Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2018 Mar 21;8:4981. doi: 10.1038/s41598-018-23289-3

The transcriptional profiles and functional implications of long non-coding RNAs in the unfolded protein response

Hongyang Quan 1,2,#, Qianqian Fan 1,3,#, Chuang Li 1,#, Yan-ying Wang 1, Lin Wang 1,✉
PMCID: PMC5862980  PMID: 29563563

Abstract

The unfolded protein response (UPR) is activated, when the folding capacity is compromised in the endoplasmic reticulum (ER). To date, most studies focused on the coding genes and microRNAs in UPR. Other non-coding RNAs affected by UPR and their roles in UPR have not been systematically studied. Long noncoding RNAs (lncRNAs) are increasingly recognized as powerful epigenetic regulators. In this study, we transcriptomically profiled the lncRNAs and mRNAs from mouse embryonic fibroblasts under ER stress, and identified many differentially expressed lncRNAs and mRNAs. Genomic location and mRNA-lncRNA co-expression analyses predicted a number of lncRNAs, which potentially regulate the expression of UPR genes. In particular, FR229754, an exonic sense lncRNA, is significantly up-regulated in UPR. FR229754 overlaps with Sel1l, and their expressions correlated with each other. Sel1l is involved in the ER-associated protein degradation. Silencing of FR229754 did not much affect the expression of Sel1l, but markedly reduced the levels of BiP/GRP78/Hspa5, a major ER chaperon up-regulated in UPR. Probing with pathway-specific inhibitors showed that up-regulation of FR229754 and Sel1 depended on the activation of PERK. Together, our study identified a number of candidate lncRNAs and paved the way for future characterization of their functions in UPR.

Introduction

In eukaryotic cells, the endoplasmic reticulum (ER) is a major organelle that the secretory and membrane proteins enter the secretory pathway to fold, modify and mature. Environmental, physiological and pathophysiological conditions may alter the flux of proteins into the ER and exceed its folding capacity. The resulted accumulation of unfolded proteins activates multiple adaptive cellular processes, which are collectively known as ER stress response and include the unfolded protein response (UPR)1. UPR originally protects the cells to survive the stress insult, and could commit the cells to apoptosis, if the adaptive responses fail to restore the ER proteostasis.

In mammalian cells, UPR encompasses three branches, namely the inositol-requiring protein-1α (IRE1α), activating transcription factor-6α (ATF6α) and protein kinase RNA (PKR)-like ER kinase (PERK)2,3. In the unstressed cells, IRE1α, ATF6α and PERK are bound to BiP/GRP78/Hspa5, a major chaperon in the ER lumen. Upon ER stress, BiP binds to the unfolded proteins accumulated in the ER lumen and dissociates from the three UPR sensors. IRE1α, ATF6α and PERK are then activated by a series of events, including dimerization, phosphorylation, endonuclease splicing, ER-Golgi trafficking and proteolytic processing, and generate three respective downstream transcription factors, namely X-box binding protein 1(XBP1), activating transcription factor 4 (ATF4) and ATF6α. XBP1, ATF4 and ATF6α signal the nucleus to increase the ER chaperon expression to assist protein folding, the phospholipid synthesis to expand the ER, and the ER-associated protein degradation (ERAD) to remove the unfolded proteins through the ubiquitin proteasome system2–4.

UPR is regulated by multiple cellular mechanisms including microRNAs. Dozens of microRNAs are differentially expressed after the treatment with ER stress inducers, such as tunicamycin and thapsigargin. Several differentially expressed microRNAs also function as modulators of UPR. For example, miR-30c-2* is up-regulated in UPR by PERK, and in turn attenuates UPR by decreasing XBP15. MiR-211, which is also induced after PERK activation, represses the CHOP transcription by targeting its 5′ untranslated region6. Some microRNAs can affect the expression of UPR-unrelated proteins. For example, miR-708, which is transcribed from an intron of a CHOP-regulated gene, Odz4, controls the expression of rhodopsin in retina and prevents it from entering the ER7.

In the past decade, long noncoding RNAs (lncRNAs) have emerged as another class of non-protein coding RNAs, which play important regulatory roles in multiple cellular processes8. lncRNAs can be classified as intronic, exonic, overlapping and intergenic lncRNAs, based on their locations in regard to the nearest protein-coding genes9. Exonic lncRNAs can be further classified as sense and antisense lncRNAs based on the direction of transcription. The long intergenic noncoding RNAs, also known as lincRNAs, are found to contain introns, exons and polyadenylated tails similarly as the mRNAs, and can be spliced to different transcripts10,11.

Mechanistically, lncRNAs regulate gene transcription either in cis or in trans. For example, Xist, which is transcribed from one X chromosome, activities the X chromosome silencing12–14. HOTAIR, which is transcribed from the HOXC cluster, interacts with the Polycomb repressive complex 2 to represses the transcription of the HOXD cluster in trans15,16. Some lncRNAs post-transcriptionally regulate genes expression by affecting the pre-mRNA splicing and mRNA translation. MALAT1, a nuclear lncRNA widely associated with cancer metastasis, affects the phosphorylation of serine/arginine-containing splicing factors17. lncRNAs can also function as competing endogenous RNAs (ceRNAs) to interact with microRNAs and antagonize the microRNA-mediated regulation. For example, HULC, a lncRNA highly up-regulated in liver cancers, can act as a ceRNA to sponge miR-372, and reduce the transcriptional repression of miR-372 targets genes18.

In addition to the microRNAs affected by or modulating UPR, several lncRNAs have also been linked with UPR19. The expression of calreticulin, an ER chaperone involved in glycoprotein folding, is regulated by miR-455 and ncRNA-RB1, a lncRNA that shares a bidirectional promoter with the RB1 gene. Silencing of ncRNA-RB1 reduced calreticulin levels20. Malat1 was reported to be up-regulated about two fold in UPR, and the up-regulation depended on PERK activation21. A megacluster of microRNAs and their host long non-coding RNA transcript (lnc-MGC) are increased in the glomeruli of mouse models of diabetic nephropathy22. Lnc-MGC appears to be regulated by CHOP, a transcription factor downstream of PERK. Lnc-MGC plays a role in glomerular extracellular matrix formation and hypertrophy in diabetic mice, possibly through interaction with the cluster microRNAs. Hypoxia significantly increased the expression of HypERlnc, a lncRNA in pericytes and perivascular mural cells23. HypERlnc has been suggested to regulate both the viability and permeability of pericytes and endothelial cells and UPR activation, which is believed to contribute to the development of many cardiopulmonary diseases.

To date, the global expression profile of lncRNAs under ER stress has not been reported. In this study, we used a comprehensive mRNA/lncRNA microarray to examine the transcriptome of MEFs under ER stress, and identified a large number of differentially expressed lncRNAs and mRNAs. We then performed genomic location and mRNA-lncRNA co-expression analyses to identify several candidate lncRNAs, which potentially regulate the expression of UPR genes. In particular, we carried out characterization of the functional involvement and expression of FR229754, an up-regulated lncRNA, in UPR.

Results

Time course of UPR activation in MEFs

Before performing microarray analysis, we first determined the time course of the UPR activation in MEFs. The MEFs were treated with 5 μg/ml tunicamycin, 200 nM thapsigargin or vehicle control for up to 24 h, and the cells were harvested at 0, 4, 8, 12, 16, 24 h, respectively. Real-time PCR experiments showed that the expression of BiP, IRE1α, PERK, ATF6α, Chop and ATF4, another transcription factor downstream of PERK, steadily increased over 24 h (Fig. 1a). The expression of IRE1β and ATF6β, the isoforms of IRE1α and ATF6α that are not activated in UPR, remained largely unchanged (Supplementary Fig. 1). Analysis of Xbp-1 splicing showed that Xbp-1 became fully spliced, which indicated the activation of the IRE1α branch, as early as 4 h (Fig. 1b). These results together demonstrated that the transcriptional up-regulation of many UPR target genes increased over 24 h in MEFs, and the three branches were likely activated in different chronological orders, a finding consistent with several previous reports24–26. Because prolonged UPR activation is known to trigger apoptosis, we also examined the cleavage of poly (ADP-ribose) polymerase (PARP) in MEFs treated with tunicamycin and thapsigargin. Much lower or undetectable PARP cleavage was seen in the MEFs treated with tunicamycin or thapsigargin for 4 to 16 h, but the cleavage was significantly increased in the MEFs with UPR induced for 24 h, indicating that apoptosis was minimal at 16 h under these conditions (Fig. 1c). Therefore we chose 16 h as an arbitrary time point to analyze the expression profile of mRNAs and lncRNAs from the tunicamycin-treated MEFs.

Figure 1.

Figure 1

Time course of UPR activation in MEFs under ER stress. (a) MEFs were treated with 5 μg/ml tunicamycin (Tm), 200 nM thapsigargin (Tg) and DMSO as a vehicle control for the indicated time, and the expression of UPR (BiP, Atf4, Chop, Ire1α, Perk, and Atf6α) genes were analyzed by real-time PCR. All examined RNAs were normalized to Gapdh. (b) Xbp-1 mRNA splicing was determined by reverse transcription-PCR. Unspliced (u) and spliced (s) Xbp-1 mRNA products are indicated. Gapdh PCR products serve as a loading control. (c) Immunoblotting analysis of PARP and its cleaved fragment. Gapdh serves as a loading control. Data are shown as mean + SD. *P < 0.05, **P < 0.01 and ***P < 0.001. n = 3.

Microarray analysis of lncRNA and mRNA profiles in MEFs

Our microarray contains 51,302 probes, which were 60-nucleotide long and designed to hybridize with the entire mouse transcriptome of 24,239 mRNAs and 35,757 lncRNAs. The mouse lncRNAs were pooled from the several lncRNA databases: Ensembl, RefSeq, Ultra-conserved region encoding LncRNA (UCR), lncRNAdb, ncRNA and NONCODE. In our study, the expression of 881, 69 and 13 lncRNAs, and 976, 129 and 32 mRNAs was found to change over 2, 5 and 10 fold in the tunicamycin-treated MEFs, respectively (Fig. 2a). The mRNAs and lncRNAs changed over 5 fold are shown in heatmaps (Fig. 2b,c). Chop, Herpud1 (homocysteine inducible er protein with ubiquitin like domain 1), Ero1lb (endoplasmic reticulum oxidoreductase 1β), BiP and Hrd1/Snyn1 (HMG-CoA reductase degradation 1/synoviolin 1) were among the most strongly up-regulated genes (DEGs) (Fig. 2b). 15 and 54 lncRNAs increased or decreased over 5 fold, respectively, and they were further categorized into 13 intergenic, 18 intronic, 32 exonic sense, 2 exonic antisense and 4 overlapping lncRNAs.

Figure 2.

Figure 2

Microarray analysis of mRNAs and lncRNAs in MEFs under ER stress. (a) Volcano plot of the lncRNA expression levels between the control and tunicamycin (Tm)-treated MEFs. (b,c) Hierarchical clustering heat maps showing mRNAs and lncRNAs changed over 5 fold between DMSO (control) and Tm-treated MEFs. The zoom-in window in (b) shows the list of mRNAs up-regulated over tenfold. The 1,2,3 represent three individual samples of DMSO- and Tm-treated MEFs. (d) The possible molecular functions of the most significantly changed 500 lncRNAs predicted by lncRNA-mRNA co-expression analysis. (e) The possible biological processes that these lncRNAs are involved in.

The top 500 differentially expressed lncRNAs are predicted to be involved in several molecular functions, namely protein binding, ion binding and catalytic activity, and participate in a host of biological processes: metabolism, localization biosynthesis and transport (Fig. 2d,e). We then used real-time PCR to validate the expression of six randomly selected lncRNAs (n278914, n290844, FR223708, n416682, FR346657 and FR091011) and mRNAs (Calnexin, Calreticulin, Krt20, Has2, Hrd1 and Edem), which were differentially expressed after UPR activation as identified by the microarray study. Comparable trend of change was seen by both techniques from the RNAs prepared from three independently cultured MEFs (Fig. 3a). Furthermore, we examined the time course of FR346657, FR091011, Hrd1 and Edem expression in MEFs treated with 5 μg/ml tunicamycin for up to 24 h (Fig. 3b). Most of their expression reached planteu at 8 h, and subsequently decreased or maintained throughout 24 h.

Figure 3.

Figure 3

Validation of mRNA and lncRNA expression in MEFs under ER stress. (a) Real-time PCR analysis of the expression of six randomly selected lncRNAs and mRNAs from three independent sets of DMSO (control) and tunicamycin (Tm)-treated MEFs at 16 h. (b) The expression of FR346657, FR091011, Hrd1 and Edem1 over the course of UPR for up to 24 h as analyzed by real-time PCR analysis. All examined RNAs were normalized to Gapdh. Data are shown as mean + SD. *P < 0.05, **P < 0.01 and ***P < 0.001. n = 3.

Genomic locations of the differentially expressed lncRNAs in UPR

We next analyzed the chromosomal distribution of the lncRNAs differentially expressed greater than twofold after UPR activation, and found that these transcripts scattered widely on all chromosomes (Supplementary Fig. 2). Several recent studies have suggested that the expression patterns of many lncRNAs strongly correlate with their neighboring/overlapping coding genes8. We therefore examined the presence of any coding genes neighboring or overlapping with the most differentially expressed lncRNAs identified in the microarray study. We found that, among the lncRNAs differentially expressed over 5 fold, 22 lncRNAs neighbor or overlap with 22 coding genes, whose expressions also significantly changed in UPR (Table 1). These 22 lncRNAs include one lincRNA (n290468), nine intronic lncRNAs (FR322715, FR342061, FR315668, FR197614, FR351780, FR333518, FR378244, FR201427 and FR262136), nine exonic sense lncRNAs (FR223709, FR167504, n285450, n281650, FR229754, FR086606, FR095406, FR378356 and FR366793), one exonic antisense lncRNA (FR159674) and two overlapping lncRNAs (n295470 and n266048). The expressions of most lncRNAs in this group changed in the same direction as their nearest genes, with comparable fold.

Table 1.

The information of the nearest genes neighboring/overlapping with the most differentially expressed lncRNA in UPR.

Class Name Fold Gene Fold
LincRNA
linc n290468 9.587↓ Adam12 8.534↓
Intronic lncRNA
intronic FR322715 5.741↓ Pls3 2.763↓
intronic FR342061 7.093↓ Cacna1c 2.037↓
intronic FR315668 5.858↓ Pde8b 2.548↓
intronic FR197614 6.230↓ Errfi1 5.129↓
intronic FR351780 5.878↓ Cacna1c 2.037↓
intronic FR333518 6.742↓ Cacna1c 2.037↓
intronic FR378244 5.092↓ Dlc1 3.857↓
intronic FR201427 8.457↓ Cacna1c 2.037↓
intronic FR262136 5.863↑ Cxadr 5.723↑
Exonic sense lncRNA
exonic-sense FR223709 10.041 Krt20 2.886↓
exonic-sense FR167504 6.0154↓ Sh3kbp1 2.590↓
exonic-sense n285450 7.199↓ Mical2 5.734↓
exonic-sense n281650 5.298↑ Prss16 4.923↑
exonic-sense FR229754 8.031↑ Sel1l 11.547↑
exonic-sense FR086606 11.709↓ Has2 15.767↓
exonic-sense FR095406 9.1600↓ Grb14 4.319↓
exonic-sense FR378356 5.142↓ Kif26b 4.729↓
exonic-sense FR366793 5.532↑ Slc7a11 7.919↑
Exonic antisense lncRNA
exonic-antisense FR159674 5.849↓ Nudt6 2.568↓
Overlapping lncRNA
overlapping n295470 5.385↓ Igfbp5 4.821↓
overlapping n266048 6.490↓ Mylk 4.888↓

Notably, the nearest gene to an exonic sense lncRNA, FR229754, is Sel1l, which encodes the mammalian homologue of yeast Hrd3p. Sel1l, which encodes the mammalian homologue of yeast Hrd3p. Hrd3p is a binding partner of Hrd1p, an E3 ubiquitin ligase essential in the ERAD and highly up-regulated in UPR (Fig. 2b). SEL1L knockout cells are defective in the degradation of misfolded ER luminal proteins27. The expressions of FR229754 and Sel1l were up-regulated over 8 and 11 fold in UPR, respectively, as shown by the microarray analysis. The rest lncRNA-neighbouring/overlapping genes include Adam12, Pls3, Cacna1c, Pde8b, Errfi1, Dlc1, Cxadr, Krt20, Sh3kbp1, Mical2, Prss16, Has2, Grb14, Kif26b, Slc7a11, Nudt6, Igfbp5 and Mylk, respectively, which encode proteins involved in a wide spectrum of cellular functions from cytoskeleton organization, ion transport, glucose metabolism to extracellular matrix formation. For example, Adam12, which encodes a disintegrin and metalloprotease involved in cell adhesion and extracellular matrix formation, overlaps with a lincRNA, n290468. Hyaluronan synthase 2 (Has2) is involved in hyaluronan synthesis and extracellular matrix formation, and is next to an exonic sense lncRNA, FR086606. Real-time PCR and immunoblotting analysis confirmed the transcriptional up-regulation of FR229754 and Sel1l and down-regulation of n290468 and Adam12 in three independent sets of tunicamycin-treated MEFs (Fig. 4a), their trend of change over the course of UPR for up to 24 h (Fig. 4b), and the up-and down-regulation of Sel1l and Adam12 at protein level (Supplementary Fig. 3).

Figure 4.

Figure 4

Real-time PCR analysis of lncRNAs and mRNAs identified from genomic location analyses. (a) Real-time PCR analysis of FR229754, Sel1l, n290468 and Adam12 in three independent sets of DMSO (control) and tunicamycin (Tm)-treated MEFs at 16 h. (b) The expression of FR229754, Sel1l, n290468 and Adam12 over the course of UPR for up to 24 h as analyzed by real-time PCR analysis. All examined RNAs were normalized to Gapdh. Data are shown as mean + SD. *P < 0.05, **P < 0.01 and ***P < 0.001. n = 3.

lncRNA functions predicted by lncRNA-mRNA co-expression analyses

We next identified the mRNAs that were expressed in a fashion statistically correlated with the above-identified lncRNAs, using lncRNA-mRNA co-expression analysis. The identified mRNAs might be expressed under the same promoter, i.e. in the comparable trend as the lncRNA, or represent the possible targets that were regulated by the lncRNA. FR229754 and n290468, which overlaps with Sel1l and Adam12, respectively, were co-expressed with a large number of UPR genes, in addition to genes and from other cellular pathways, e.g. extracellular matrix (ECM), PI3 kinase (PI3K)-Akt, MAP kinase (MAPK) and glucose metabolism (Fig. 5a,b). FR229754 correlated with the expression of many UPR genes, including several ER chaperones and ERAD components, e.g. Sel1l, BiP, Edem, Ero1, DnaJ and Derl3 (Fig. 5a). n290468 was also co-expressed with many UPR genes and several ECM genes including Adam12 (Fig. 5b).

Figure 5.

Figure 5

Possible mRNA candidates identified from lncRNA-mRNA co-expression analyses. Representative co-expressing mRNAs identified from lncRNA-mRNA co-expression analyses are depicted in the periphery with FR229754 (a) and n290468 (b) depicted in the center.

The functional impact and expression of FR229754

Because the expression of FR229754 correlated with Sel1l and many UPR genes, and it was strongly up-regulated in UPR, we next examined the impact of FR229754 silencing on the expression of Sel1l and BiP. Two small interfering RNAs designed against FR229754 reduced the expression of FR229754 in the unstressed and tunicamycin-treated MEFs, with si-2 being more potent (Fig. 6a). Interestingly, the level of Sel1l was not much affected by FR229754 in the MEFs transfected with si-2, while the level of BiP was greatly reduced and especially in the tunicamycin-treated MEFs transfected with si-2, suggesting that the level of FR229754 affects the up-regulation of BiP in UPR (Fig. 6b,c).

Figure 6.

Figure 6

Silencing of FR229754 markedly reduced BiP levels. (a–c) Real-time PCR analysis of FR229754, Sel1l and BiP in the DMSO and tunicamycin-treated MEFs, transfected with negative control non-targeting (NT) and two small interfering (si-1 and si-2) RNAs designed against FR229754. Note that si-2 is more potent in silencing FR229754 in the MEFs. All examined RNAs were normalized to Gapdh. Data are shown as mean + SD. *P < 0.05, **P < 0.01 and ***P < 0.001. n = 3.

We further analyzed which UPR branch was more intimately involved in the expression of FR229754 and Sel1l. In order to assess the contribution of each UPR branch (Ire1α, Perk and Atf6) to lncRNA expression, we used the specific inhibitors targeting Ire1α, Perk and Atf6α, respectively. 4μ8C, GSK2606414 and Ceapin-A7, inhibit the XBP1 splicing, PERK phosphorylation and the ER-Golgi trafficking of ATF6, respectively28–30. Several studies have suggested that the transcriptional regulation of UPR target genes relies on the activation of individual UPR branch, i.e. Ire1α-, Perk- and Atf6α-dependent26,31,32, although overlap in some target genes has also been reported25. Real-time PCR analysis (Supplementary Fig. 4) confirmed that treatment with 4μ8C, GSK2606414 and Ceapin-A7 induced similar changes to many UPR gene [including ER chaperones (BIP), PERK downstream effector (Chop, ATF4) and ERAD effector (EDEM and p58)] expression, in a comparable fashion as the IRE1α-, PERK- and ATF6α-deficient MEFs25. In our experiment, incubation with GSK2606414, not 4μ8C and Ceapin-A7, largely reversed the increase of FR229754 and Sel1l induced by tunicamycin treatment, suggesting that the activation of Perk branch, not Ire1α and Atf6α, mediates the transcriptional up-regulation of FR229754 and Sel1l (Fig. 7a,b).

Figure 7.

Figure 7

The involvement of the three UPR branches in FR229754 expression. MEFs were treated with tunicamycin (5 μg/ml) for 16 h and in the presence of 10 μM 4μ8C, 10 μM GSK2606414 and 10 μM CEAPIN-A7 to assess the contribution of Ire1α, Perk and Atf6α. (a,b) Real-time PCR analysis of FR229754 and Sel1l. All examined RNAs were normalized to Gapdh. Data are shown as mean + SD. *P < 0.05, **P < 0.01 and ***P < 0.001. n = 3.

Discussion

In this study, we examined the transcriptomic profiles of lncRNAs and mRNAs of MEFs treated with ER stress-inducing compound. Our data of the mRNA profiles in MEFs treated with tunicamycin are consistent with previous profiling studies in MEFs and other tissues33–37. Interestingly, we found that genes from pathways seemingly unrelated to the ER were also significantly altered after UPR activation. These include genes responsible for cell adhesion and extracellular matrix remodeling, e.g. Adam12, Has2 and collagen isoforms (CO1A1, CO1A2 and CO6A1). Similar findings were reported by a proteomics study36. Our lncRNA-mRNA co-expression analysis also showed that FR229754 and n290468 were co-expressed with genes from other cellular pathways such as ECM, PI3K-Akt, MAPK and glucose metabolism. These results strongly suggest that the activation of UPR induces the adaptive changes in multiple cellular processes, in addition to the canonical ER proteostasis-regulating pathway. How the canonical and noncanonical pathways coordinate in the activation and maintenance of UPR awaits future characterization. Some lncRNAs identified in this study may link these pathways together.

We used two approaches to probe the potential functions of the differentially expressed lncRNAs in UPR. First, by identifying the genomic location of the most differentially expressed lncRNAs, we predicted that the genes, which neighbor or overlap with the differentially expressed lncRNAs, may be their cis targets. On the other hand, we used the lncRNA-mRNA network to identify the mRNAs, whose expressions correlated with two differentially expressed lncRNAs, FR229754 and n290468. The identification of Sel1l and Adam12 as their co-expressing mRNAs corroborated our genomic location approach. A host of lncRNAs are known to regulate the expressions of their target genes at epigenetic (as recruiters, tethers and scaffolds) and transcriptional (as decoys, coregulators, and RNA polymerase II inhibitors) levels8. Future studies are required to characterize how the lncRNAs identified by these two approaches mechanistically affect the expression of their potential target genes, including UPR-related and unrelated genes.

One interesting lncRNA candidate identified from this study is FR229754, which overlaps with Sel1l in terms of genomic sequence and correlated with Sel1l and other UPR genes such as BiP at expression level. Studies in yeast and higher organisms have identified three different pathways for the degradation of ERAD substrates, depending on the location of the misfolded domains, namely ERAD-L, ERAD-M and ERAD-C (with misfolding in the ER lumen, inside the ER membrane and on the cytosolic side of a transmembrane protein, respectively)38. The ERAD-L pathway is further categorized into the ERAD-Ls (for degradation of soluble luminal proteins) and ERAD-Lm (degradation of transmembrane proteins) pathways39. In yeast and higher organisms, Hrd1p is shown to is shown to recognize and degrade ERAD-L and ERAD-M substrates, whereas the other evolutionarily conserved ER ubiquitin ligase Doa10/TEB4 mediates ERAD-C substrate degradation38–42.

Mammalian and chicken Sel1l have been shown as an essential component required for the degradation of ERAD-Ls, but not ERAD-Lm substrates27,39–41. Sel1l knockout mice suffer embryonic lethality43. Silencing of FR229754 greatly reduced the level of BiP, indicating that FR229754 level affects the chaperone adaptive response in UPR. We further used specific inhibitors and demonstrated that the transcriptional up-regulation of FR229754 and Sel1l is dependent on the activation of Perk branch. Because the inhibitors used to block the three UPR pathways likely have off-target effects, future studies using the MEFs isolated from IRE1α-, PERK- and ATF6α-deficient mice would be required to validate and compare with the findings of our study. In summary, our study identified a large number of differentially expressed lncRNAs after the UPR activation. The lncRNAs and the possible mRNA targets predicted by the bioinformatic analysis in this study lay a foundation for future functional characterization of non-coding RNAs in UPR.

Methods

Animals

Pathogen-free male and female C57BL/6 J mice were purchased from Vital River Laboratory Animal Technology Co. Ltd. (Beijing, China). 10-week-old mice were mated in a temperature-controlled room with a 12-h light/dark cycle. Pregnancy was assessed by visual inspection of a distended abdomen. The animal protocol followed the “Principles of laboratory animal care” (NIH publication No. 86-23), and was approved by the Ethics Committee of Peking Union Medical College.

Cell culture and chemicals

Mouse embryonic fibroblasts (MEFs) were isolated from pregnant mice at E13.5 and cultured in DMEM containing 10% fetal bovine serum as previously described44. Tunicamycin, thapsigargin, 4μ8C and GSK2606414 were purchased from Calbiochem. Ceapin-A7 was a generous gift from Drs. Ciara Gallagher and Peter Walter (University of California San Francisco). All other chemicals were purchased from Sigma-Aldrich, unless stated otherwise. To induce ER stress, MEFs were treated with 5 μg/ml tunicamycin (Tm) for up to 24 hours. To inactivate each UPR branch (Ire1α, Perk and Atf6α), the MEF cells were treated with 10 μM 4μ8C, 10 μM GSK2606414 and 10 μM Ceapin-A7.

RNA extraction and reverse transcription-polymerase chain reaction

Total RNAs were extracted from cells using Trizol (Invitrogen, USA), following the manufacturer’s instruction. The concentration and purity of the RNA samples were determined using a NanoDrop 2000C (Thermo Scientific, USA). 1.5 μg of RNA was reverse transcribed to cDNA using oligo(dT) and random primers with the TransScript First-Strand cDNA Synthesis SuperMix kit (TransGen Biotech, Beijing). The Xbp1 splicing was detected by standard reverse transcription-polymerase chain reaction using 2 × Taq PCR StarMix (GenStar, Beijing). The specific primers for murine Xbp1 and Glyceraldehyde-3-phosphate dehydrogenase (Gapdh) are as follows: Xbp1: Forward, GAACCAGGAGTTAAGAACACG; Reverse, AGGCAACAGTGTCAGAGTCC; Gapdh: Forward, GGCCTCCAAGGAGTAAGA; Reverse, GTGCAGCGAACTTTATTGA.

Microarray analysis

The OE Mouse lncRNA Microarray V2.0 (OEBiotech, Shanghai) was used for the global profiling of mouse lncRNAs and protein-coding transcripts. Total RNAs were quantified and the RNA integrity was assessed using Agilent Bioanalyzer 2100 (Agilent Technologies, USA). The labeling, microarray hybridization and wash were performed by the microarray facility at OEBiotech, Shanghai. Briefly, cDNAs were transcribed from total RNAs, synthesized to cRNAs and labeled with cyanine-3-CTP. The labeled cRNAs were then hybridized onto the microarray. After wash, the fluorescent signals were scanned using the Agilent Scanner G2505C (Agilent Technologies, USA).

Feature Extraction software V10.7.1.1 (Agilent Technologies, USA) was used to analyze the array images to obtain the raw data, which was further analyzed by Genespring software (Agilent Technologies, USA). The differentially expressed protein-coding genes and lncRNAs were identified, and fold change as well as P value from the statistics t-test were calculated. We set a limit for the up- or down-regulated lncRNAs as fold change ≥ 2.0 and P value ≤ 0.05.

Real-time quantitative PCR (Real-time PCR)

Primers for mRNA or lncRNA used in real-time PCR were designed using Primer 6 software (PREMIER Biosoft, USA), and then verified using the Basic Local Alignment Search Tool (BLAST) from National Centre for Biotechnology Information. Sequence information is as follows: Ire1α: Forward, 5′-TTCTGAGGTTCTTAGCCA-3′; Reverse, 5′-CATGCATTCACAAACATGA-3′; Atf4: Forward, 5′-CCTGATAGAAGAGGTCCG-3′; Reverse, 5′-GGTACTTTCACTACAAAATAAT-3′; Perk: Forward, 5′-ATTTATGTCGGTAGTGTCA-3′; Reverse, 5′-CTTGAAAGAAGTCATAATAGTT-3′; BiP: Forward, 5′-CAGAGTGGAGTTGAAAAT-3′; Reverse, 5′-AAAATTAGACCAGTGTAAA-3′; Chop: Forward, 5′-CCTGCCTTTCACCTTGGA-3′; Reverse, 5′-GCTTTGGGATGTGCGTGT-3′; Atf6α: Forward, 5′-TGAGCAGCTGAAGAAGGAGA-3′; Reverse, 5′-TTCTCTGACACCACCTCGTC-3′; Sel1l: Forward, 5′-TTCGTCTGGCTGCTTGGT-3′; Reverse, 5′-TGCGTATCTTCTTGCGTGTT-3′; Adam12: Forward, 5′-TGGGACCAGAGAGGAGCTTAC-3′; Reverse, 5′-GTTGCACAGTCAGCACGTCT-3′; Has2: Forward, 5′-GAGCACCAAGGTTCTGCTTC-3′; Reverse, 5′-CTCTCCATACGGCGAGAGTC-3′; Krt20: Forward, 5′-GTGGCTCGCTGTATAGGAAGG-3′; Reverse, 5′-CAGGTCCGATCCGTTGGAG-3′; Hrd1: Forward, 5′-AGCTACTTCAGTGAACCCCACT-3′; Reverse, 5′-CTCCTCTACAATGCCCACTGAC-3′; Edem: Forward, 5′-TCTACATGCGCCAGATCGAC-3′; Reverse, 5′-TCGACAGCATCACAGATGGG-3′; Ire1β: Forward, 5′- TGAGGAACAAGAAGCACCACT-3′; Reverse, 5′- AGAGCTGGTGGGTAGTAGGG-3′; Atf6β: Forward, 5′- GAGGAGCAGGCACAGTTGTT-3′; Reverse, 5′- AAGATGGGTAGAGGGTCCCA-3′; p58ipk: Forward, 5′-GCTGAACTCCGTTCTGTCCA-3′; Reverse, 5′-TCGACAGCATCACAGATGGG-3′; Calnexin: Forward, 5′-GCTAGGGAGAATGAATTGCCG-3′; Reverse, 5′- TTGGGCTTCCATCCAATCGC-3′; Calreticulin: Forward, 5′-TACAAGGGCGAGTGGAAACC-3′; Reverse, 5′-GCATCGGGGGAGTATTCAGG-3′; Gapdh: Forward, 5′-CCCAACACTGAGCATCTCC-3′; Reverse, 5′-GGGTGCAGCGAACTTTATT-3′; FR223708: Forward, 5′-ATTAAAGCAGTTACACCCAGCA-3′; Reverse, 5′-ACCCAACGCTACCATCCAC-3′; FR229754: Forward, 5′-GGTCGCCCTGCCCACA-3′; Reverse, 5′-AAACCCCAGCGTGTCCC-3′; FR091011: Forward, 5′-AGGACTAGAGTAAGCAGGAGA-3′; Reverse, 5′-TTCACGGCTGTGGGTTGA-3′; FR346657: Forward, 5′-GTGCGGTGGTTACAGAAG-3′; Reverse, 5′-CAGTCCCAGGTGGCATCC-3′; n290468: Forward, 5′-AGCCAAACACTCAACTGGAC-3′; Reverse, 5′-GGCCTCCTTTCCAACATGCTT-3′; n416682: Forward, 5′-AAGGCAAACCAAACAGAC-3′; Reverse, 5′-TACAGCACGGATGAAGAG-3′; n290844: Forward, 5′-GCGTAGAGGGCAGGTATTGT-3′; Reverse, 5′- CAGGAATCAGACCCACGGAA-3′; n278914: Forward, 5′-GTGGCCCAGATCTTTCCATCT-3′; Reverse, 5′-AAGGCCAGACTGGGGAGAAG-3′. The real-time PCR reactions were performed in 96-well optical plates using StepOnePlusTM Real-time PCR system (Applied Biosystems) with SYBR Green PCR Master Mix (TransGen Biotech, Beijing). All experiments were performed in triplicate, and all samples were normalized to the expression of Gapdh.

Genomic sequence analysis

The genomic sequence of murine lncRNAs and mRNAs were obtained using the UCSC genome browser (http://genome.ucsc.edu/) and the following databases: Ensembl, RefSeq, Ultra-conserved region encoding LncRNA (UCR), lncRNAdb, ncRNA and NONCODE. The chromosome locations of lncRNAs were annotated by the version of Dec. 2011 (GRCm38/mm10).

Construction of the lncRNA-mRNA co-expression network

The lncRNA-mRNA co-expression network was constructed using the normalized signal intensity of each differentially expressed lncRNA identified from the microarray study against the normalized signal intensity of every mRNA. The Pearson correlation was calculated for each lncRNA-mRNA pair, and then the pairs with correlation coefficient > 0.99 and P-value < 0.05 were deemed significant.

Gene ontological analysis

Gene ontology (GO) (http://www.geneontology.org) was used to assign the co-expressed mRNAs to GO terms and thereby predict the potential molecular functions and biological processes that one lncRNA may be involved. Briefly, we annotated the GO terms of the co-expressed mRNAs for each lncRNA, and then conducted a functional enrichment for the co-expressed mRNAs by summating the GO terms. The enriched functional terms were used to access the involvement of one given lncRNA in biological processes, cellular components and molecular functions. KEGG pathway analyses were performed to predict the biological pathways (http://www.genome.ad.jp/kegg/).

Immunoblotting

Total cellular proteins were prepared using a lysis buffer [20 mM HEPES pH7.5, 150 mM NaCl, 1% Triton-X100, 10% glycerol, 1 mM EDTA 10 mM tetrasodium pyrophosphate, 100 mM NaF, 17.5 mM β-glycerophosphate, 1 mM phenylmethysulfonyl fluoride and protease inhibitor cocktail (Roche)]. The protein lysates were analyzed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE), electrotransferred to polyvinylidene difluoride (PVDF) membranes, and then subjected to immunoblotting using a standard protocol. The primary antibodies used in this study include: PARP (Cell Signaling Technology, 9542), Adam12 (Proteintech, 14139-1-AP), Sel-1l (Santa Cruz, sc-377350), β-actin (Molecular Biological Laboratories, PM053), GAPDH (Proteintech, 60004-1-Ig). After incubation with peroxidase-conjugated secondary antibody (anti-Rabbit IgG, 074-1506, KPL; anti-Mouse IgG, 330, Molecular Biological Laboratories), the proteins of interest were visualized with Clarify Western ECL Substrate (Bio-Rad).

RNA interference

RNA interference was performed using RNAiMAX (Invitrogen). Briefly, MEFs were seeded in 6-well plates and cultured overnight, and transfected with siRNA oligonucleotides (50 nmol per well) with RNAiMAX according to the manufacturer’s instruction. 48 h after transfection, cells were harvested for further analysis. The siRNA oligonucleotides were designed using an on-site algorithms and synthesized by GenePhama (Shanghai, China) as follows: FR229754: siRNA-1: 5′-GCAGCAAACUUUAGGUGAC-3′; siRNA-2: 5′-UCGACUAGCUGACUUACAU-3′. Non-targeting (NT) siRNA: 5′-UUCUCCGAACGUGUCACGU-3′ was also purchased from GenePhama (Shanghai, China).

Statistical analysis

Expression ratios were subjected to a log2 transformation to produce fold-change data. Differential expression levels of lncRNAs and mRNAs were compared, using an independent sample t-test between two groups. P < 0.05 was considered significant.

Electronic supplementary material

Acknowledgements

We thank the members of the laboratory of L.W. for helpful discussions. This work was supported by grants from the National Natural Science Foundation of China (81372201), Ministry of Science and Technology of the People’s Republic of China (2016YFC1302203 and 2012CB517504) to L.W.

Author Contributions

L.W., H.Q. and C.L. conceived and designed the experiments; H.Q., Q.F. and C.L. performed the experiments; H.Q. and Y.Y.W. performed the bioinformatic analysis; H.Q., Q.F. and L.W. analyzed data; L.W. wrote the manuscript.

Competing Interests

The authors declare no competing interests.

Footnotes

Hongyang Quan, Qianqian Fan and Chuang Li contributed equally to this work.

Electronic supplementary material

Supplementary information accompanies this paper at 10.1038/s41598-018-23289-3.

Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Senft D, Ronai ZA. UPR, autophagy, and mitochondria crosstalk underlies the ER stress response. Trends Biochem Sci. 2015;40:141–148. doi: 10.1016/j.tibs.2015.01.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Walter P, Ron D. The unfolded protein response: from stress pathway to homeostatic regulation. Science. 2011;334:1081–1086. doi: 10.1126/science.1209038. [DOI] [PubMed] [Google Scholar]
  • 3.Hetz C, Chevet E, Oakes SA. Proteostasis control by the unfolded protein response. Nat Cell Biol. 2015;17:829–838. doi: 10.1038/ncb3184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Gardner BM, Pincus D, Gotthardt K, Gallagher CM, Walter P. Endoplasmic reticulum stress sensing in the unfolded protein response. Cold Spring Harb Perspect Biol. 2013;5:a013169. doi: 10.1101/cshperspect.a013169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Byrd AE, Aragon IV, Brewer JW. MicroRNA-30c-2* limits expression of proadaptive factor XBP1 in the unfolded protein response. J Cell Biol. 2012;196:689–698. doi: 10.1083/jcb.201201077. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Chitnis NS, et al. miR-211 is a prosurvival microRNA that regulates chop expression in a PERK-dependent manner. Mol Cell. 2012;48:353–364. doi: 10.1016/j.molcel.2012.08.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Behrman S, Acosta-Alvear D, Walter P. A CHOP-regulated microRNA controls rhodopsin expression. J Cell Biol. 2011;192:919–927. doi: 10.1083/jcb.201010055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Kung, J. T., Colognori, D. & Lee, J. T. Long noncoding RNAs: past, present, and future. Genetics193, 651–669, 10.1534/genetics.112.146704 (2013). [DOI] [PMC free article] [PubMed]
  • 9.Shi X, Sun M, Liu H, Yao Y, Song Y. Long non-coding RNAs: a new frontier in the study of human diseases. Cancer Lett. 2013;339:159–166. doi: 10.1016/j.canlet.2013.06.013. [DOI] [PubMed] [Google Scholar]
  • 10.Kapusta A, Feschotte C. Volatile evolution of long noncoding RNA repertoires: mechanisms and biological implications. Trends Genet. 2014;30:439–452. doi: 10.1016/j.tig.2014.08.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Ulitsky I, Shkumatava A, Jan CH, Sive H, Bartel DP. Conserved function of lincRNAs in vertebrate embryonic development despite rapid sequence evolution. Cell. 2011;147:1537–1550. doi: 10.1016/j.cell.2011.11.055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Brown CJ, et al. A gene from the region of the human X inactivation centre is expressed exclusively from the inactive X chromosome. Nature. 1991;349:38–44. doi: 10.1038/349038a0. [DOI] [PubMed] [Google Scholar]
  • 13.Pinheiro, I. & Heard, E. X chromosome inactivation: new players in the initiation of gene silencing. F1000Res6, 10.12688/f1000research.10707.1 (2017). [DOI] [PMC free article] [PubMed]
  • 14.Gendrel AV, Heard E. Noncoding RNAs and epigenetic mechanisms during X-chromosome inactivation. Annu Rev Cell Dev Biol. 2014;30:561–580. doi: 10.1146/annurev-cellbio-101512-122415. [DOI] [PubMed] [Google Scholar]
  • 15.Gupta RA, et al. Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis. Nature. 2010;464:1071–1076. doi: 10.1038/nature08975. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Rinn JL, et al. Functional demarcation of active and silent chromatin domains in human HOX loci by noncoding RNAs. Cell. 2007;129:1311–1323. doi: 10.1016/j.cell.2007.05.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Ji P, et al. MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer. Oncogene. 2003;22:8031–8041. doi: 10.1038/sj.onc.1206928. [DOI] [PubMed] [Google Scholar]
  • 18.Wang J, et al. CREB up-regulates long non-coding RNA, HULC expression through interaction with microRNA-372 in liver cancer. Nucleic Acids Res. 2010;38:5366–5383. doi: 10.1093/nar/gkq285. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.McMahon M, Samali A. & Chevet, E. Regulation of the unfolded protein response by noncoding RNA. Am J Physiol Cell Physiol. 2017;313:C243–C254. doi: 10.1152/ajpcell.00293.2016. [DOI] [PubMed] [Google Scholar]
  • 20.Musahl AS, et al. A long non-coding RNA links calreticulin-mediated immunogenic cell removal to RB1 transcription. Oncogene. 2015;34:5046–5054. doi: 10.1038/onc.2014.424. [DOI] [PubMed] [Google Scholar]
  • 21.Bhattacharyya S, Vrati S. The Malat1 long non-coding RNA is upregulated by signalling through the PERK axis of unfolded protein response during flavivirus infection. Sci Rep. 2015;5:17794. doi: 10.1038/srep17794. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Kato M, et al. An endoplasmic reticulum stress-regulated lncRNA hosting a microRNA megacluster induces early features of diabetic nephropathy. Nat Commun. 2016;7:12864. doi: 10.1038/ncomms12864. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Bischoff FC, et al. Identification and Functional Characterization of Hypoxia-Induced Endoplasmic Reticulum Stress Regulating lncRNA (HypERlnc) in Pericytes. Circ Res. 2017;121:368–375. doi: 10.1161/CIRCRESAHA.116.310531. [DOI] [PubMed] [Google Scholar]
  • 24.Lin JH, et al. IRE1 signaling affects cell fate during the unfolded protein response. Science. 2007;318:944–949. doi: 10.1126/science.1146361. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Wu J, et al. ATF6alpha optimizes long-term endoplasmic reticulum function to protect cells from chronic stress. Dev Cell. 2007;13:351–364. doi: 10.1016/j.devcel.2007.07.005. [DOI] [PubMed] [Google Scholar]
  • 26.Okada T, Yoshida H, Akazawa R, Negishi M, Mori K. Distinct roles of activating transcription factor 6 (ATF6) and double-stranded RNA-activated protein kinase-like endoplasmic reticulum kinase (PERK) in transcription during the mammalian unfolded protein response. Biochem J. 2002;366:585–594. doi: 10.1042/bj20020391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Ninagawa S, Okada T, Takeda S, Mori K. SEL1L is required for endoplasmic reticulum-associated degradation of misfolded luminal proteins but not transmembrane proteins in chicken DT40 cell line. Cell Struct Funct. 2011;36:187–195. doi: 10.1247/csf.11018. [DOI] [PubMed] [Google Scholar]
  • 28.Cross BC, et al. The molecular basis for selective inhibition of unconventional mRNA splicing by an IRE1-binding small molecule. Proc Natl Acad Sci USA. 2012;109:E869–878. doi: 10.1073/pnas.1115623109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Axten JM, et al. Discovery of 7-methyl-5-(1-{[3-(trifluoromethyl)phenyl]acetyl}-2,3-dihydro-1H-indol-5-yl)-7H-p yrrolo[2,3-d]pyrimidin-4-amine (GSK2606414), a potent and selective first-in-class inhibitor of protein kinase R (PKR)-like endoplasmic reticulum kinase (PERK) J Med Chem. 2012;55:7193–7207. doi: 10.1021/jm300713s. [DOI] [PubMed] [Google Scholar]
  • 30.Gallagher, C. M. & Walter, P. Ceapins inhibit ATF6alpha signaling by selectively preventing transport of ATF6alpha to the Golgi apparatus during ER stress. Elife5, 10.7554/eLife.11880 (2016). [DOI] [PMC free article] [PubMed]
  • 31.Lee AH, Iwakoshi NN, Glimcher LH. XBP-1 regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response. Mol Cell Biol. 2003;23:7448–7459. doi: 10.1128/MCB.23.21.7448-7459.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Harding HP, et al. An integrated stress response regulates amino acid metabolism and resistance to oxidative stress. Mol Cell. 2003;11:619–633. doi: 10.1016/S1097-2765(03)00105-9. [DOI] [PubMed] [Google Scholar]
  • 33.Pereira, E. R., Liao, N., Neale, G. A. & Hendershot, L. M. Transcriptional and post-transcriptional regulation of proangiogenic factors by the unfolded protein response. PLoS One5, 10.1371/journal.pone.0012521 (2010). [DOI] [PMC free article] [PubMed]
  • 34.Kamauchi S, Nakatani H, Nakano C, Urade R. Gene expression in response to endoplasmic reticulum stress in Arabidopsis thaliana. FEBS J. 2005;272:3461–3476. doi: 10.1111/j.1742-4658.2005.04770.x. [DOI] [PubMed] [Google Scholar]
  • 35.Travers KJ, et al. Functional and genomic analyses reveal an essential coordination between the unfolded protein response and ER-associated degradation. Cell. 2000;101:249–258. doi: 10.1016/S0092-8674(00)80835-1. [DOI] [PubMed] [Google Scholar]
  • 36.Mintz M, et al. Time series proteome profiling to study endoplasmic reticulum stress response. J Proteome Res. 2008;7:2435–2444. doi: 10.1021/pr700842m. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Bull VH, Thiede B. Proteome analysis of tunicamycin-induced ER stress. Electrophoresis. 2012;33:1814–1823. doi: 10.1002/elps.201100565. [DOI] [PubMed] [Google Scholar]
  • 38.Carvalho P, Goder V, Rapoport TA. Distinct ubiquitin-ligase complexes define convergent pathways for the degradation of ER proteins. Cell. 2006;126:361–373. doi: 10.1016/j.cell.2006.05.043. [DOI] [PubMed] [Google Scholar]
  • 39.Bernasconi R, Galli C, Calanca V, Nakajima T, Molinari M. Stringent requirement for HRD1, SEL1L, and OS-9/XTP3-B for disposal of ERAD-LS substrates. J Cell Biol. 2010;188:223–235. doi: 10.1083/jcb.200910042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Christianson JC, Shaler TA, Tyler RE, Kopito RR. OS-9 and GRP94 deliver mutant alpha1-antitrypsin to the Hrd1-SEL1L ubiquitin ligase complex for ERAD. Nat Cell Biol. 2008;10:272–282. doi: 10.1038/ncb1689. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Hosokawa N, et al. Human XTP3-B forms an endoplasmic reticulum quality control scaffold with the HRD1-SEL1L ubiquitin ligase complex and BiP. J Biol Chem. 2008;283:20914–20924. doi: 10.1074/jbc.M709336200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Wang L, et al. Degradation of the bile salt export pump at endoplasmic reticulum in progressive familial intrahepatic cholestasis type II. Hepatology. 2008;48:1558–1569. doi: 10.1002/hep.22499. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Francisco AB, et al. Deficiency of suppressor enhancer Lin12 1 like (SEL1L) in mice leads to systemic endoplasmic reticulum stress and embryonic lethality. J Biol Chem. 2010;285:13694–13703. doi: 10.1074/jbc.M109.085340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Qiu, L. Q., Lai, W. S., Stumpo, D. J. & Blackshear, P. J. Mouse Embryonic Fibroblast Cell Culture and Stimulation. Bio Protoc6, 10.21769/BioProtoc.1859 (2016). [DOI] [PMC free article] [PubMed]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES