R. andeanae.” Infection rates of R. parkeri were also higher, and “Ca. R. andeanae” lower, here compared to A. maculatum reported previously in Kansas and Oklahoma. As we continue to monitor infection rates and levels, we anticipate that understanding temporal changes will improve our awareness of human risk for spotted fever rickettsioses. Further, these data may lead to additional studies to evaluate potential interactions among sympatric Rickettsia species in A. maculatum at the population level.

Keywords: Rickettsia parkeri, “Candidatus Rickettsia andeanae”, Amblyomma maculatum (Gulf Coast tick), Mississippi

The Gulf Coast tick, Amblyomma maculatumKoch (1844), is currently considered native throughout the Western Hemisphere, with North American populations mainly established along the Gulf and Atlantic Coasts of the United States (Teel et al. 2010). Of medical importance, A. maculatum is the major tick vector for Rickettsia parkeri, an agent of spotted fever group rickettsiosis, of which there are now at least 37 identified human cases in the United States (Paddock and Goddard 2015). Reported infection rates of R. parkeri in A. maculatum vary in the southern states and may reach up to 56% in some areas (Sumner et al. 2007, Paddock et al. 2010, Fornadel et al. 2011, Varela-Stokes et al. 2011, Wright et al. 2011, Ferrari et al. 2012, Florin et al. 2013, Budachetri et al. 2014, Nadolny et al. 2014, Pagac et al. 2014, Paddock and Goddard 2015, Mays et al. 2016). In addition to R. parkeri, A. maculatum may be infected with a spotted fever group rickettsia of unknown pathogenicity, “Candidatus Rickettsia andeanae,” first identified in A. maculatum and Ixodes boliviensis from Peru (Blair et al. 2004). In the southeastern United States, “Ca. R. andeanae”-infected questing A. maculatum were reported at infection rates ranging from 1–6.3% (Sumner et al. 2007, Paddock et al. 2010, Fornadel et al. 2011, Varela-Stokes et al. 2011, Wright et al. 2011, Ferrari et al. 2012, Jiang et al. 2012, Leydet and Liang 2013, Budachetri et al. 2014, Paddock and Goddard 2015, Mays et al. 2016). A high prevalence of “Ca. R. andeanae” was also recently reported in A. maculatum from Kansas and Oklahoma, whereas R. parkeri was absent (Paddock et al. 2015). Coinfections of A. maculatum with R. parkeri and “Ca. R. andeanae” are not common, but have been reported (Varela-Stokes et al. 2011, Ferrari et al. 2012, Leydet and Liang 2013, Budachetri et al. 2014), with one report documenting coinfections at a rate higher than expected by random chance (Ferrari et al. 2012).

Among the reports of rickettsiae in A. maculatum, rickettsial levels within infected ticks are not well-documented. In the present study, we evaluated infection rates of R. parkeri and “Ca. R. andeanae” and quantified rickettsial DNA levels in questing adult A. maculatum from central Mississippi, over a 3-yr period. By continuing to monitor infection rates and additionally document rickettsial levels of selected pathogenic and (presumably) nonpathogenic tick-associated rickettsiae in this region over time, we provide insight into natural maintenance of these organisms and potential changes in risk for pathogen exposure.

Materials and Methods

Amblyomma maculatum Collections and Assays

Adult questing A. maculatum were collected by flagging/dragging in May–September of 2013–2015 from four sites within Oktibbeha County, MS (Fig. 1). The 2013 A. maculatum samples were previously from another study (Lee et al. 2014). We identified A. maculatum in the laboratory based on a standard taxonomic key (Keirans and Litwak 1989) and kept them in a humidity chamber (saturated potassium nitrate, ∼93% humidity) until processing. To reduce external contaminants, we washed A. maculatum by vortexing 3 min in each of the following: 0.17% sodium hypochlorite, 0.5% benzalkonium chloride, 70% ethyl alcohol, and sterile phosphate buffered saline (pH 7.4). Ticks were bisected sagittally and genomic DNA extracted from individual halves using a DNeasy Blood and Tissue Kit (Qiagen, Limburg, Netherlands). The other tick halves were archived (−80 °C) and extracted DNA samples stored (−20°C) until testing.

Figure 1.

Figure 1.

Open in a new tab

Geographical location of A. maculatum collection site in Oktibbeha County, MS. Site points were based on geographical coordinates.

For quality control, DNA extracts were tested in a PCR assay to amplify a fragment of the tick mitochondrial 16S rRNA gene (Black and Piesman 1994). All tick extracts were positive by this assay, and subsequently screened for R. parkeri and “Ca. R. andeanae” DNA using a TaqMan multiplex quantitative (Q)PCR assay with Rickettsia-wide primers and species-specific probes. Primers and probes are listed in Table 1, with the exception that concentrations of both QrompB primers in initial screening were at 300 nM. Nontemplate and positive controls were included in each assay, and reactions tested on a Stratagene Mx3005P (Agilent Technologies, Santa Clara, CA). Extracts that were initially positive by QPCR were re-assayed to quantify rickettsiae by modifying the TaqMan multiplex QPCR to include TaqMan primers and probe for the A. maculatum macrophage migration inhibitory factor (MIF) gene (sequences kindly provided by E. Harris and K. Macaluso, Louisiana State University). In each multiplex QPCR assay, 3 µl sample DNA was mixed with Brilliant Multiplex Master Mix 2X (Agilent Technologies), ROX reference dye (30 nM), and probes and primers (Table 1) in a 25 µl reaction volume. We performed QPCR on a Stratagene Mx3005P with a two-step cycling profile consisting of 95˚C for 10 min followed by 40 cycles of 95˚C for 15 s and 60˚C for 1 min. All positive extracts were tested in duplicate and all assays included 10-fold dilutions (107 to 102) of plasmid template mixture combining plasmids constructed using R. parkeri GFPuv Oktibbeha strain, “Ca. R andeanae” and A. maculatum. Nontemplate (water) controls were included in each run for quality control. Only data from multiplex QPCR assays with efficiencies between 90% and 110% for all three targets, and R squared values above or equal to 0.985 were used for evaluating rickettsial levels. We calculated levels in each extract using the ratio of rompB copy number to tick MIF copy number, for each rickettsial species. An annual and overall index of coinfection was calculated (Ginsberg 2008) using numbers of A. maculatum determined positive for R. parkeri, “Ca. R. andeanae,” or both, by QPCR.

Table 1.

Primers and probes, with final concentrations, used in TaqMan Multiplex QPCR assay for quantification of rickettsial levels

Primer/probe name Sequence (5′ → 3′) Final concentration
QrompB_F AAGTGGTACTTCAACATGGG 400 nM
QrompB_R GCACCACCTTGGATTAAAG 400 nM
CaRa_probe_FAM ATCGCGGAAGGTGCTCAAGTTAATG 50 nM
Rp_probe_HEX ATTTTGGAAGGTGCGCAAGTTAATGC 400 nM
Amac MIF.18F CCAGGGCCTTCTCGATGT 300 nM
Amac MIF.99R CCATGCATTGCAAACC 300 nM
Amac MIF.63_Cy5 TGTTCTCCTTTGGACTCAGGCAGC 200 nM
Open in a new tab

Rickettsial ompB sequences used for design of primers and probes were GenBank accession numbers GU131157 and AF123717.

We confirmed all 2015 extracts that were positive by rompB multiplex QPCR for one Rickettsia sp. (n = 60) or both (n = 1) by sequencing rompA gene amplicons from species-specific PCR assays (Paddock et al. 2010, Varela-Stokes et al. 2011). PCR amplicons were purified (DNA Clean and Concentrator, Zymo Research, CA), bidirectionally sequenced (Eurofins MWG Operon, Huntsville, AL), and sequences aligned (ClustalX2) (Larkin et al. 2007). Consensus sequences were identified using BLAST (Basic Local Alignment Search Tool) analysis in the National Center for Biotechnology Information (NCBI) database.

Statistical Analyses

The occurrence of R. parkeri and “Ca. R. andeanae” infection in A. maculatum was assessed in separate logistic regression using PROC LOGISTIC in SAS for Windows 9.4 (SAS Institute, Inc., Cary, NC). Gender, year, and gender by year interactions were initially included as explanatory variables. The gender by year interaction was not significant for either outcome and was removed, with the models refit. Penalized maximum likelihood estimation was used for the “Ca. R. andeanae” models due to quasi-complete separation of data points because no “Ca. R. andeanae” positive ticks were collected in 2013. The effect of year and Rickettsia species on rickettsial levels was assessed by ANOVA using PROC MIXED in SAS for Windows 9.4. The two main effects and their interaction were initially included as explanatory variables in the model. The year by Rickettsia species interaction was not significant and was removed, with the model refit. Pair-wise comparisons of years were made with Tukey correction of p-values. Due to low sample size for coinfected ticks, a Wilocoxon Signed Rank test using PROC UNIVARIATE in SAS for Windows 9.4 was used to compare “Ca. R. andeanae” to R. parkeri levels. An alpha level of 0.05 was used to determine statistical significance for all analyses.

Results and Discussion

A total of 335 A. maculatum were collected between 2013 and 2015; no significant sex bias was observed in our population. Infection rates of R. parkeri and “Ca. R. andeanae” in A. maculatum varied annually, with overall rates of single infections at 28.7% and 9.3%, respectively (Table 2). The odds of detecting R. parkeri in 2014 were significantly lower compared to 2013 (OR 0.3; CI 0.156–0.567) and 2015 (OR 0.2; CI 0.110–0.383). In 2013, 33/95 (34/7%) of A. maculatum were positive for R. parkeri but “Ca. R. andeanae” was not detected. Not surprisingly, the odds of detecting “Ca. R. andeanae” in 2014 were significantly higher than in 2013 (OR 24.1; CI 1.435–404.8) and for 2015 compared to 2013 (OR 36.9; CI 2.196–618.649). There was no significant difference in infection rates based on A. maculatum gender (R. parkeri infection P = 0.9474; “Ca. R. andeanae” infection P = 0.6572). The overall coinfection rate was 0.9% (3/335 coinfected A. maculatum). The index of coinfection (IC) was calculated (Ginsberg 2008), with the IC between 0 and -11.9 among study years and an overall IC of -5.42, indicating fewer coinfected ticks than expected by chance alone. Rickettsial levels (calculated as the ratio of rickettsial ompB copy number to tick MIF copy number) in positive ticks, varied in singly infected ticks. The level of “Ca. R. andeanae” (6.76; SE 1.066) was significantly lower than R. parkeri (14.26; SE 0.584; P < 0.0001). Rickettsial levels were also significantly different between 2014 and 2013 (Adj P < 0.0001), and between 2015 and 2013 (Adj P < 0.0001), likely because no “Ca. R. andeanae”-infected tick was detected in 2013. However, there was no significant difference in rickettsial levels between 2014 and 2015 (Adj P = 0.9081). Finally, there was no significant difference in rickettsial levels between R. parkeri and “Ca. R. andeanae” in coinfected ticks (P = 1.0); however, there were only three coinfected ticks to evaluate.

Table 2.

Number of A. macluatum [male:female] positive for rickettsial DNA [male:female] out of total A. maculatum collected per site in Oktibbeha County, MS, over the 3-yr collection period

Site no. 2013
 2014
 2015
R. parkeri “Ca. R. andeanae” Coinfected R. parkeri “Ca. R. andeanae” Coinfected R. parkeri “Ca. R. andeanae” Coinfected
1 16 [6:10]/45 [18:27] 0 [0:0]/45 [18:27] 0 [0:0]/45 [18:27] 15 [9:6]/66 [35:31] 12 [4:8]/66 [35:31] 2 [1:1]/66 [35:31] 13 [7:6]/42[22:20] 5 [4:1]/42[22:20] 0 [0:0]/42[22:20]
2 17 [8:9]/50 [23:27] 0 [0:0]/50 [23:27] 0 [0:0]/50 [23:27] 2 [0:2]/10 [1:9] 0 [0:0]/10 [1:9] 0 [0:0]/10 [1:9] 0 [0:0]/1[0:1] 0 [0:0]/1[0:1] 0 [0:0]/1[0:1]
3 NSa NS NS NS NS NS 31[13:18]/58[24:34] 11[4:7]/58[24:34] 1[0:1]/58[24:34]
4 NS NS NS 2 [1:1]/63 [37:26] 3 [2:1]/63 [37:26] 0 [0:0]/63 [37:26] NS NS NS
Total 33 [14:19]/95 [41:54] 0 [0:0]/95 [41:54] 0 [0:0]/95 [41:54] 19 [10:9]/139 [73:66] 15 [6:9]/139 [73:66] 2 [1:1]/139 [73:66] 44 [20:24]/101[46:55] 16 [8:8]/101[46:55] 1 [0:1]/101[46:55]
Open in a new tab

Tick extracts initially positive by rompB QPCR were confirmed by rompA amplicon sequencing (2015 samples) and final QPCR analysis for rickettsial levels (2013–2015).

a

Not sampled.

For 2015 extracts positive only for R. parkeri by QPCR, 39/44 had consensus rompA sequences 100% identical to available R. parkeri (e.g., KF782320.1 and KC003476.1). Rickettsial ompA amplicons from all extracts positive for “Ca. R. andeanae” by initial QPCR (16/16) were also 100% identical to “Ca. R. andeanae” (e.g., KF179352.1 and KF030932.1). Of the five R. parkeri samples where a consensus sequence could not be resolved, one extract had one unambiguous sequence which demonstrated 99% identity with R. parkeri (e.g., KF782320.1 and KC003476.1). Two samples could not be confirmed by sequencing. For the remaining two samples, consensus sequences were 100% identical to multiple rickettsiae including R. parkeri (e.g. KP861344.1), an endosymbiont of A. maculatum (KP172268.1), and uncultured Rickettsia (e.g., JQ914775.1). We considered all 44 extracts positive for R. parkeri based on the two QPCR and specific rompA PCR assay results prior to sequencing. For R. parkeri and “Ca. R. andeanae”-specific rompA amplicons in the 2015 coinfected tick, a consensus sequence for the “Ca. R. andeanae” rompA amplicon was 100% identical to “Ca. R. andeanae”, whereas one unambiguous sequence direction for the R. parkeri rompA amplicon was 99% identical to R. parkeri.

Thus, the three-year infection rate for R. parkeri (28.7%) was within the range previously reported for southeastern A. maculatum (Sumner et al. 2007, Paddock et al. 2010, Fornadel et al. 2011, Varela-Stokes et al. 2011, Wright et al. 2011, Ferrari et al. 2012, Florin et al. 2013, Budachetri et al. 2014, Nadolny et al. 2014, Pagac et al. 2014, Paddock and Goddard 2015, Mays et al. 2016). However, it was higher than that previously reported for similar sites sampled in Mississippi; 19.1% of A. maculatum were singly infected with R. parkeri in the location labeled “North” reported by Ferrari et al. (2012). While infection rates for “Ca. R. andeanae” varied among study years, the overall infection rate of “Ca. R. andeanae” here (9.3%), was higher than the previously reported infection rates in the Southeast, and higher compared to the three-year rate (0%) reported for the “North” location by Ferrari et al. (Paddock et al. 2010, Varela-Stokes et al. 2011, Ferrari et al. 2012, Nadolny et al. 2014). Thus, both “Ca. R. andeanae” and R. parkeri rates were increased in the current study. This may reflect a combination of temporal changes in the natural maintenance of both rickettsiae due to abiotic and biotic factors, and random fluctuation in rates. Still, “Ca. R. andeanae” infection in our sampled A. maculatum was lower, and R. parkeri higher, to rates recently reported from populations in Kansas and Oklahoma (Paddock et al. 2015). While uncommon, A. maculatum coinfected with R. parkeri and “Ca. R. andeanae” have been reported (Varela-Stokes et al. 2011, Ferrari et al. 2012). In the current study, we detected 0.9% coinfected questing A. maculatum (3/335). The overall index of coinfection (IC) was −5.42, demonstrating that the coinfection rate was lower than expected by chance alone, in contrast to a previous study from Mississippi (Ferrari et al. 2012). In our study, infection rates of both R. parkeri and “Ca. R. andeanae” varied, although only two of the four sites within the county were sampled consistently over the three year period; some sites could not be resampled due to human alterations (e.g., construction). The most notable annual fluctuations were with infection rates of “Ca. R. andeanae,” which did not appear to be negatively correlated to R. parkeri infection rates.

Geographical differences in infection rates, particularly the absence of R. parkeri and overwhelming presence of Ca. R. andeanae” in A. maculatum from Kansas and Oklahoma suggest that rickettsial exclusion by transovarial interference may be occurring on a broader population scale (Paddock et al. 2015). Infrequent evidence of “Ca. R. andeanae” in A. maculatum has been reported where R. parkeri is frequently found in this tick vector (Florin et al. 2013, Nadolny et al. 2014, Pagac et al. 2014). We found that the mean rickettsial level for A. maculatum singly infected with R. parkeri was significantly higher than for A. maculatum singly infected with “Ca. R. andeanae.” This finding suggests that R. parkeri are maintained at a higher bacterial load than “Ca. R. andeanae” in questing A. maculatum. In contrast, the mean rickettsial levels for R. parkeri and “Ca. R. andeanae” in coinfected ticks were similar to each other and both low, compared to singly infected ticks. Using a nonparametric test for statistical analysis of these three ticks, we found no difference in rickettsial levels between the two rickettsial species. Considering the presence of “Ca. R. andeanae” and observed exclusion of R. parkeri in A. maculatum populations from Kansas and Oklahoma (Paddock et al. 2015), determining whether rickettsial levels in these populations vary from those detected here would contribute to a better understanding of geographical differences in A. maculatum-rickettsial maintenance. Of note, after completion of this study we were made aware that ticks from a laboratory-reared colony (Oklahoma State University Tick Rearing Facility; OSU) were released on part of Site 2 for an unrelated study by another group. Over the three years, 61 adult A. maculatum were collected from Site 2. No tick from this site was positive for “Ca. R. andeanae,” while 31.1% overall were positive for R parkeri. Given that we detected “Ca. R. andeanae” but not R. parkeri infection in PCR tests of OSU colony ticks in the past, we do not suspect that this release significantly impacted our study. The A. maculatum collected were more likely from the endemic population.

In summary, the current study demonstrated disparate mean rickettsial levels and infection rates for R. parkeri and “Ca. R. andeanae” in A. maculatum from Oktibbeha Co., MS. This is significant considering A. maculatum is a known and primary vector for the pathogen, R. parkeri, and is known to occasionally bite humans (Goddard 2002). Human cases have increased since the first case described in 2004, in part due to increased awareness and reporting (Goddard 2004, Paddock et al. 2004, Goddard and Varela-Stokes 2009, Paddock and Goddard 2015). Currently, the pathogenic potential for “Ca. R. andeanae” in A. maculatum and human or other vertebrate hosts is unknown. Understanding the relationship between R. parkeri and “Ca. R. andeanae” in the ticks, and monitoring infection rates and levels, will provide practical information for evaluating changes in human risk for R. parkeri rickettsiosis and the role of “Ca. R. andeanae” in affecting risk of spotted fever rickettsiosis.

Acknowledgments

We would like to thank Jerome Goddard, at Mississippi State University, for tick collection in his property, for helpful comments on the manuscript, and for continued general intellectual support of our research interests in tick-borne disease. We would also like to thank the Macaluso lab (Louisiana State University) for sharing their A. maculatum MIF gene primer and probe sequences. Funding was provided in part by the College of Veterinary Medicine, Mississippi State University. Our co-authors, E.M., E.U., B.M.-H. , were summer research experience veterinary students supported by an NIH T35 OD010432. The A.V.S. laboratory was supported in part by an NIH COBRE, P20GM103646, and NIH R15 1R15AI099928-01A1 during this study.

References

  1. Black W. C., Piesman J. 1994. Phylogeny of hard-and soft-tick taxa (Acari: Ixodida) based on mitochondrial 16S rDNA sequences. Proc. Natl. Acad. Sci. USA. 91: 10034–10038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Blair P. J., Jiang J., Schoeler G. B., Moron C., Anaya E., Cespedes M., Cruz C., Felices V., Guevara C., Mendoza L., et al. 2004. Characterization of spotted fever group rickettsiae in flea and tick specimens from northern Peru. J. Clin. Microbiol. 42: 4961–4967. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Budachetri K., Browning R. E., Adamson S. W., Dowd S. E., Chao C. C., Ching W. M., Karim S. 2014. An insight into the microbiome of the Amblyomma maculatum (Acari: Ixodidae). J. Med. Entomol. 51: 119–129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Ferrari F. A., Goddard J., Paddock C. D., Varela-Stokes A. S. 2012. Rickettsia parkeri and “Candidatus Rickettsia andeanae” in Gulf Coast ticks, Mississippi, USA. Emerg. Infect. Dis. 18: 1705–1707. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Florin D. A., Jiang J., Robbins R. G., Richards A. L. 2013. Infection of the gulf coast tick, Amblyomma maculatum (Acari: Ixodidae), with Rickettsia parkeri: First report from the State of Delaware. Syst. Appl. Acarol. 18: 27–29. [Google Scholar]
  6. Fornadel C. M., Zhang X., Smith J. D., Paddock C. D., Arias J. R., Norris D. E. 2011. High rates of Rickettsia parkeri infection in Gulf Coast ticks (Amblyomma maculatum) and identification of “Candidatus Rickettsia andeanae” from Fairfax County, Virginia. Vector Borne Zoonotic Dis. 11: 1535–1539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Ginsberg H. S. 2008. Potential effects of mixed infections in ticks on transmission dynamics of pathogens: Comparative analysis of published records. Exp. Appl. Acarol. 46: 29–41. [DOI] [PubMed] [Google Scholar]
  8. Goddard J. 2002. A ten-year study of tick biting in Mississippi: Implications for human disease transmission. J. Agromedicine 8: 25–32. [DOI] [PubMed] [Google Scholar]
  9. Goddard J. 2004. American Boutonneuse Fever: A new tick-borne rickettsiosis. Infect. Med. 21: 207–210. [Google Scholar]
  10. Goddard J., Varela-Stokes A. 2009. The discovery and pursuit of American Boutonneuse Fever: A new spotted fever group rickettsiosis. Midsouth Entomol. 2: 47–52. [Google Scholar]
  11. Jiang J., Stromdahl E. Y., Richards A. L. 2012. Detection of Rickettsia parkeri and “Candidatus Rickettsia andeanae” in Amblyomma maculatum Gulf Coast ticks collected from humans in the United States. Vector Borne Zoonotic Dis. 12: 175–182. [DOI] [PubMed] [Google Scholar]
  12. Keirans J. E., Litwak T. R. 1989. Pictorial key to the adults of hard ticks, family Ixodidae (Ixodida: Ixodoidea), east of the Mississippi River. J. Med. Entomol. 26: 435–448. [DOI] [PubMed] [Google Scholar]
  13. Koch C. L. 1844. Systematische ubersicht uber die Ordnung der Zecken. Arch. Naturgesch 10: 217–239. [Google Scholar]
  14. Larkin M. A., Blackshields G., Brown N. P., Chenna R., McGettigan P. A., McWilliam H., Valentin F., Wallace I. M., Wilm A., Lopez R. 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947–2948. [DOI] [PubMed] [Google Scholar]
  15. Lee J. K., Smith W. C., McIntosh C., Ferrari F. G., Moore-Henderson B., Varela-Stokes A. 2014. Detection of a Borrelia species in questing Gulf Coast ticks, Amblyomma maculatum. Ticks Tick Borne Dis. 5: 449–452. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Leydet B. F., Liang F. T. 2013. Detection of human bacterial pathogens in ticks collected from Louisiana black bears (Ursus americanus luteolus). Ticks Tick Borne Dis. 4: 191–196. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Mays S. E., Houston A. E., Trout Fryxell R. T. 2016. Specifying pathogen associations of Amblyomma maculatum (Acari: Ixodidae) in Western Tennessee. J. Med. Entomol. 53: 435–440. [DOI] [PubMed] [Google Scholar]
  18. Nadolny R. M., Wright C. L., Sonenshine D. E., Hynes W. L., Gaff H. D. 2014. Ticks and spotted fever group rickettsiae of southeastern Virginia. Ticks Tick Borne Dis. 5: 53–57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Paddock C. D., Sumner J. W., Comer J. A., Zaki S. R., Goldsmith C. S., Goddard J., McLellan S. L., Tamminga C. L., Ohl C. A. 2004. Rickettsia parkeri: A newly recognized cause of spotted fever rickettsiosis in the United States. Clin. Infect. Dis. 38: 805–811. [DOI] [PubMed] [Google Scholar]
  20. Paddock C. D., Fournier P. E., Sumner J. W., Goddard J., Elshenawy Y., Metcalfe M. G., Loftis A. D., Varela-Stokes A. 2010. Isolation of Rickettsia parkeri and identification of a novel spotted fever group Rickettsia sp. from Gulf Coast ticks (Amblyomma maculatum) in the United States. Appl. Environ. Microbiol. 76: 2689–2696. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Paddock C. D., Goddard J. 2015. The evolving medical and veterinary importance of the Gulf Coast tick (Acari: Ixodidae). J. Med. Entomol. 52: 230–252. [DOI] [PubMed] [Google Scholar]
  22. Paddock C. D., Denison A. M., Dryden M. W., Noden B. H., Lash R. R., Abdelghani S. S., Evans A. E., Kelly A. R., Hecht J. A., Karpathy S. E. 2015. High prevalence of “Candidatus Rickettsia andeanae” and apparent exclusion of Rickettsia parkeri in adult Amblyomma maculatum (Acari: Ixodidae) from Kansas and Oklahoma. Ticks Tick Borne Dis. 6: 297–302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Pagac B. B., Miller M. K., Mazzei M. C., Nielsen D. H., Jiang J., Richards A. L. 2014. Rickettsia parkeri and Rickettsia montanensis, Kentucky and Tennessee, USA. Emerg. Infect. Dis. 20: 1750–1752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Sumner J. W., Durden L. A., Goddard J., Stromdahl E. Y., Clark K. L., Reeves W. K., Paddock C. D. 2007. Gulf Coast ticks (Amblyomma maculatum) and Rickettsia parkeri, United States. Emerg. Infect. Dis. 13: 751–753. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Teel P. D., Ketchum H. R., Mock D. E., Wright R. E., Strey O. F. 2010. The gulf coast tick: A review of the life history, ecology, distribution, and emergence as an arthropod of medical and veterinary importance. J. Med. Entomol. 47: 707–722. [DOI] [PubMed] [Google Scholar]
  26. Varela-Stokes A. S., Paddock C. D., Engber B., Toliver M. 2011. Rickettsia parkeri in Amblyomma maculatum ticks, North Carolina, USA, 2009-2010. Emerg. Infect. Dis. 17: 2350–2353. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Wright C. L., Nadolny R. M., Jiang J., Richards A. L., Sonenshine D. E., Gaff H. D., Hynes W. L. 2011. Rickettsia parkeri in Gulf Coast Ticks, Southeastern Virginia, USA. Emerg. Infect. Dis. 17: 896–898. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Medical Entomology are provided here courtesy of Oxford University Press

RESOURCES