Skip to main content
Evidence-based Complementary and Alternative Medicine : eCAM logoLink to Evidence-based Complementary and Alternative Medicine : eCAM
. 2018 Mar 6;2018:6302748. doi: 10.1155/2018/6302748

Optimized Extract from Corylopsis coreana Uyeki (Hamamelidaceae) Flos Inhibits Osteoclast Differentiation

Yongjin Lee 1, Jung-Eun Kim 2, Kwang-Jin Kim 1, Seung-Sik Cho 2,, Young-Jin Son 1,
PMCID: PMC5859845  PMID: 29692856

Abstract

Osteoporosis is a metabolic disorder that decreases the stability against fractures of the spine, femur, and radius by weakening the strength and integrity of bones. Receptor activator of nuclear factor-kappa B ligand signaling ultimately activated nuclear factor-activated T cells c1, a major transcription factor for osteoclast formation. This study researched the effects of Corylopsis coreana (C. coreana) Uyeki flos extracts on the antiosteoclastic potential of macrophages and the phytochemicals contained therein. The alcoholic extract of C. coreana Uyeki flos inhibited the differentiation of osteoclast. We carried out the experiments of the pattern of differentiation of osteoclasts based on the alcoholic percentage of extracts. Among them, 80% alcoholic extract showed the highest inhibitory effect. The alcoholic extract was composed of phytochemicals such as bergenin, quercetin, and quercitrin. This extract inhibited not only mRNA expression levels of NFATc1, osteoclast-associated receptor (OSCAR), cathepsin K, and tartrate-resistant acid phosphatase (TRAP), but also the translational expression of NFATc1. The inhibitory effect for osteoclast differentiation of the alcoholic extract was confirmed using the resorption pit assay. This is the first scientific report of the antiosteoclastic effects of C. coreana Uyeki flos extract, which can be applied therapeutically for the treatment of osteoporosis.

1. Introduction

Osteoporosis is a metabolic disease in which the bone integrity and strength are weak due to qualitative changes in the bone microstructure, which decreases the stability against fractures of the spine, femur, and radius. In diseases, such as osteoporosis, the number of osteoclasts is increased resulting in a decrease in bone density. Moreover, in inflammatory conditions, for example, rheumatoid arthritis and periodontitis, osteoclast formation is activated with concomitant bone destruction. The differentiation of osteoclasts is regulated by receptor activator of nuclear factor-kappa B ligand (RANKL), a cytokine essential for the bone metabolism [1]. The interaction between RANK and RANKL activates the continuity of intracellular molecular phenomena directly, leading to osteoclastogenesis. The osteoclast differentiation pathway by RANKL includes NF-κB, mitogen-activated protein kinase (MAPK), including c-Jun N-terminal kinase (JNK), extracellular signal-regulated kinase (ERK), and p38 [2]. This signal transduction can interact with nuclear factor-activated T cells c1 (NFATc1), a master regulator of osteoclastogenesis, leading to translocation into the nucleus [3]. NFATc1, a member of the transcription factors NFAT family, is increased significantly during RANKL-induced osteoclastogenesis [4].

C. coreana Uyeki flos belongs to the Hamamelidaceae (witch hazel) family and is cultured as a medicinal plant in China and South Korea [5]. C. coreana Uyeki flos has been utilized as a traditional medicine to treat chills, nausea, dizziness, and heart pounding [5, 6] but there are few scientific reports of C. coreana Uyeki flos. In a previous study, some compounds from the leaves of C. coreana Uyeki flos were extracted and identified. It was discovered that they had antioxidative and antiproliferative components [5]. Recently, the authors identified flavonoids and isocoumarin in the flower extract of C. coreana Uyeki flos and reported their antimicrobial, antioxidant, and antihyperuricemic activity [7, 8]. On the other hand, to the best of the authors' knowledge, there is a paucity of reports on the antiosteoclastic activity of C. coreana Uyeki flos.

Therefore, this study examined the osteoclastic activity of the alcoholic extracts of C. coreana Uyeki flos and identified the active constituents responsible for the antiosteoclastic effects using the relevant in vitro systems. This study could provide a basic information for the complementary and alternative herbal medicines for the treatment of osteoporosis and its related diseases.

2. Materials and Methods

2.1. Plant Materials

Samples of C. coreana Uyeki flos were collected in May 2013 near Jogye Mountain, in Jeonnam Province, Korea. A voucher specimen (MNUCSS-CC-01) was deposited in Mokpo National University (Muan, Republic of Korea). The air-dried and powdered samples of C. coreana Uyeki flos (10 g) were extracted twice with diverse percentages of ethanol (100 mL) at RT for 3 days. After filtration, the resulting ethanol solution was evaporated, freeze-dried, and stored at −50°C. The crude extract was resuspended in ethanol and filtered using a 0.4 μm membrane filter. All samples were used for the optimization of extract and in vitro experiments.

2.2. Constituent Purification and Profiling by High-Performance Liquid Chromatography (HPLC)

The air-dried, powdered extract of C. coreana Uyeki flos was sonicated for 3 hrs with ethanol. After filtration, the ethanol was evaporated and suspended in distilled water and then defatted with an n-hexane, ratio of 1 : 1 (v/v). The aqueous layer was partitioned with ethyl acetate (2 × 200 mL). The evaporation residue (2 g) was subjected to flash silica gel chromatography, using an n-hexane : EtOAc solvent system (9 : 1~3 : 1), to afford 10 fractions. Fractions 2, 3, and 4 were subjected to further RP-C18 silica gel chromatography, using an acetonitrile : water (10 : 100) eluent system, to afford bergenin (BER), quercitrin (QCIT), and quercetin (QCT). The compounds were further purified by preparative thin layer column chromatography for analytically acceptable purity. Constituent-profiling of the C. coreana Uyeki flos samples by HPLC analysis was performed as previously described [8]. All analysis was conducted using an Alliance 2695 HPLC system (Waters; Millford, MA, USA) equipped with a photodiode array detector. The analytical column used was an Agilent Zorbax extended C18 column (5 μm, 150 mm × 5 mm) with a mobile phase consisting of solvents A (acetonitrile) and B (water containing 0.2% phosphoric acid) and employing gradient elution (from 10/90 to 100/0, v/v) at a flow rate of 0.8 mL/min. The column temperature was maintained at 25°C, and the detection wavelength was set to 350 nm for BER, QCT, and QCIT. The mobile phase was filtered through a 0.22 μm filter and degassed.

2.3. Cell Cultures and Osteoclast Differentiation

This study was conducted in strict accordance with the recommendations contained in the Standard Protocol for Animal Study of Sunchon National University. The protocol was approved by the Sunchon National University Institutional Animal Care and Use Committee (SCNU IACUC; Permission number SCNU IACUC 2016-07). All cells were cultured in a 37°C and 5% CO2 incubator. Bone marrow-derived macrophages (BMMs) were derived from unfractionated bone marrow cells (BMCs). The BMCs were isolated from the tibia and femur of 5-week-old male ICR mice (n = 2: Damool Science, KR) by flushing with α-minimum essential medium (α-MEM; Invitrogen Life Technologies, CA, USA) containing 100 U/mL penicillin/streptomycin (Invitrogen, CA, USA). The cells were incubated on a Petri dish in α-MEM supplemented with 10% fetal bovine serum (FBS; Invitrogen Life Technologies, CA, USA) and 100 U/mL penicillin/streptomycin (10%  α-MEM) with 30 ng/mL of the mouse recombinant macrophage colony-stimulating factor (M-CSF; PEPROTECH, NJ, USA). After 3 days, the cells attached to Petri dishes were obtained as BMMs. The BMMs were plated at a density of 1 × 104 cells/well in a 96-well tissue culture plate in 10%  α-MEM and cultured with 10 ng/mL of the mouse recombinant receptor activator of nuclear factor-κB ligand (RANKL; R&D Systems, MN, USA) and 30 ng/mL M-CSF for 4 days in the presence or absence of C. coreana Uyeki flos.

2.4. Tartrate-Resistant Acid Phosphatase (TRAP) Staining Assay

The cells were washed with PBS and fixed with 3.7% formalin for 5 min. After washing with PBS, the cells were permeabilized with 0.1% Triton X-100 for 10 min. And, then, they were washed, and stained for 10 min at 37°C in the dark with a TRAP solution containing Fast Garnet GBC, sodium nitrite, naphthol AS-BI phosphoric acid, acetate, and tartrate (Sigma-Aldrich, MO, USA). The TRAP+-MNCs (nuclei ≥ 3) were counted as mature osteoclasts.

2.5. Cytotoxicity Assay

The BMMs were cultured at a density of 1 × 104 cells/well on a 96-well plate in triplicate with M-CSF (30 ng/mL) and C. coreana Uyeki flos. The cell viability was evaluated using a CCK-8 kit (Dojindo Molecular Technologies, Japan) according to the manufacturer's protocol.

2.6. Real-Time PCR Analysis

The BMMs were plated at 3.5 × 104 cells/well in a 6-well plate and cultured with 10 ng/mL RANKL and 30 ng/mL M-CSF for 0, 1, 2, and 3 days in the presence or absence of C. coreana Uyeki flos. The primers for real-time PCR were designed (Table 1) using the Primer3 design program. The total RNAs were isolated with TRIzol reagent (Invitrogen, CA, USA), and 1 μg of RNAs was reverse-transcribed with the M-MLV cDNA Synthesis kit (Enzynomics, KR) according to the manufacturer's protocol. Quantitative PCR was accomplished using a TOPreal qPCR 2x PreMIX (Enzynomics, KR) and Real-Time PCR detection system (Bio-Rad, CA, USA). All tests were run in triplicate and normalized to the housekeeping gene GAPDH.

Table 1.

Primer sequences used in this study.

Gene of interest Direction Primer sequence (5′–3′)
TRAP Sense GATGACTTTGCCAGTCAGCA
Antisense ACATAGCCCACACCGTTCTC
NFATc1 Sense GGGTCAGTGTGACCGAAGAT
Antisense GGAAGTCAGAAGTGGGTGGA
Cathepsin K Sense GGCCAACTCAAGAAGAAAAC
Antisense GTGCTTGCTTCCCTTCTGG
OSCAR Sense CTGCTGGTAACGGATCAGCTC
Antisense CCAAGGAGCCAGAACCTT
GAPDH Sense AACTTTGGCATTGTGGAAGG
Antisense ACACATTGGGGGTAGGAACA

2.7. Western Blot Analysis

The cells were washed with phosphate-buffer saline (PBS) and homogenized with a lysis buffer containing 20 mM Tris-HCl, pH 7.5, 1% v/v Igepal CA-630, 150 mM NaCl, 1 mM sodium fluoride (Sigma, USA), 1 mM sodium orthovanadate (Sigma, USA), 0.5 mM phenylmethylsulfonyl fluoride (Sigma, USA), 1 mM DTT, 2 mM EDTA, 10 μg/mL aprotinin (Sigma, USA), 5 μg/mL leupeptin (Sigma, USA), and 2 μg/mL pepstatin (Sigma, USA). The lysates were centrifuged at 12,000g for 15 min at 4°C. The protein concentration was determined using a DC Protein Assay (Bio-Rad, CA, USA). The protein extracts were subjected to 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (20 μg per lane) and transferred to a polyvinylidene difluoride (PVDF) membrane (Millipore, USA). After blocking with 5% skim milk the membranes were incubated overnight at 4°C with the primary antibodies (NFATc1 and actin antibodies from Santa Cruz Biotechnology, CA, USA). After washing, the membranes were incubated with the horseradish peroxidase- (HRP-) conjugated secondary antibody (Santa Cruz Biotechnology, CA, USA) for 2 hrs at room temperature. The antibody blots were developed using a MicroChemi 4.2 (DNR Bio-Imaging System, Jerusalem, Israel) and Super-Signal West Pico/Femto Chemiluminescent Substrate (Pierce Chemical, IL, USA).

2.8. Resorption Pit Analysis

To analyze the surface for pit formation, the BMMs were plated at 6 × 106 cells/well in a 24-well tissue culture plate and cultured with the conditions of 30 ng/mL M-CSF in a negative/positive (without/with 10 ng/mL RANKL) and the presence (10 and 30 μg/mL) of 80% C. coreana Uyeki flos for 4 days. The media were discarded and 100 μL of 10% bleach solution was changed on day 4. And cells were incubated for 5 min at RT. The plate was washed twice with distilled water and dried at RT for about 4 hrs. The generated pits were observed using a microscope at 100x magnification.

2.9. Statistical Analysis

The proteins and RNA from C. coreana Uyeki flos and control groups were analyzed to determine the differences in the levels of expression using Student's t-test. Probability (P) values less than 0.05 were considered significant ( P < 0.05, ∗∗ P < 0.01, and ∗∗∗ P < 0.001).

3. Results

3.1. C. coreana Uyeki Flos Inhibits the Differentiation of BMMs into Osteoclasts

To examine the effects of C. coreana Uyeki flos on RANKL-induced osteoclast differentiation, we performed in vitro osteoclast differentiation. The BMMs were treated with the vehicle (0.1% DMSO) as a control and the C. coreana Uyeki flos extract and then mixed with 30 ng/mL M-CSF and 10 ng/mL RANKL for 4 days. We conducted the TRAP staining to determine the most effective alcohol concentrations; the inhibitory effect of osteoclastogenesis was highest with 80% alcohol extract (Figure 1(a)). We performed the experiment on the optimal amounts of samples to inhibit osteoclast differentiation. The 80% extract of C. coreana Uyeki flos at a concentration above 10 μg/mL inhibited the osteoclast differentiation. Its inhibitory effect appeared as the plateau above 30 μg/mL (Figures 1(b) and 2(a)). Moreover, the 80% extract of C. coreana Uyeki flos at a concentration above 10 μg/mL inhibited the differentiation of TRAP+-osteoclasts. The number of TRAP+-MNCs (nuclei ≥ 3) was decreased dose-dependently by C. coreana Uyeki flos (Figure 2(b)).

Figure 1.

Figure 1

Osteoclast differentiation was inhibited by C. coreana Uyeki flos extracts. BMMs were cultured for 4 days in 0.1% DMSO (control vehicle) or the concentration 30 μg/ml of C. coreana Uyeki flos extract with RANKL (10 ng/mL) and M-CSF (30 ng/ml). The inhibitive patterns of osteoclast differentiation based on the alcoholic percentage of extracts (a). The inhibitive patterns of osteoclast differentiation based on the concentration of the 80% alcoholic extract of C. coreana Uyeki flos (b).

Figure 2.

Figure 2

RANKL-mediated osteoclastogenesis was suppressed by C. coreana Uyeki flos extracts, and the extracts had no cytotoxic effect. (a) BMMs were cultured for 4 days in 0.1% DMSO (control vehicle) or the indicated concentrations of C. coreana Uyeki flos extract with RANKL (10 ng/mL) and M-CSF (30 ng/ml). Multinucleated cells were fixed (3.7% formalin), permeabilized (0.1% Triton X-100), and stained with the TRAP solution. (b) Mature TRAP-positive multinucleated osteoclasts (MNCs) were photographed under an optical microscope. TRAP-positive MNCs (nuclear number > 3) were counted. ∗∗ P < 0.01; ∗∗∗ P < 0.001. (c) The effect of C. coreana Uyeki flos extracts on the viability of BMMs was measured by the CCK-8 assay.

3.2. C. coreana Uyeki Flos Had No Cytotoxic Effect

The toxic effects of C. coreana Uyeki flos on the BMMs were identified. The BMMs were incubated with C. coreana Uyeki flos-treated medium containing 30 ng/mL M-CSF for 3 days and the cell viability was measured by the CCK-8 kit (Figure 2(c)). C. coreana Uyeki flos at concentrations less than 30 μg/mL showed no cytotoxicity to the BMMs.

3.3. Main Components Identified from the 80% Alcoholic Extracts

Table 2 listed total flavonoids, phenolics, and the contents of active constituents of phytochemicals. The 80% alcoholic extract of C. coreana Uyeki flos was composed of 269 mg of total phenolics, 16 mg of total flavonoids, and some phytochemicals, such as bergenin (BER), quercetin (QCT), and quercitrin (QCIT). The contents of BER, QCT, and QCIT were 17.01, 1.50, and 0.05% (w/w), respectively, in the 80% alcoholic extract.

Table 2.

Total flavonoids, phenolics, and contents of active constituents of the main phytochemicals identified from the 80% ethanolic extract of C. coreana Uyeki flos (n = 5).

Constituent Content
Total flavonoids 16.43 ± 0.09 (mg/g eq.quercetin)
Total phenolics 269.37 ± 98.72 (mg/g eq.gallic acid)
Bergenin 17.01 ± 0.08% (w/w)
Quercetin 1.5 ± 0.007% (w/w)
Quercitrin 0.05 ± 0.002% (w/w)

3.4. C. coreana Uyeki Flos Suppresses RANKL-Induced Gene Expression

Real-time PCR analysis was performed to confirm the effects of C. coreana Uyeki flos on osteoclast formation and the expression of transcription factors and osteoclast-specific markers. C. coreana Uyeki flos reacted with RANKL and inhibited the mRNA expression of OSCAR and NFATc1, which are important transcription factors involved in osteoclast differentiation (Figures 3(a) and 3(b)). In addition, the mRNA expression levels of cathepsin K and TRAP involved in NFATc1 expression were inhibited significantly in osteoclast differentiation (Figures 3(c) and 3(d)).

Figure 3.

Figure 3

Effect of C. coreana Uyeki flos extracts on RANKL induced the mRNA expressions of osteoclastic-specific genes. The BMMs were pretreated with vehicle (0.1% DMSO) or C. coreana Uyeki flos extracts (30 μg/mL) for 1 hr and then treated with RANKL (10 ng/mL) and M-CSF (30 ng/mL) for the designated time periods. The total RNA was extracted using TRIzol reagent, and mRNA expression levels of NFATc1, OSCAR, Cathepsin K, and TRAP were measured by real-time PCR. The internal control was used with GAPDH. P < 0.05; ∗∗ P < 0.01; ∗∗∗ P < 0.001.

3.5. C. coreana Uyeki Flos Suppresses RANKL-Induced Protein Expression of NFATc1

The effect of C. coreana Uyeki flos on the protein level of NFATc1, a key regulator of osteoclast differentiation, was determined by western blotting. RANKL increased the protein expression of NFATc1 dramatically over time, but the level of NFATc1 protein expression was reduced significantly after exposure to C. coreana Uyeki flos (Figure 4). This result suggested that C. coreana Uyeki flos inhibited the protein expression of NFATc1, which is key element in the osteoclast formation process.

Figure 4.

Figure 4

Effect of C. coreana Uyeki flos extracts on the translational expression of an osteoclast-specific transcription factor, NFATc1. BMMs were pretreated with vehicle (0.1% DMSO) or C. coreana Uyeki flos extracts (30 μg/mL) for 1 hr prior to RANKL (10 ng/mL) and M-CSF (30 ng/mL) treatment at the designated time periods. β-Actin was used as the internal control.

3.6. C. coreana Uyeki Flos Suppresses RANKL-Induced Resorptive Activity

To confirm the inhibitory activity of the alcoholic extract of C. coreana Uyeki flos in osteoclast differentiation, we performed the resorption pit assay that can resorb the mineralization matrix and indicate the ability to form resorption pits on the surface. This experiment showed a lot of pits produced by human osteoclast precursor cells on the Corning Osteo Assay Surface in a positive well, compared with a negative well (Figures 5(a) and 5(b)). It was confirmed that the Corning Osteo Assay Surface was a good substrate for the analysis of osteoclast functional activity. When the alcoholic extract of C. coreana Uyeki flos was added, the number of resorptive pits was decreased in proportion to the adding amounts of the extract (Figures 5(c) and 5(d)). This result demonstrated that the alcoholic extract of C. coreana Uyeki flos inhibited the resorptive activity of osteoclast induced by RANKL.

Figure 5.

Figure 5

Resorption pit assay for osteoclast. The BMMs were plated at 6 × 106 cells/well in a 24-well tissue culture plate and cultured with the conditions of 30 ng/mL M-CSF in a negative/positive (without/with 10 ng/mL RANKL) ((a) and (b), resp.) and the presence (10 and 30 μg/mL, (c) and (d), resp.) of 80% C. coreana Uyeki flos for 4 days.

4. Discussion

Imbalances between osteoblasts and osteoclasts induced by various factors cause excessive bone resorption, which is particularly characteristic of osteoporosis. In the bone marrow, osteoclastic bone cells differentiate from hematopoietic stem cells [9, 10]. Osteoclastic cells are often differentiated in vitro when BMMs are treated with RANKL and M-CSF [11]. Activation of the RANKL-induced NF-kB and MAPK pathways is an important mechanism for osteoclastogenesis [1214]. In this study, the alcoholic extracts derived from C. coreana Uyeki flos inhibited osteoclast differentiation from the BMMs and downregulated the expression of the marker genes and involved protein by blocking the RANKL-induced signaling pathway [15]. In addition, we confirmed that the osteoclast suppressed by C. coreana Uyeki flos had a resorptive activity using the resorption pit assay. These results suggested that C. coreana Uyeki flos could be used as a therapeutic agent to inhibit bone breakdown in osteolytic bone diseases such as osteoporosis.

A number of flavonoids and phenolic compounds possess antiosteoclastic activity [16]. Therefore, the ethanol extraction process was optimized with respect to the total flavonoids and total phenolics. In a previous study, the 80% alcoholic extract showed the optimal flavonoid and phenolic content [7, 8]. Therefore, according to the results of a previous study and the findings of the current study, the 80% alcoholic extract was selected for further in vitro studies. A previous study showed that BER, QCT, and QCIT were the main bioactive phytochemicals identified from C. coreana Uyeki flos [7]. The 80% alcoholic extract exhibited the highest antiosteoclastic activity among all extracts examined (Figures 1 and 2). Therefore, these constituents were analyzed in the 80% alcoholic extract prepared in the present study. BER was one of the major compounds in the 80% alcoholic extract of C. coreana Uyeki flos. Nazir et al. reported that BER inhibits the formation of proinflammatory helper T cell type 1 cytokines (TNF-α, IFN-γ, and IL-2), while it potentiates the anti-inflammatory helper T cell type 2 cytokines (IL-5 and IL-4) in the arthritic mice model [17]. QCT and QCIT appear to be important active compounds in the 80% alcoholic extract. Oliveira et al. reported that QCT did not affect the cell viability and decreased osteoclast formation compared with a control and downregulated NF-κB pathway. They suggested that QCT might be inhibitor of osteoclast differentiation under inflammatory conditions (LPS-induced) through attenuation of NF-κB activation [18]. Previous studies have reported that QCT increased bone formation marker, such as osteocalcin. Derakhshanian et al. suggested that quercetin prevented the glucocorticoid-induced osteoporosis by its bone enhancing effect [19]. Therefore, QCT is a potential substance in the extract of C. coreana that induces the activity of antiosteoclast and proosteoblast. The antiosteoclastic activity of QCT by osteoclast differentiation in vitro assay in our lab (data not shown) was confirmed. Satué et al. reported that QCIT promotes osteoblastogenesis in MC3T3-E1 cells and inhibits osteoclast differentiation in RAW264.7 cells, highlighting the positive effect of QCIT on the prevention of osteoporosis [20].

Several proteins are involved in the functioning of osteoclast differentiation. Some of the important proteins were analyzed by real-time qPCR. The OSCAR presents a costimulatory receptor that is important for osteoclast differentiation and is involved in the activation of NFATc1 and macrophage immune cell regulators [21]. Therefore, OSCAR is associated with osteoporosis and rheumatoid arthritis and may trigger their onset mechanism [22, 23]. Cathepsin K is expressed mainly in osteoclasts and acts as a lysosomal cysteine protease [24]. The protein also plays a significant role in degrading the organic composition of bone (predominantly Type I collagen) [25]. Cathepsin K plays a significant role in bone resorptive mechanism. Odanacatib (ODN), an inhibitor of cathepsin K, is currently being developed as a treatment for osteoporosis [26]. TRAP is expressed strongly in osteoclastic cell and induces osteoclast differentiation [27, 28]. TRAP is involved in osteoclast migration to the spot of bone resorption and begins osteoclast differentiation [29]. In this study, TRAP, OSCAR, and cathepsin K, which are important mediators of osteoclast differentiation, were inhibited by the treatment with C. coreana Uyeki flos.

Interestingly, unlike the expression pattern of increasing expression of NFATc1 mRNA in the presence of RANKL until day 3, the level of translational expression of NFATc1 peaked at day 2 and rapidly decreased to baseline by day 3. Because of the nuclear import of these proteins in the presence of RANKL, the expression level of NFATc1 protein was decreased during late-stage osteoclast differentiation by an auto-feedback system of NFATc1 but the mRNA expression level of NFATc1 is maintained until the last stage of osteoclastogenesis [30].

5. Conclusions

In the present study, the alcoholic extracts of C. coreana Uyeki flos were prepared, and the ethanol extraction process was optimized with respect to the total flavonoid, total phenolic content, contents of active compounds, and antiosteoclastic activity. The in vitro study showed that the optimized 80% alcoholic extract could inhibit osteoclast differentiation significantly at a concentration of 30 μg/mL. In addition, the osteoclast inhibited by C. coreana Uyeki flos had a resorptive activity; that is, the resorptive activity was suppressed by the extract of C. coreana Uyeki flos. The extract of C. coreana Uyeki flos was analyzed by HPLC and its contents were identified. In vitro study showed that the antiosteoclastic activity of the extract was caused by total phenolics, flavonoids, and some phytochemicals, such as QCT and QCIT, synergistically. This paper is the first scientific report of the antiosteoclastic activity of C. coreana Uyeki flos extracts, highlighting the feasibility of the present herbal medicine for the treatment of osteoporosis.

Acknowledgments

This study was supported by Grants from National Research Foundation of Korea (NRF) (2016R1A6A3A11930984 and 2017R1C1B5015187) and the Forest Science & Technology Projects (Project no. 2017024A00-1720-BA01) by Korea Forest Service.

Contributor Information

Seung-Sik Cho, Email: sscho@mokpo.ac.kr.

Young-Jin Son, Email: sony@sunchon.ac.kr.

Conflicts of Interest

The authors declare that there are no conflicts of interest.

References

  • 1.Boyle W. J., Simonet W. S., Lacey D. L. Osteoclast differentiation and activation. Nature. 2003;423(6937):337–342. doi: 10.1038/nature01658. [DOI] [PubMed] [Google Scholar]
  • 2.Baud'huin M., Duplomb L., Ruiz Velasco C., Fortun Y., Heymann D., Padrines M. Key roles of the OPG-RANK-RANKL system in bone oncology. Expert Review of Anticancer Therapy. 2007;7(2):221–232. doi: 10.1586/14737140.7.2.221. [DOI] [PubMed] [Google Scholar]
  • 3.Takayanagi H. The role of NFAT in osteoclast formation. Annals of the New York Academy of Sciences. 2007;1116:227–237. doi: 10.1196/annals.1402.071. [DOI] [PubMed] [Google Scholar]
  • 4.Takayanagi H., Kim S., Koga T., et al. Induction and activation of the transcription factor NFATc1 (NFAT2) integrate RANKL signaling in terminal differentiation of osteoclasts. Developmental Cell. 2002;3(6):889–901. doi: 10.1016/S1534-5807(02)00369-6. [DOI] [PubMed] [Google Scholar]
  • 5.Kim M. H., Ha S. Y., Oh M. H., Kim H. H., Kim S. R., Lee M. W. Anti-oxidative and anti-proliferative activity on human prostate cancer cells lines of the phenolic compounds from Corylopsis coreana Uyeki. Molecules. 2013;18(5):4876–4886. doi: 10.3390/molecules18054876. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Wang H., Provan G. J., Helliwell K. Determination of hamamelitannin, catechins and gallic acid in witch hazel bark, twig and leaf by HPLC. Journal of Pharmaceutical and Biomedical Analysis. 2003;33(4):539–544. doi: 10.1016/S0731-7085(03)00303-0. [DOI] [PubMed] [Google Scholar]
  • 7.Seo J., Kim J., Shim J., et al. HPLC analysis, optimization of extraction conditions and biological evaluation of Corylopsis coreana uyeki flos. Molecules. 2016;21(1):p. 94. doi: 10.3390/molecules21010094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Yoon I.-S., Park D.-H., Ki S.-H., Cho S.-S. Effects of extracts from Corylopsis coreana Uyeki (Hamamelidaceae) flos on xanthine oxidase activity and hyperuricemia. Journal of Pharmacy and Pharmacology. 2016;68(12):1597–1603. doi: 10.1111/jphp.12626. [DOI] [PubMed] [Google Scholar]
  • 9.Yin T., Li L. The stem cell niches in bone. The Journal of Clinical Investigation. 2006;116(5):1195–1201. doi: 10.1172/JCI28568. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Mansour A., Abou-Ezzi G., Sitnicka E., Jacobsen S. E. W., Wakkach A., Blin-Wakkach C. Osteoclasts promote the formation of hematopoietic stem cell niches in the bone marrow. The Journal of Experimental Medicine. 2012;209(3):537–549. doi: 10.1084/jem.20110994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Li J., Zeng L., Xie J., et al. Inhibition of Osteoclastogenesis and Bone Resorption in vitro and in vivo by a prenylflavonoid xanthohumol from hops. Scientific Reports. 2015;5 doi: 10.1038/srep17605.17605 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Zheng H., Yu X., Collin-Osdoby P., Osdoby P. RANKL stimulates inducible nitric-oxide synthase expression and nitric oxide production in developing osteoclasts: An autocrine negative feedback mechanism triggered by RANKL-induced interferon-β via NF-κB that restrains osteoclastogenesis and bone resorption. The Journal of Biological Chemistry. 2006;281(23):15809–15820. doi: 10.1074/jbc.M513225200. [DOI] [PubMed] [Google Scholar]
  • 13.Matsumoto M., Sudo T., Maruyama M., Osada H., Tsujimoto M. Activation of p38 mitogen-activated protein kinase is crucial in osteoclastogenesis induced by tumor necrosis factor. FEBS Letters. 2000;486(1):23–28. doi: 10.1016/S0014-5793(00)02231-6. [DOI] [PubMed] [Google Scholar]
  • 14.Ikeda F., Nishimura R., Matsubara T., et al. Critical roles of c-Jun signaling in regulation of NFAT family and RANKL-requlated osteoclast differentiation. The Journal of Clinical Investigation. 2004;114(4):475–484. doi: 10.1172/JCI200419657. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Choe J.-Y., Kim S.-K. Melittin inhibits osteoclast formation through the downregulation of the RANKL-RANK signaling pathway and the inhibition of interleukin-1β in murine macrophages. International Journal of Molecular Medicine. 2017;39(3):539–548. doi: 10.3892/ijmm.2017.2876. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.An J., Yang H., Zhang Q., et al. Natural products for treatment of osteoporosis: the effects and mechanisms on promoting osteoblast-mediated bone formation. Life Sciences. 2016;147:46–58. doi: 10.1016/j.lfs.2016.01.024. [DOI] [PubMed] [Google Scholar]
  • 17.Nazir N., Koul S., Qurishi M. A., et al. Immunomodulatory effect of bergenin and norbergenin against adjuvant-induced arthritis—a flow cytometric study. Journal of Ethnopharmacology. 2007;112(2):401–405. doi: 10.1016/j.jep.2007.02.023. [DOI] [PubMed] [Google Scholar]
  • 18.Oliveira T., Figueiredo C. A., Brito C., et al. Allium cepa L. and quercetin inhibit RANKL/ porphyromonas gingivalis LPS-induced osteoclastogenesis by downregulating NF-κB signaling pathway. Evidence-Based Complementary and Alternative Medicine. 2015;2015:11. doi: 10.1155/2015/704781.704781 [DOI] [Google Scholar]
  • 19.Derakhshanian H., Djalali M., Djazayery A., et al. Quercetin prevents experimental glucocorticoid-induced osteoporosis: a comparative study with alendronate. Canadian Journal of Physiology and Pharmacology. 2013;91(5):380–385. doi: 10.1139/cjpp-2012-0190. [DOI] [PubMed] [Google Scholar]
  • 20.Satué M., del Mar Arriero M., Monjo M., Ramis J. M. Quercitrin and taxifolin stimulate osteoblast differentiation in MC3T3-E1 cells and inhibit osteoclastogenesis in RAW 264.7 cells. Biochemical Pharmacology. 2013;86(10):1476–1486. doi: 10.1016/j.bcp.2013.09.009. [DOI] [PubMed] [Google Scholar]
  • 21.Koga T., Inui M., Inoue K., et al. Costimulatory signals mediated by the ITAM motif cooperate with RANKL for bone homeostasis. Nature. 2004;428(6984):758–763. doi: 10.1038/nature02444. [DOI] [PubMed] [Google Scholar]
  • 22.Hofbauer L. C., Schoppet M. Clinical implications of the osteoprotegerin/RANKL/RANK system for bone and vascular diseases. The Journal of the American Medical Association. 2004;292(4):490–495. doi: 10.1001/jama.292.4.490. [DOI] [PubMed] [Google Scholar]
  • 23.Weiss J. M., Renkl A. C., Maier C. S., et al. Osteopontin is involved in the initiation of cutaneous contact hypersensitivity by inducing Langerhans and dendritic cell migration to lymph nodes. The Journal of Experimental Medicine. 2001;194(9):1219–1229. doi: 10.1084/jem.194.9.1219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Bromme D., Okamoto K. Human Cathepsin 02, a novel cysteine protease highly expressed in osteoclastomas and ovary molecular cloning, sequencing and tissue distribution. Biological Chemistry Hoppe-Seyler. 1995;376(6):379–384. doi: 10.1515/bchm3.1995.376.6.379. [DOI] [PubMed] [Google Scholar]
  • 25.Kafienah W., Brömme D., Buttle D. J., Croucher L. J., Hollander A. P. Human cathepsin K cleaves native type I and II collagens at the N-terminal end of the triple helix. Biochemical Journal. 1998;331(part 3):727–732. doi: 10.1042/bj3310727. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Boonen S., Rosenberg E., Claessens F., Vanderschueren D., Papapoulos S. Inhibition of cathepsin K for treatment of osteoporosis. Current Osteoporosis Reports. 2012;10(1):73–79. doi: 10.1007/s11914-011-0085-9. [DOI] [PubMed] [Google Scholar]
  • 27.Sapkota M., Li L., Choi H., Gerwick W. H., Soh Y. Bromo-honaucin A inhibits osteoclastogenic differentiation in RAW 264.7 cells via Akt and ERK signaling pathways. European Journal of Pharmacology. 2015;769:100–109. doi: 10.1016/j.ejphar.2015.11.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Otero J. E., Dai S., Alhawagri M. A., Darwech I., Abu-Amer Y. IKKβ activation is sufficient for RANK-independent osteoclast differentiation and osteolysis. Journal of Bone and Mineral Research. 2010;25(6):1282–1294. doi: 10.1002/jbmr.4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Sheu T.-J., Schwarz E. M., Martinez D. A., et al. A phage display technique identifies a novel regulator of cell differentiation. The Journal of Biological Chemistry. 2003;278(1):438–443. doi: 10.1074/jbc.M208292200. [DOI] [PubMed] [Google Scholar]
  • 30.Kim J. H., Kim K., Jin H. M., et al. Negative feedback control of osteoclast formation through ubiquitin-mediated down-regulation of NFATc1. The Journal of Biological Chemistry. 2010;285(8):5224–5231. doi: 10.1074/jbc.M109.042812. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Evidence-based Complementary and Alternative Medicine : eCAM are provided here courtesy of Wiley

RESOURCES