Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2018 Mar 28;92(8):e02184-17. doi: 10.1128/JVI.02184-17

Herpes Simplex Virus 1 Dramatically Alters Loading and Positioning of RNA Polymerase II on Host Genes Early in Infection

Claire H Birkenheuer a, Charles G Danko b, Joel D Baines a,✉
Editor: Rozanne M Sandri-Goldinc
PMCID: PMC5874419  PMID: 29437966

ABSTRACT

Herpes simplex virus 1 (HSV-1) transcription is mediated by cellular RNA polymerase II (Pol II). Recent studies investigating how Pol II transcription of host genes is altered after HSV-1 are conflicting. Chromatin immunoprecipitation sequencing (ChIP-seq) studies suggest that Pol II is almost completely removed from host genes at 4 h postinfection (hpi), while 4-thiouridine (4SU) labeling experiments show that host transcription termination is extended at 7 hpi, implying that a significant amount of Pol II remains associated with host genes in infected cells. To address this discrepancy, we used precision nuclear run-on analysis (PRO-seq) to determine the location of Pol II to single-base-pair resolution in combination with quantitative reverse transcription-PCR (qRT-PCR) analysis at 3 hpi. HSV-1 decreased Pol II on approximately two-thirds of cellular genes but increased Pol II on others. For more than 85% of genes for which transcriptional termination could be statistically assessed, Pol II was displaced to positions downstream of the normal termination zone, suggesting extensive termination defects. Pol II amounts at the promoter, promoter-proximal pause site, and gene body were also modulated in a gene-specific manner. qRT-PCR of selected RNAs showed that HSV-1-induced extension of the termination zone strongly correlated with decreased RNA and mRNA accumulation. However, HSV-1-induced increases of Pol II occupancy on genes without termination zone extension correlated with increased cytoplasmic mRNA. Functional grouping of genes with increased Pol II occupancy suggested an upregulation of exosome secretion and downregulation of apoptosis, both of which are potentially beneficial to virus production.

IMPORTANCE This study provides a map of RNA polymerase II location on host genes after infection with HSV-1 with greater detail than previous ChIP-seq studies and rectifies discrepancies between ChIP-seq data and 4SU labeling experiments with HSV-1. The data show the effects that a given change in RNA Pol II location on host genes has on the abundance of different RNA types, including nuclear, polyadenylated mRNA and cytoplasmic, polyadenylated mRNA. It gives a clearer understanding of how HSV-1 augments host transcription of some genes to provide an environment favorable to HSV-1 replication.

KEYWORDS: RNA polymerases, herpes simplex virus, human herpesviruses, transcriptional regulation, transcriptional repression

INTRODUCTION

Herpes simplex virus 1 (HSV-1) is an alphaherpesvirus that infects the majority of humans by the time they reach adulthood. The virus initially causes skin vesicles or mucosal ulcers that recur in some individuals despite the presence of an intact immune system. In immunocompromised and immunodeficient patients, it can cause blindness and debilitating or fatal encephalitis (1).

RNA polymerase II (Pol II) transcription involves four distinct stages: recruitment, initiation, elongation, and termination (2, 3). These stages, along with mRNA splicing and reinitiation, influence the level of functional, exported, cytoplasmic mRNA (3). Pol II is recruited to cellular genes when appropriate transcription factors are activated and the preinitiation complex (PIC) is formed (2, 3). Activation of the basal transcription factor H (TFIIH) by the mediator complex results in phosphorylation of serine 5 on the carboxyl-terminal domain (CTD) of Pol II (2, 4). This event releases Pol II, initiating transcription (2, 5).

On most genes, Pol II transcribes the first 30 to 60 bases before undergoing a promoter-proximal pause (PPP), caused in part by the negative elongation factor (NELF) and the 1-β-d-ribofuranosylbenzimidazole (DRB)-sensitive inducing factor (DSIF) (2, 3, 6–9). The positive elongation factor (p-TEFb), which contains cyclin-dependent kinase 9 (CDK9), and its partner cyclin (cyclin T1) phosphorylate NELF, DSIF, and serine 2 in the CTD of Pol II, releasing Pol II from the PPP (10, 11).

Transcription continues until Pol II reaches the polyadenylation signal (PAS), where Pol II processivity slows and various polyadenylation factors are recruited, culminating in transcript cleavage and 3′-end processing (12). The torpedo model is one hypothesized mechanism believed to cause release of Pol II from the template. In this model, the cellular 5′-3′ exonuclease Xrn2 starts degrading the downstream remnant of the nascent RNA after cleavage has occurred. Xrn2 degrades the downstream RNA faster than Pol II can transcribe, eventually catching up to Pol II and causing its release from the template (12). In this respect, the rate of Pol II processivity can influence the site of termination. Pol II with a slower elongation rate terminates closer to the PAS, whereas Pol II elongating with a higher rate transcribes far past the PAS (13). Activation of Xrn2 for transcription termination is controlled, in part, by its phosphorylation by p-TEFb (14). In mammalian cells, the slowing Pol II accumulates around the 3′ ends of most genes (0.5 kb to 1.5 kb downstream of the PAS) (15, 16), and occupancy gradually reduces to undetectable levels between 1 kb and 3 kb downstream of the PAS (13). This region (0.5 to 3 kb downstream of the PAS) is known as the termination zone (13). HSV-1 infection causes Pol II to continue transcribing beyond this point on most host genes (17). Diminishment or failure of Pol II to terminate often decreases gene expression and potentially invokes many detrimental consequences for the cell (12).

Starting early in infection, HSV-1 increases viral gene expression and simultaneously diminishes expression of most cellular genes using different mechanisms. The increase in viral gene expression is mediated by the alpha trans-inducing factor (α-TIF) and the viral immediate early gene products (α-gene products) ICP0, ICP4, ICP22, and ICP27. The α-TIF protein, introduced into the newly infected cell during viral entry, binds host transcription factors OCT1 and HCF and facilitates Pol II transcription of α-genes in a promoter-specific manner (18–21).

The α-gene products target different parts of the Pol II transcriptional process. ICP4 is associated with many of the factors needed for host transcription initiation, such as TFIID and mediator (22, 23), and regulates Pol II at the level of chromatin remodeling, transcription initiation and elongation, and mRNA processing (22, 23). ICP22 modulates transcription elongation at both host and viral genes by modulating Pol II phosphorylation events mediated by CDK9 in the p-TEFb complex (24–26). ICP27 inhibits host gene expression by inhibiting splicing of host mRNAs. ICP27 also promotes HSV-1 gene expression by aiding in the export of HSV-1 mRNA to the cytoplasm for translation (27, 28). The decrease in host gene expression also involves multiple mechanisms including the virion host shutoff protein (VHS), which cleaves mRNA near the 5′ end, diminishing translation (28–31).

Microarray analysis of total RNA abundance after HSV-1 and pseudorabies virus (PRV) infection revealed a remarkable alteration of the cellular transcriptome within hours (32–34). While these studies identified intriguing differences between infected and uninfected cells, the mechanisms responsible for the changes are unclear.

Chromatin immunoprecipitation sequencing (ChIP-seq) data suggest that Pol II is removed from the host genome by 4 h postinfection (35). However, 4-thiouridine (4SU) tagging and sequencing experiments combined with ribosomal profiling have suggested that Pol II is still associated with the host genome at 7 h postinfection but continues transcription well beyond the PAS, suggesting defects in 3′-end processing of cellular mRNAs (36).

To help resolve these reports, we analyzed Pol II positioning in HEp-2 cells at 3 h postinfection with HSV-1 using precision nuclear run-on analysis (PRO-seq) and quantitative reverse transcription-PCR (qRT-PCR). The data suggest that HSV-1 α-gene products work together to shutoff some host genes while activating others. We speculate that genes with depleted Pol II are detrimental or not important to HSV-1 infection, whereas genes with increased Pol II are beneficial to viral infection. The mechanism behind the differential regulation and its importance remain to be determined.

RESULTS

PRO-seq methodology and validation.

To reconcile previous conflicting reports, we used PRO-seq to visualize and quantify Pol II occupancy on host genes at 3 h postinfection with HSV-1 and compared these data to similar profiles from mock-infected cells. The experimental design is diagrammed in Fig. 1A and follows previous protocols (8, 9). All four biotinylated nucleotides were used in the run-on reactions. It was anticipated that incorporation of any one of the added biotinylated nucleotides into the nascent strand of RNA would terminate Pol II transcription (Fig. 1B) (8, 9). Sequencing the ends of the nascent RNA then allows mapping of the Pol II position to the DNA template with single-base-pair resolution.

FIG 1.

FIG 1

Methodology and validation of precision nuclear run-on analysis (PRO-seq) after HSV-1 infection. (A) Schematic representation of the precision nuclear run-on technique. HEp-2 cells were infected with HSV-1 at an MOI of 5, and infection was allowed to progress for 3 h before isolation of nuclei. Native nucleotides were replaced with biotinylated nucleotides, and nuclear run-on reactions occurred for 3 to 20 min. Incorporation of the biotinylated nucleotides inhibited further Pol II processivity. Nascent RNA transcripts were purified with magnetic, streptavidin-coated beads. Sequencing libraries were prepared: fragments were hydrolyzed to create ∼100-bp fragments, 3′ adapters were ligated, the 5′ caps were removed, and the 5′ ends were repaired before 5′ adapter ligations. The RNAs were reverse transcribed and then PCR amplified. The amplified libraries were polyacrylamide gel purified before being submitted for sequencing on the Illumina NextSeq500 platform. Bioinformatics analysis was performed with SeqMonk, and data were also viewed on the integrative genomics viewer (IGV). (B) Validation of the nuclear run-on analysis using [α-32P]CTP incorporation into nascent RNA in the presence and absence of biotinylated UTP. A reaction without nuclei was included as a negative control (open circles). Isolated nuclei were exposed to [α-32P]CTP and nonlabeled UTP, ATP, and GTP (closed circles) or [α-32P]CTP, biotinylated UTP, and nonlabeled ATP and GTP (closed boxes) and were allowed to “run on” for 5 or 20 min before RNA was isolated and subjected to scintillation counting. (C) Image of a representative polyacrylamide gel used to purify the libraries prepared from three replicates of mock-infected cells and from three replicates of HSV-1-infected cells. The libraries appeared on the gels as broad bands above the 120-bp primer dimer. The bands were excised, and DNA within them was purified and sequenced. (D) Pearson correlation scatter plots showing variation in read levels for each probe (dots) between HSV-1 and mock infection replicates (1 versus 2 and 1 versus 3). The R value shown is the Pearson correlation coefficient between reads for each probe between replicates. (E) Pearson correlation scatter plot showing variation between the HSV-1 and mock infection replicate sets. The R value shown is the Pearson correlation coefficient between average reads per probe in each data set.

Preliminary experiments ensured that the run-on conditions were appropriate and that incorporated biotinylated nucleotides inhibited further Pol II transcription. Uninfected samples were subjected to the run-on conditions with or without biotinylated UTP in the presence of radiolabeled [α-32P]CTP, and cold, unlabeled CTP, ATP, and GTP (Fig. 1B). A sample with no nuclei was used as a negative control. Nuclear run-on reactions were allowed to proceed for 5 min and 20 min. The labeled RNA was purified, and counts of radioactivity per minute for each sample were measured with a scintillation counter. Radioactivity incorporation into nascent RNA occurred within 5 min of run-on and increased with time (Fig. 1B). The presence of biotinylated UTP decreased radioactivity incorporation in both the 5- and 20-min reactions (1.8-fold and 62.8-fold, respectively) (Fig. 1B), indicating that incorporation of the biotinylated nucleotides terminated the nuclear run-on reactions.

Three biological replicates of mock- and HSV-1-infected HEp-2 cells at 3 h postinfection were used for PRO-seq library preparation. The libraries were separated on polyacrylamide gels (Fig. 1C), and a broad band containing cDNAs of the nuclear run-on products (125 bp and larger) was excised from the gel and extracted (9). The libraries were sequenced on the NextSeq500 platform. Variation between replicate sets was determined using scatter plots to determine Pearson correlation coefficients (Fig. 1D and E) and principal-component analysis (PCA) (data not shown). Each replicate from the two experimental conditions was very similar to the other replicates within the set, with the calculated Pearson correlation coefficient (R) approaching 1.0 (Fig. 1D). Yet, when the HSV-1 replicate set was compared to the mock replicate set, there was very little correlation, with an r value of 0.408 (Fig. 1E). Thus, most variability in sequence output was a result of experimental conditions and not replicate variation within a single condition (Fig. 1D and E).

Reads were aligned to the human hg38 genome build and viewed using the integrative genomics viewer (IGV) from the Broad Institute (37, 38) (Fig. 2). There are several hallmarks of a successful PRO-seq profile: higher read density in the promoter-proximal pause (PPP) region than in the gene body, equal read density between introns and exons, and substantial occupancy downstream of the PAS (i.e., in the termination zone) (9). The PRO-seq libraries presented here met all of these criteria. PPP sites were easily distinguishable from the gene body, particularly in mock-infected samples (Fig. 2B to D; see Fig. 4B); reads extended beyond the PAS in both mock- and HSV-1-infected samples (Fig. 2B to F; see Fig. 3B and 4B), and there was no discernible intron/exon bias.

FIG 2.

FIG 2

Diagrams of different Pol II occupancy patterns in different gene regions after HSV-1 infection. (A) Diagram of a “generic gene” outlining various components. The TSS is defined by the large black arrow which originates at the first base pair of the mRNA transcript and indicates the direction of transcription. The 5′ and 3′ untranslated regions (UTRs) are defined by the narrow gray boxes, while exons are defined as the wider gray boxes. The AUG start codon is shows as a blue bar, and the poly(A) signal is defined by the red bar. The promoter-proximal pause region shown in yellow-orange is defined as the first 100 bp downstream of the TSS. The gene body is defined as +100 bp past the TSS to the poly(A) signal. The region downstream of the poly(A) signal was broken into two regions, the termination A region [the poly(A) signal to +1,500 bp past the poly(A) signal], and the termination B region [+1,500 bp past the poly(A) signal to +5,000 bp past the poly(A) signal]. The same diagram components are used to delineate portions of the individual genes shown in panels (B to F). (B to F) Coverage of reads from the PRO-seq analysis on the genes STUB1, USP8, MYC, EGR1, FOSB, respectively. Each diagram shows read coverage on the y axis and distance (in kilobases) from the TSS on the x axis. Components of each gene are shown in the diagram and are scaled to the distance indicated on the x axes. One representative sample of 3 replicates is shown for HSV-1 and mock infection. Each gene was chosen to illustrate a different pattern of Pol II occupancy across the gene.

FIG 4.

FIG 4

Analysis of Pol II occupancy in the Drosophila spike-in PRO-seq experiment. (A) Diagram of a “generic gene” outlining the various components probed for Pol II occupancy for the DESeq2 analysis in SeqMonk. (B) Pearson correlation scatter plots showing read correlations between mock and HSV-1 replicate sets with respect to the Drosophila genome and the human genome. R values indicate the Pearson correlation coefficient. (C) Changes in Pol II occupancy after HSV-1 infection in the promoter-proximal pause region (0 to 100 bp) downstream of the TSS are shown in the large center circle. Each subset from this pie chart was then analyzed for changes in Pol II occupancy within the gene body [+100 bp to poly(A) signal]. (D) Pol II termination extension into the termination B region of genes [+1,500 to +5,000 bp with respect to the poly(A) signal] after HSV-1 infection. The ratios of reads in the A region to those in the B region in analyzable genes (defined in the text) from mock-infected and HSV-infected cells were calculated. The percentage of genes is shown for each section, and the exact number of genes found within each category is shown in parentheses. Changes were calculated by comparing reads from three biological replicates of infected cells to similar data from mock-infected cells. Statistical analysis was done using DESeq2. An increase in Pol II occupancy in the B versus A region suggests termination defects caused by HSV-1.

FIG 3.

FIG 3

Changes in global Pol II occupancy across different gene regions after HSV-1 infection. (A) Diagram of a “generic gene” outlining the various components probed for Pol II occupancy for the DESeq2 analysis in SeqMonk. (B) Changes in Pol II occupancy after HSV-1 infection in the promoter-proximal pause region (0 to 100 bp) downstream of the TSS are shown in the large center circle. Each subset was then analyzed for changes in Pol II occupancy within the gene body [+100 bp to poly(A) signal] (see Table S1 in the supplemental material). (C) Pol II termination extension into the termination B region of genes [+1,500 to +5,000 bp with respect to the poly(A) signal] after HSV-1 infection. Values reflect the ratios of reads in the A region to those in the B region before and after infection. An increase in Pol II occupancy within this region suggests termination defects caused by HSV-1 (see Table S2 in the supplemental material). The percentage of genes is shown for each section of the pie chart, and the exact number of genes found within each category is shown in parentheses. Changes were calculated by comparing reads from three biological replicates of infected cells to similar data from mock-infected cells. Statistical analysis was done using DESeq2. (See also Fig. 4.)

Common changes in Pol II occupancy in host genes after 3 h of HSV-1 infection.

We were interested in the location of Pol II with respect to generic gene features, i.e., the PPP, the gene body, and termination regions designated A (PAS to +1,500 bp downstream of the PAS) and B (+1,500 bp to +5,000 bp downstream of the PAS) (Fig. 2A, 3A, and 4A). For most genes, infection caused a loss of Pol II from all regions. An example of this type of change is demonstrated by the IGV profile of STUB1 (Fig. 2B). This HSV-1-induced change in Pol II occupancy correlates with conclusions made previously from ChIP-seq (35). However, this result was not the case for all genes. In some cases, infection caused a loss of Pol II at the PPP (e.g., USP8 [Fig. 2C]) but no change in Pol II occupancy across the gene body. For many genes, HSV-1 infection increased Pol II in the transcription termination B region (e.g., USP8, and MYC [Fig. 2C and D, respectively]), similar to results from 4SU labeling (36). We also noted genes for which HSV-1 infection increased Pol II occupancy over all gene regions, (e.g., EGR1 and FOSB [Fig. 2E and F, respectively]).

The SeqMonk software package, available from Babraham Bioinformatics (https://www.bioinformatics.babraham.ac.uk/projects/seqmonk/), was used to create virtual probes to quantify the read counts at each region outlined in Fig. 2A, 3A, and 4A to gain a general understanding of the changes induced by HSV-1 (39). DESeq2 statistical analysis (40) identified genes with significant changes (P < 0.05) between HSV-1- and mock-infected samples in the PPP and body regions (see Table S1 in the supplemental material). This analysis indicated that 5,693 genes were sufficiently active and statistically similar within experimental replicates to compare occupancy at the PPP between the two conditions (Fig. 3A and B and Table S1). Of these genes, 67% had a greater-than-2-fold reduction of Pol II occupancy at the PPP at 3 h after HSV infection, 13% had a greater-than-2-fold increase, and 20% had a less-than-2-fold change (Fig. 3B). These results were confirmed by a subsequent experiment where Drosophila nuclei were spiked into the HEp-2 nuclei before run-on occurred, providing a way to assess the reproducibility of the replicates (Fig. 4C). Although the majority of genes lost Pol II at the PPP upon HSV infection, the PRO-seq results indicated that approximately one-third of human genes did not follow this phenotype (Fig. 3B and 4C).

The genes with an HSV-1-induced decrease of Pol II occupancy at the PPP were then examined for changes in Pol II occupancy along the gene body (Fig. 3A). Of the 3,791 genes for which HSV-1 decreased occupancy in the PPP region, 69% also had decreased Pol II levels along the gene body (Fig. 3B; Table S1). This result could be explained by HSV-1-induced removal of Pol II from the PPP and a concomitant decrease of Pol II complexes entering the elongation phase or by removal of the complexes from both the PPP and gene body. In contrast to the results with these genes, 6% of the genes with decreased PPP occupancy had an increase in Pol II levels along the gene body, and 25% had unchanged Pol II levels along the body (Fig. 3B; Table S1). These results are not explainable by a simple removal of Pol II from the PPP or gene body but suggest either decreased Pol II recruitment and initiation with a concomitant increase of Pol II processivity or a more rapid release of Pol II from the pause site into the elongation phase. Taken together, the data suggest multiple, gene-specific mechanisms by which HSV-1 controls Pol II transcription during infection. These mechanisms depend on the gene and include removal and/or inadequate reinitiation of Pol II complexes on genes, decreased recruitment of Pol II to promoters, and increased Pol II elongation rates.

Of the 739 genes that had increased Pol II in the PPP, approximately 40% also had increased occupancy in the gene body (Fig. 3B; Table S1). HSV-1 likely alters expression of these genes by increasing the rate of Pol II recruitment and/or initiation with subsequent release from the PPP into the elongation phase. Forty-one percent of the 739 genes with increased Pol II in the PPP had unchanged occupancy in the gene body (Fig. 3B; Table S1). This suggests that in these cases HSV-1 infection increases Pol II recruitment and initiation but does not change the rate of release from the PPP, resulting in levels of Pol II in the gene body similar to those observed in mock infection. Approximately 19% of the 739 genes that had elevated Pol II abundance in the PPP had decreased Pol II abundance in the gene body after HSV-1 infection, suggesting a reduced rate of Pol II release into the elongation phase despite higher levels of recruitment or initiation at the gene promoter.

Quantification revealed that 1,163 genes had a <2-fold change in Pol II occupancy at the PPP, suggesting that HSV-1 infection does not alter the amount of Pol II recruited or initiated in these cases (Fig. 3B; Table S1). Forty-four percent of these genes also had no change in the gene body, suggesting that HSV-1 infection does not change the rate of Pol II release into the elongation phase. However, 13% of these genes did have increased Pol II along the gene body (Fig. 3B; Table S1). These genes could possibly forgo promoter-proximal pausing, while HSV-1 infection increases Pol II recruitment and initiation. Forty-three percent of genes that had no change in Pol II occupancy at the PPP had a reduced level of Pol II in the gene body after HSV-1 infection (Fig. 3B; Table S1). One explanation for this phenotype is that these genes have increased Pol II processivity through the gene body with no change in Pol II recruitment, initiation, or release from the PPP into the elongation phase.

Analysis of transcription termination.

We also looked at Pol II levels downstream of the PAS and analyzed transcription termination in a manner similar to what was done previously using 4SU RNA-labeling experiments (36). We first identified genes from mock-infected cell samples that had higher levels of Pol II occupancy in their termination A region than in the termination B region (an A/B ratio of >2) (see Table S2 in the supplemental material). These genes were selected because pausing at the A site over the B site likely reflects active 3′-terminal mRNA processing. In contrast, more occupancy at the B site reflects higher Pol II elongation rates with poorly coordinated transcription termination. We then analyzed the A/B ratios of these genes after HSV-1 infection. Approximately 86% of the genes analyzed had a >2-fold increase of Pol II in their B region compared to their A region after HSV-1 infection {[mock(A/B)]/[HSV-1(A/B)] > 2-fold} (Fig. 3C; Table S2), indicating that Pol II occupancy was extended beyond the normal termination site, similar to what was reported previously at 7 h postinfection (36). Twelve percent of the genes analyzed for transcription termination had no significant change in their A/B ratios after HSV-1 infection {0.5-fold < [mock(A/B)]/[HSV-1(A/B)] < 2-fold} (Fig. 3C; Table S2), indicating that transcriptional termination of these genes was not influenced by HSV-1 infection. Only 2% of genes analyzed for transcription termination had A/B ratios change <0.5-fold after HSV-1 infection, indicating more efficient termination after infection (Fig. 3C; Table S2).

It should be noted that this analysis was limited to a subset of genes because many genes in mock-infected cells did not fit the criterion of an A/B ratio of >2. There were several potential reasons for this exclusion: (i) there were insufficient reads in either termination region A or B in the mock-infected sample to make the comparison meaningful (e.g., for FOSB, and c-FOS [Fig. 2F and 5C]), (ii) a transcriptionally active downstream neighboring gene might make it difficult to discern which gene was responsible for a given read, and (iii) some genes in which pausing attributable to 3′-terminal processing predominated in the B region due to rapid Pol II elongation rates and/or alternative PAS usage (41).

FIG 5.

FIG 5

Validation of SDHA as a reference gene and screen shots of PRO-seq data for additional genes analyzed in the qRT-PCR experiments (A). CT values of the SDHA reference gene in different RNA samples from mock-infected and 3-h-HSV-1-infected HEp-2 cells and 3- and 6-h-HSV-1 infected CV1 cells, demonstrating SDHA as an appropriate, stable transcript for use as a reference standard. (B to D) PRO-seq readout of Pol II occupancy along the SDHA gene (B), the c-FOS gene (C), and the JUNB gene (D) in mock infection and 3 h after HSV-1 infection in HEp-2 cells. This occupancy correlates with SDHA's transcript stability and confirms the SeqMonk and DESeq2 global analysis of these genes shown in Table 1. The scale (kb) is indicated at the bottom of the diagram of each gene. The promoter-proximal pause sites are in yellow. Red vertical bars indicate the polyadenylation site. Vertical lines intersecting each gene define the limits of the termination A and B regions.

A validation experiment, where Drosophila nuclei were spiked into the HEp-2 nuclear run-on mix before the run-on commenced, showed results similar to those of the original experiment (Fig. 4). The validation experiment was carried out with 3 independent biological replicates for both mock- and HSV-1-infected cells, where one Drosophila nucleus was added for every 10,000 HEp-2 nuclei before the run-on reaction was performed. After alignment to both the human hg38 and Drosophila dm3 genomes, the replicates were compared. Scatter plots of mock-infected replicates compared to HSV-1-infected replicates show that mock- and HSV-1-infected replicate sets varied only with respect to the human genome (R = 0.698) and not with respect to the Drosophila genome (R = 0.921) (Fig. 4B). This analysis indicated that the differences between HSV-1- and mock-infected cells observed for the hg38 genome alignment were a result of HSV-1 infection and not a result of variability in the run-on reactions or library preparation.

The human reads from the Drosophila spike-in validation experiment were analyzed in the same manner as for the original data set (Fig. 4C and D). The coverage of statistically relevant PRO-seq reads in the human genome was greatly reduced after the Drosophila spike-in. This is likely the result of reduced read coverage in the human genome. Regardless, the percentages of genes with HSV-1-induced changes in Pol II occupancy at the PPP, body, and termination zone (Fig. 4C and D) were similar to those of the initial PRO-seq data set, validating the overall conclusions but with less sensitivity (i.e., fewer could be analyzed statistically).

Correlation of regional Pol II occupancy changes with total, nuclear polyadenylated, and cytoplasmic polyadenylated RNA levels.

It was of interest to determine the effects of each Pol II alteration on mRNA production. We quantified transcripts of selected host genes using quantitative reverse transcription-PCR (qRT-PCR) (Table 1). HEp-2 cells were infected with HSV-1, and at 3 h postinfection, either total RNA was isolated or nuclear and cytoplasm fractions were collected. The cellular fractions were then used for mRNA isolation with oligo(dT) beads. Genes for the analysis were chosen based on Pol II occupancy changes within defined gene regions (Fig. 2A and 3A). Transcript levels in total RNA, nuclear polyadenylated RNA (N-mRNA), and polyadenylated cytoplasmic mRNA (C-mRNA) of each gene were quantified on a relative basis.

TABLE 1.

RNA Pol II occupancy changes after HSV-1 infection on selected host genes, as calculated using DESeq2 statistical analysis, and their effects on RNA expressiona

Gene Change in RNA Pol II occupancyb in:
PPP Body Termination extension Total RNA Nuclear mRNA Cytoplasmic mRNA
STUB1 ↓ ↓ No — — —
USP8 ↓↓↓ ↑ Yes ↓↓ ↓ —
MYC — — Yes ↓ ↓↓ ↓
EGR1 ↑↑ Increased Yes ↑↑ ↑ ↓
FOSB ↑↑↑ ↑↑ NA Increased Increased Increased
c-FOS ↑ Increased NA ↑↑↑ ↑↑↑ —
JUNB — ↑ No ↑↑↑ ↑↑↑ ↑↑↑
a

See also Fig. 5 and Table 3.

b

NA, no reads in mock termination A and/or B region, so termination extension analysis was not possible. —, <2-fold change; single arrow, fold change of 2 to 5; double arrow, fold change of 6 to 9; triple arrow, fold change of 10 or more. Increased, genes that had reads in the HSV-1 data set but not in the mock data set, making a null fold change calculation.

For relative quantification, SDHA was used as a reference gene (42). SDHA expression was validated as an appropriate reference gene for our studies by comparing threshold cycle (CT) values between mock- and HSV-1 infected samples and by analyzing its Pol II occupancy with the PRO-seq data (Fig. 5A and B). SDHA CT values between mock- and 3-h HSV-1-infected samples were similar in total RNA, nuclear mRNA, and cytoplasmic mRNA (Fig. 5A). Pol II occupancy across the SDHA gene was similar between mock- and HSV-1-infected samples, with a slight reduction in Pol II occupancy at the PPP region after HSV-1 infection but no change in occupancy in the body or termination A and B regions (Fig. 5B).

The results of the qRT-PCR assay are shown in Table 1. For some genes, termination extension could not be assessed because these genes did not meet the qualification of a termination A/B ratio of >2 in mock-infected samples. These cases are indicated by NA in Table 1 and are explained below.

USP8 had decreased Pol II at the PPP region but increased Pol II at every other region analyzed after HSV-1 infection, decreased transcript levels in the total RNA and nuclear mRNA samples, and no change in transcript levels in the cytoplasmic mRNA samples (Table 1). This suggests that the HSV-1-induced termination defects result in reduced nuclear transcript abundance. The lack of a change in USP8 cytoplasmic mRNA may be indicative of a relatively long USP8 mRNA half-life and/or its low rate of translation and availability to VHS processing (43).

MYC had no change in Pol II occupancy at the PPP and body after HSV-1 infection but had extended transcription termination, showed decreased transcript levels in total RNA (−3.9-fold), nuclear mRNA (−5.5-fold), and cytoplasmic mRNA (−2.8-fold). This suggests that the decreased MYC transcript levels are a result of aberrant transcription termination and subsequent degradation and failure to export, similar to the case for USP8.

The EGR1 gene locus showed an HSV-1-induced increase in Pol II at all regions analyzed and showed extension of its termination zone. This gene had increased transcript levels in total RNA and nuclear mRNA samples but decreased cytoplasmic mRNA. These data suggest that the termination defects brought about by HSV-1 infection have a larger effect on functional, exported transcripts than the enhanced recruitment of Pol II to the gene locus. The termination defects of this gene were apparent even when analyzing the difference in transcript levels between total RNA and polyadenylated nuclear mRNA, suggesting that the termination defects induced by HSV-1 lead to degradation of cellular RNA in the nucleus. This effect would be in addition to the expected VHS-mediated degradation in the cytoplasm.

FOSB RNA was not detectable in any mock RNA sample tested; however, it was measurable in all HSV-1 RNA samples. It was therefore not possible to calculate fold increases, so the effect is indicated by the word “increased” in Table 1. FOSB had increased Pol II occupancy at the PPP region and in the body region. There were no reads present in the termination A and B regions of the mock-infected samples, so comparative analysis of termination extension was not possible (indicated as NA in Table 1). However, in HSV-1-infected cells, there were more reads in the termination A region than in the termination B region of the gene, suggesting that the termination zone of FOSB was not dramatically affected by HSV-1 infection compared to other genes (Fig. 2F).

The analysis of c-FOS transcripts in total RNA and nuclear mRNA showed significant increases after infection. However, c-FOS transcripts in the cytoplasmic mRNA samples had a less-than-2-fold difference after infection. Pol II was recruited to the c-FOS promoter after infection and showed a greater level of PPP release, inasmuch as no reads were present in the c-FOS gene body in the mock samples. Like for FOSB, analysis of termination extension was not possible because the mock-infected samples did not allow identification of the termination zone. However, the qRT-PCR analysis suggests that there was termination extension in c-FOS after infection, because c-FOS transcripts were not changed substantially in cytoplasmic mRNA, suggesting poor export of these transcripts to the cytoplasm.

Analysis of JUNB Pol II occupancy and transcript levels showed no change in Pol II recruitment to the promoter but increased RNA Poll II release into the gene body, with proper termination conferring increased transcript levels in all RNA fractions analyzed.

The gene STUB1, which was analyzed as a representative gene with reduced Pol II levels, demonstrated no measurable difference in any RNA type (Table 1). STUB1 transcript levels were low, even without infection with HSV-1. Pol II occupancy in mock-infected samples extended far into the termination B region, giving STUB1 a large termination zone. Unlike EGR1, c-FOS, JUNB, JUN, and FOSB, which have mRNA half-lives of 60 min, most cellular mRNAs have half-lives much longer than 3 h. It follows that if the STUB1 transcript has a long half-life, we would expect no significant change in mRNA level despite a reduction in Pol II at the STUB1 gene locus. Its low abundance and its readout in previously published ribosomal profiling experiments (36) suggest that translation of STUB1 is not reduced after HSV-1 infection until well after 3 h, likely making VHS degradation of the STUB1 transcript undetectable at this time (43).

Functional clustering of genes with HSV-induced Pol II changes.

Functional annotation and clustering of the genes identified in Fig. 3B showed differences with interesting implications (Table 2). Almost 20% of genes with decreased Pol II in both the PPP and body regions encode integral components of the plasma membrane, (Table 2). Other genes with decreased Pol II occupancy that clustered with a P value of <0.05 encode products involved in transcriptional regulation, the Golgi apparatus, chromatin regulation, and DNA damage (Table 2).

TABLE 2.

Functional grouping of genes with increased, unchanged, or decreased Pol II occupancy at the PPP and body regions after 3 h of infection with HSV-1a

Function % of genes with:
Increased or unchanged Pol II Decreased Pol II
Extracellular exosome 15.20
Poly(A) RNA binding 9.40
Transcription regulation 8.04 15.90
Negative regulation of apoptotic processes 3.40
Cell-cell signaling 1.78
Viral transcription 1.33
Positive regulation of cell cycle 0.89
Integral component of membrane 19.80
Golgi apparatus 5.80
Chromatin regulation 3.80
DNA damage 2.91
Total % of genes that could be clustered 40.04 48.21
a

Genes were grouped using the DAVID Bioinformatics Database from the NIH NIAID and selected with a P value cutoff of <0.05.

About 15% of genes with increased or unchanged Pol II occupancy are involved in the extracellular exosome pathway (15.2%) (Table 2). Other gene groups altered in this way included those for RNA poly(A) binding, transcriptional regulation, negative regulation of apoptosis, cell-cell signaling, and viral transcription (Table 2).

It is important to note that only 40.04% of the genes with increased or unchanged Pol II occupancy and 48.21% of genes with decreased Pol II occupancy clustered into groups with recognizable functions at a P value cutoff of <0.05. This suggests that other mechanisms besides gene functionality play a role in how HSV-1 infection changes the Pol II profile on host genes. Such factors may include the nature of the respective promoter regions, nucleosome occupancy, or environmental signals.

DISCUSSION

Effects of HSV-1 alterations of Pol II occupancy on gene expression.

The data presented here further the current understanding of how HSV-1 infection modifies host gene expression and confirm a previous conclusion that HSV-1 infection inhibits efficient Pol II transcription termination on the majority of host genes (36), remarkably within 3 h of infection (Fig. 3C and 4D). The effect on termination correlates with decreased cytoplasmic mRNA levels of certain genes, such as EGR1 and MYC (Table 1), and is consistent with data from ribosomal profiling experiments (36).

Although the PRO-seq data show that Pol II levels are reduced on a majority of genes (Fig. 3B and 4C), HSV-1 selectively increases Pol II occupancy on others (Fig. 2B to F, 3B and C, 5B to D, and 4C; Table 1). This is only partly consistent with conclusions from ChIP-seq experiments conducted at 4 h postinfection, which suggested that HSV-1 infection results in a near-complete loss of Pol II from the host genome (35). Our results are consistent with microarray and qRT-PCR data that demonstrate that many host genes are upregulated by HSV-1 infection (32, 34, 44). The discrepancy between the PRO-seq and ChIP-seq results may be due to the nature of the assays. Unlike ChIP-seq, PRO-seq reports the positioning of Pol II directly and excludes certain biases inherent to immunoprecipitation, such as antibody binding and the effects of different antibody-to-target ratios.

The number of genes in infected cells with increased Pol II occupancy across the promoter and increased or unchanged Pol II in the gene body (596 genes) (Fig. 3A) is similar in number to the 450 genes with upregulated total RNA levels at 7 h postinfection (33, 34). Thus, increased Pol II occupancy, recruitment, and elongation correlate well with the selective increased RNA levels induced by HSV. It follows that these factors may have a larger impact on gene expression than increased RNA stability, as suggested previously (35).

The data in Table 1 show that the pattern of Pol II across the gene locus impacts the RNAs produced from most genes tested and their ability to enter the cytoplasm for translation (Table 1).

An exception to these general rules was STUB1, inasmuch as this gene showed decreased Pol II occupancy across the entire locus but demonstrated no change in transcript levels from any type of RNA analyzed (Fig. 2B; Table 1). We speculate that the high stability of STUB1 mRNA, the low rate of Pol II procession along the gene after HSV-1 infection, or the rate of translation of STUB1 mRNA may account for the discrepancy between high Pol II occupancy and unchanged RNA levels. Distinguishing between these possibilities requires further experiments beyond the scope of these studies.

The decreased transcript levels of MYC and EGR1 in cytoplasmic mRNA may be a combinatorial effect of impaired transcription termination and the presence of VHS. VHS activity might also contribute to the absence of a change in c-FOS mRNA in the cytoplasm despite a considerable increase in c-FOS transcripts in the total RNA and nuclear mRNA samples. It is possible that there are termination defects on c-FOS, but these defects could not be analyzed on a comparative basis due to lack of Pol II occupancy in the body and termination region in mock-infected cells. Because the qRT-PCR primers used in this study do not discern spliced from unspliced transcripts for any target gene, it is possible that the high levels of transcripts in the total RNA and nuclear mRNA fractions include aberrantly spliced and poorly terminated/polyadenylated transcripts which cannot be exported to the cytoplasm.

Despite the presence of VHS, FOSB and JUNB mRNAs accumulated to significantly higher levels in the cytoplasm after HSV-1 infection. These two genes had increased Pol II occupancy along their gene loci, with similar profiles (increased or unchanged Pol II at the PPP region and increased Pol II in the gene body) (Fig. 2F and 5D; see Table S2 in the supplemental material). JUNB had proper transcription termination (Table 1, Fig. 5D, and Table S2), and it is likely that FOSB also exhibited proper transcription termination (Fig. 2F), although lack of Pol II reads in mock-infected samples at the FOSB locus made it difficult to make conclusions about the role of HSV-1 in any putative alteration of the termination profile. These observations suggest that Pol II occupancy with this profile enhances productive transcription to levels that can overcome the nonselective endonucleolytic activity of VHS. Additionally, the values of cytoplasmic mRNAs of the genes analyzed correlate with ribosomal profiling data gathered by Rutkowski and others (36).

Functional implications of altered Pol II occupancy.

Many targets of activated mitogen-activated protein kinase (MAPK) signaling had increased or unchanged Pol II occupancy. Examples of these include MYC, EGR1, FOSB, c-FOS, and JUNB (Fig. 2D to F; Table 1) and JUN and FOSL (Table S2). These data are largely consistent with alterations of these transcript levels as measured from total RNA in cells infected with HSV-1 or pseudorabies virus (PRV) (32–34, 44).

The products of many of these genes modify the cell cycle and cellular stress responses, some of which lead to NF-κB and MAPK activation, which are linked to enhanced viral transcription and replication (45–48). Since HSV-1 activates these pathways, it is reasonable to hypothesize that controlling the levels of downstream targets should also be helpful for virus replication. For example, HSV-1 activation of the Jun N-terminal protein kinase (JNK) pathway (47, 48) may be useless if insufficient levels of the JNK target JUNB are present.

Several observations suggest that HSV-1 alters the cellular expression profile to promote its own replication. For example, the genes with functions in the extracellular exosome secretory pathway were the group represented with highest confidence in the functional annotation. This group may reflect the importance of the cellular exosome secretory pathway to viral particle egress and immune evasion (49–51). As another example, genes involved in poly(A) RNA binding and transcriptional regulation were heavily represented among those that remained transcriptionally active after HSV-1 infection (Table 2). These observations potentially coincide with HSV-1 manipulation of the termination of cellular transcription (36).

The functional annotation of genes with decreased transcriptional activity after HSV-1 infection also correlates with previously published data (34). The largest functional group of genes with downregulated Pol II occupancy were genes that encode integral membrane components (Table 2). These changes correlate with the reorganization of membranes during herpesvirus assembly and egress (52).

The functional annotation also showed that genes involved in transcriptional regulation appeared in both up- and downregulated gene sets after HSV-1 infection (Table 2; Fig. 3 and 4). Altering the expression of transcriptional activators and repressors may modulate and amplify HSV-1's ability to affect Pol II transcription. These groupings may provide mechanistic insights into how HSV-1 regulates transcription, and their analysis will be useful in future PRO-seq studies with HSV-1 mutants.

The ability of HSV-1 to modulate Pol II recruitment, initiation, elongation, and termination at such an early time point suggests that the viral immediate early genes or tegument proteins that enter the cell as virion components act to manipulate Pol II occupancy on most active host genes. The data presented here suggest that this manipulation involves multiple mechanisms to produce a cellular environment favorable to virus replication. Limitations of this study include the analysis of HEp-2 cells, a transformed cell line, at a single time point postinfection. Experiments to examine additional time points in primary cells and neuronal cells are under way.

PRO-seq has proven to be a powerful tool to analyze Pol II location in virus infection with unprecedented detail, and it is a less biased approach for this analysis than ChIP. It will be a useful tool to clarify the respective roles that viral genes play in the manipulation of host cell transcription.

MATERIALS AND METHODS

Cell lines and viruses.

HEp-2 cells were grown and maintained in Dulbecco's modified Eagle medium (DMEM) (Thermo Fisher) supplemented with 10% newborn calf serum (NBS) and penicillin-streptomycin at 37°C in a CO2 water-jacketed incubator. Drosophila S2 cells (ATCC) were grown as a loose monolayer in Schneider's medium (Lonza) supplemented with 10% fetal bovine serum at 23°C. The herpes simplex virus 1 F strain [HSV-1(F)] was grown, and titers were determined, in CV1 cells.

HSV-1 infections.

HEp-2 cells (4 × 107 cells) were used for each nuclear run-on replicate; each experiment contained 2 (preliminary nuclear run-on experiments) or 3 (PRO-seq and Drosophila nucleus spike-in PRO-seq) replicates of each mock- and HSV-1-infected cell group. HEp-2 cell monolayers were infected with HSV-1 at a multiplicity of infection (MOI) of 5. Mock-infected HEp-2 cells were exposed to the same medium that lacked virus.

Isolation of nuclei.

Cells were placed on ice, and their nuclei were immediately isolated following the protocol outlined previously (6, 8, 9). Briefly, cells washed with phosphate-buffered saline (PBS) were exposed to ice-cold swelling buffer (10 mM Tris-HCl [pH 7.5], 10% glycerol, 3 mM CaCl2, 2 mM MgCl2, 0.5 mM dithiothreitol [DTT], protease inhibitors [Roche], 4 U/ml RNase inhibitor [RNase Out; Thermo Fisher]) for 10 min. The cells were then removed from the dish using a cell scraper. Pelleted cells were resuspended in lysis buffer (10 mM Tris-HCl [pH 7.5], 10% glycerol, 0.5% Igepal, 3 mM CaCl2, 2 mM MgCl2, 0.5 mM DTT, protease inhibitors [cOmplete, EDTA-free protease inhibitor cocktail; Sigma], 4 U/ml RNase inhibitor), incubated on ice for 10 min, and then lysed with 100 strokes in a Dounce tissue homogenizer. Nuclear release was monitored with a light microscope. Isolated nuclei were centrifuged at 1,500 × g at 4°C for 5 min and washed twice with ice-cold lysis buffer and then one time with ice-cold freezing buffer (50 mM Tris-HCl [pH 8.0], 25% glycerol, 5 mM magnesium acetate, 0.1 mM EDTA, 5 mM DTT, and 4 U/ml RNase inhibitor). The nuclei were resuspended at a density of 2 × 107 nuclei/100 μl of freezing buffer and then flash frozen in liquid nitrogen before being stored at −80°C.

Nuclear run-on analysis.

Nuclear run-on reactions were carried out as described previously (8, 9). Briefly one volume of nuclear run-on reaction buffer (10 mM Tris-HCl [pH 8.0], 300 mM KCl, 1% Sarkosyl, 5 mM MgCl2, 1 mM DTT, 100 μM biotin-11-ATP, -CTP, -GTP, or -UTP [Perkin-Elmer], and 0.4 U/μl RNase inhibitor) was added to defrosted nuclei. Run-on occurred for 3, 5, or 20 min at 37°C under constant shaking on a vortex shaker and was stopped by the addition of TRIzol (Thermo Fisher). For the Drosophila S2 nucleus spike-in experiments, 2 × 104 Drosophila S2 nuclei were added to 2 × 107 HEp-2 nuclei after being defrosted. The nuclear run-on reaction buffer was added, and the run-on proceeded as described above.

To monitor the nuclear run-on reaction, and ensure that low background levels of nonbiotinylated RNA were present in the pulled-down library preparation, a nonbiotinylated nucleotide ([α-32P]CTP) was used in preliminary nuclear run-on reactions similar to what was described for the development of the global run-on sequencing method (GRO-seq) (6). Briefly, nuclear run-on reactions were carried out as described above except that the reaction mixture contained nonbiotinylated ATP and GTP, one-half the amount of unlabeled nonbiotinylated CTP, biotinylated UTP, and nonbiotinylated [α-32P]CTP. Nuclear run-on reactions proceeded for 5 and 20 min. RNA was collected with TRIzol, and then bead binding and washing occurred as described in the NextSeq500 library preparation protocol (see below). The RNA was hydrolyzed, and nucleoside triphosphates (NTPs) were removed using an RNase free P-30 column (Bio-Rad), before being blotted onto filter paper. The radioactivity on the filter paper was measured using a scintillation counter. Average counts per minute were graphed for the input, unbound, and bead-bound samples for each nuclear run-on time point.

NextSeq500 library preparation and sequencing.

For the library preparation, samples were prepared using the protocol provided by Edward Rice, as previously published (8, 9). Samples were extracted using TRIzol and then were partially hydrolyzed in 0.2 N NaOH for 20 min; unincorporated biotinylated nucleotides were removed using a P-30 column (Bio-Rad). Biotinylated transcripts were purified using streptavidin M280 Dynabeads (Thermo Fisher), and bead-bound complexes were washed twice in an ice-cold high-salt wash (50 mM Tris-HCl [pH 7.4], 2 M NaCl, 0.5% Triton X-100, 2 U/10 ml RNase inhibitor), twice in ice-cold medium-salt wash (10 mM Tris-HCl [pH 7.4], 300 mM NaCl, 0.1% Triton X-100, 2 U/10 ml RNase inhibitor), and once in ice-cold low-salt wash (5 mM Tris-HCl [pH 7.4], 0.1% Triton X-100, and 2 U/10 ml RNase inhibitor). Complexes were eluted from beads in two TRIzol extractions.

The 3′ RNA adapter with a 5′ phosphate group (5′Phos) and an inverted dT sequence (InvdT) at the 3′ end (5′Phos-GAUCGUCGGACUGUAGAACUCUGAAC-3′InvdT) was ligated to the biotinylated RNA using 10 U/μl of T4 RNA ligase I (New England BioLabs [NEB]) in the ligation mix (1× T4 RNA ligase 1 buffer, 1 mM ATP, 10% polyethylene glycol [PEG] 8000, and 20 units of RNase inhibitor). The 5′ caps of the RNAs were removed and the triphosphate group repaired using 10 units of RNA 5′-pyrophosphohydrolase (RppH) (NEB) in the RppH buffer mix (1× NEB buffer 2, 10 units RNase inhibitor). 5′-Hydroxyl repair occurred immediately after RppH treatment using 25 units of T4 polynucleotide kinase (PNK) (NEB) in the PNK reaction mix (1× PNK buffer, 1 mM ATP, 20 units RNase inhibitor). The 5′ RNA adapter (5′-CCUUGGCACCCGAGAAUUCCA-3′) was ligated using T4 RNA ligase in the ligation mix described above.

Biotinylated complexes were purified and reverse transcribed with SuperScript III reverse transcriptase (Thermo Fisher) in the RT mix (2.5 μl RNA PCR primer 1 [5′-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACG TTC AGA GTT CTA CAG TCC GA-3′], 0.625 mM each dATP, dCTP, dGTP, and dTTP, 1× first-strand synthesis buffer [Thermo Fisher], 5 mM DTT, and 20 units of RNase inhibitor). The cDNA was then PCR amplified with the Phusion high-fidelity DNA polymerase (NEB) in the PCR mix (1× GC buffer, 0.25 μM RNA PCR primer 1, a 0.25 μM concentration of one of the Illumina RNA PCR index primers, 0.25 mM each deoxynucleoside triphosphate [dNTP], and 0.4 units Phusion polymerase). PCR amplification was carried out to an optimized cycle number. The libraries were polyacrylamide gel purified in an 8% acrylamide gel in Tris-borate-EDTA (TBE), and primer dimers were removed by excising the library from the gel. The library was eluted from the gel, and prepared libraries were sent to the Cornell University sequencing facility for next-generation sequencing on the Illumina nextSeq500.

qRT-PCR analysis.

HEp-2 cells (8.8 × 106 cells/replicate) were infected with HSV-1 or mock infected, as described above. Cells were washed with cold PBS. Total RNA was collected using TRIzol (Thermo Fisher) following the manufacturer's protocol at 3 h postinfection. For the nuclear and cytoplasmic mRNAs, mock- and 3-h-HSV-1-infected cells were washed with PBS, and nuclei were isolated as described above with some modifications. After the cells were lysed with 1 ml buffer L, the lysis product was centrifuged at 15,000 × g at 4°C for 15 min. The supernatant (cytoplasmic fraction) was transferred to a new tube and kept on ice. The pellet of nuclei was lysed with TRIzol, and RNA was extracted. The cytoplasmic fraction was saved for oligo(dT) magnetic bead isolation of polyadenylated, cytoplasmic mRNA.

Oligo(dT) magnetic beads (Thermo Fisher) were used to isolate polyadenylated mRNA from both the nuclear RNA and the cytoplasmic fraction following manufacturer's protocols. The total and nuclear mRNA fractions were treated with DNase I using the Turbo DNA-free kit (Thermo Fisher). It was experimentally determined that the cytoplasmic mRNAs were free of DNA after isolation and did not need to be treated with DNase.

RNA was quantified, and 1 μg of total RNA, 500 ng of nuclear mRNA, and 50 ng of cytoplasmic mRNA were reverse transcribed using the Verso cDNA synthesis kit (Thermo Fisher). Relative qPCR was carried out using the iQ Sybr green master mix (Bio-Rad) on the ABI7900 real-time thermocycler. The host SDHA RNA was used as a reference gene (42), and primer sequences for SDHA and the various target genes are listed in Table 3. The primers for EGR1 and c-FOS were previously published (53). Reactions were performed in three technical replicates, and conditions followed the iQ Sybr green manufacturer's recommendations. Statistical analysis was done using a two-way analysis of variance (ANOVA) in Graph Pad Prism with three independent biological replicates. Only differences of 2-fold and greater were considered biologically relevant.

TABLE 3.

Primer sets used for qRT-PCR analysis

Gene Forward primer Reverse primer
SDHA 5′GGACAACTGGAGGTGGCATT3′ 5′CCGTCATGTAGTGGATGGCA3′
FOSB 5′CCTTCCACCAGCGGAACTAC3′ 5′CCGGTTCCTGCATTTAGCTG3′
JUNB 5′GCACAAGATGAACCACGTGAC3′ 5′AGGTTGGTGTAAACGGGAGG3′
STUB1 5′GAAAGTCGAATGTGTGTGGCG3′ 5′GCTCTTAAGGGTGGGCGTT3′
EGR1 5′TACGAGCACCTGACCGCAG3′ 5′CACCAGCACCTTCTCGTTGTT3′
USP8 5′GCGTCACGGAAAGAAGCACT3′ 5′GGGCACTGTGCACATAACTCT3′
MYC 5′TGTCAAGAGGCGAACACACA3′ 5′GCTTGGACGGACAGGATGTA3′
c-FOS 5′AGGAGGGAGCTGACTGATACA3′ 5′GCAGACTTCTCATCTTCTAGTT3′

Bioinformatics.

The raw sequences were analyzed using the SMIC supercomputer at Louisiana State University and the pipeline developed by the Danko lab at Cornell University (https://github.com/Danko-Lab/utils/tree/master/proseq). This pipeline removed adapter sequences from the reads and filtered out reads shorter than 16 bases. It then mapped the reads to the human hg19 and hg38 and Drosophila melanogaster dm3 genome builds. The data were viewed on the integrative genomics viewer (37, 38).

SeqMonk (https://www.bioinformatics.babraham.ac.uk/projects/seqmonk/) was used to quantify Pol II occupancy on different gene regions and to perform DESeq2 statistics using the three independent biological replicates (39, 40). The gene regions defined in SeqMonk were as follows: the promoter-proximal region (transcription start site [TSS] to +100 bp downstream of the TSS), the gene body (+100 bp downstream of the TSS to the PAS), the termination A region (the PAS to +1,500 bp downstream of the PAS), and the termination B region (+1,500 bp downstream of the PAS to 5,000 bp downstream of the PAS). Scatter plots showing Pearson correlation coefficients were generated using SeqMonk software by comparing read numbers from gene body probes between replicates and between replicate sets.

Genes with altered Pol II occupancy were analyzed for functional clustering using the DAVID bioinformatics resources available from NIAID (https://david.ncifcrf.gov/home.jsp) (54, 55).

Accession number(s).

The raw sequence reads and processed BigWig files from all experiments have been deposited in the GEO database (https://www.ncbi.nlm.nih.gov/geo/) under accession number GSE106126.

Data availability.

All data from the DESeq2 statistical analysis can be found in the supplemental material.

Supplementary Material

Supplemental material

ACKNOWLEDGMENTS

Portions of this research were conducted with high-performance computing resources provided by Louisiana State University (http://www.hpc.lsu.edu). In particular, we thank James Lupo from the Louisiana State University Center for Computation and Technology for his assistance, guidance, and patience in setting up the PRO-seq bioinformatics pipeline on the LSU HPC SuperMic cluster. We also acknowledge Edward Rice for sharing his nuclear run-on protocols and invaluable advice on PRO-seq library preparation and Elizabeth Mayton for her help with optimization of the qRT-PCR experiments.

This work was supported by the School of Veterinary Medicine, Louisiana State University, and Public Health Service grants NIH R01 AI 52341 to J.D.B. and NHGRI R01 HG009309 to C.G.D.

Footnotes

Supplemental material for this article may be found at https://doi.org/10.1128/JVI.02184-17.

REFERENCES

  • 1.Whitley R, Kimberlin DW, Prober CG. 2007. HSV-1 and 2: pathogenesis and disease, p 589–601. In Arvin A, Campadelli-Fiume G, Mocarski E, Moore PS, Roizman B, Whitley R, Yamanishi K (ed), Human herpesviruses: biology, therapy, and immunoprophylaxis. Cambridge University Press, Cambridge, United Kingdom. [PubMed] [Google Scholar]
  • 2.Buratowski S. 2009. Progression through the RNA polymerase II CTD cycle. Mol Cell 36:541–546. doi: 10.1016/j.molcel.2009.10.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Carey M, Peterson CL, Smale ST. 2009. Transcriptional regulation in eukaryotes: concepts, strategies, and techniques, 2nd ed Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [Google Scholar]
  • 4.Komarnitsky P, Cho EJ, Buratowski S. 2000. Different phosphorylated forms of RNA polymerase II and associated mRNA processing factors during transcription. Genes Dev 14:2452–2460. doi: 10.1101/gad.824700. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Sogaard TM, Svejstrup JQ. 2007. Hyperphosphorylation of the C-terminal repeat domain of RNA polymerase II facilitates dissociation of its complex with mediator. J Biol Chem 282:14113–14120. doi: 10.1074/jbc.M701345200. [DOI] [PubMed] [Google Scholar]
  • 6.Core LJ, Waterfall JJ, Lis JT. 2008. Nascent RNA sequencing reveals widespread pausing and divergent initiation at human promoters. Science 322:1845–1848. doi: 10.1126/science.1162228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Danko CG, Hah N, Luo X, Martins AL, Core L, Lis JT, Siepel A, Kraus WL. 2013. Signaling pathways differentially affect RNA polymerase II initiation, pausing, and elongation rate in cells. Mol Cell 50:212–222. doi: 10.1016/j.molcel.2013.02.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Kwak H, Fuda NJ, Core LJ, Lis JT. 2013. Precise maps of RNA polymerase reveal how promoters direct initiation and pausing. Science 339:950–953. doi: 10.1126/science.1229386. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Mahat DB, Kwak H, Booth GT, Jonkers IH, Danko CG, Patel RK, Waters CT, Munson K, Core LJ, Lis JT. 2016. Base-pair-resolution genome-wide mapping of active RNA polymerases using precision nuclear run-on (PRO-seq). Nat Protoc 11:1455–1476. doi: 10.1038/nprot.2016.086. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Ni Z, Saunders A, Fuda NJ, Yao J, Suarez JR, Webb WW, Lis JT. 2008. P-TEFb is critical for the maturation of RNA polymerase II into productive elongation in vivo. Mol Cell Biol 28:1161–1170. doi: 10.1128/MCB.01859-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Jonkers I, Lis JT. 2015. Getting up to speed with transcription elongation by RNA polymerase II. Nat Rev Mol Cell Biol 16:167–177. doi: 10.1038/nrm3953. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Proudfoot NJ. 2016. Transcriptional termination in mammals: stopping the RNA polymerase II juggernaut. Science 352:aad9926. doi: 10.1126/science.aad9926. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Fong N, Brannan K, Erickson B, Kim H, Cortazar MA, Sheridan RM, Nguyen T, Karp S, Bentley DL. 2015. Effects of transcription elongation rate and Xrn2 exonuclease activity on RNA polymerase II termination suggest widespread kinetic competition. Mol Cell 60:256–267. doi: 10.1016/j.molcel.2015.09.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Sanso M, Levin RS, Lipp JJ, Wang VY, Greifenberg AK, Quezada EM, Ali A, Ghosh A, Larochelle S, Rana TM, Geyer M, Tong L, Shokat KM, Fisher RP. 2016. P-TEFb regulation of transcription termination factor Xrn2 revealed by a chemical genetic screen for Cdk9 substrates. Genes Dev 30:117–131. doi: 10.1101/gad.269589.115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Glover-Cutter K, Kim S, Espinosa J, Bentley DL. 2008. RNA polymerase II pauses and associates with pre-mRNA processing factors at both ends of genes. Nat Struct Mol Biol 15:71–78. doi: 10.1038/nsmb1352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Gromak N, West S, Proudfoot NJ. 2006. Pause sites promote transcriptional termination of mammalian RNA polymerase II. Mol Cell Biol 26:3986–3996. doi: 10.1128/MCB.26.10.3986-3996.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Dolken L, Ruzsics Z, Radle B, Friedel CC, Zimmer R, Mages J, Hoffmann R, Dickinson P, Forster T, Ghazal P, Koszinowski UH. 2008. High-resolution gene expression profiling for simultaneous kinetic parameter analysis of RNA synthesis and decay. RNA 14:1959–1972. doi: 10.1261/rna.1136108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Triezenberg SJ, LaMarco KL, McKnight SL. 1988. Evidence of DNA: protein interactions that mediate HSV-1 immediate early gene activation by VP16. Genes Dev 2:730–742. doi: 10.1101/gad.2.6.730. [DOI] [PubMed] [Google Scholar]
  • 19.Stern S, Tanaka M, Herr W. 1989. The Oct-1 homoeodomain directs formation of a multiprotein-DNA complex with the HSV transactivator VP16. Nature 341:624–630. doi: 10.1038/341624a0. [DOI] [PubMed] [Google Scholar]
  • 20.Katan M, Haigh A, Verrijzer CP, van der Vliet PC, O'Hare P. 1990. Characterization of a cellular factor which interacts functionally with Oct-1 in the assembly of a multicomponent transcription complex. Nucleic Acids Res 18:6871–6880. doi: 10.1093/nar/18.23.6871. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Babb R, Huang CC, Aufiero DJ, Herr W. 2001. DNA recognition by the herpes simplex virus transactivator VP16: a novel DNA-binding structure. Mol Cell Biol 21:4700–4712. doi: 10.1128/MCB.21.14.4700-4712.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Dembowski JA, DeLuca NA. 2015. Selective recruitment of nuclear factors to productively replicating herpes simplex virus genomes. PLoS Pathog 11:e1004939. doi: 10.1371/journal.ppat.1004939. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Wagner LM, DeLuca NA. 2013. Temporal association of herpes simplex virus ICP4 with cellular complexes functioning at multiple steps in PolII transcription. PLoS One 8:e78242. doi: 10.1371/journal.pone.0078242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Zaborowska J, Baumli S, Laitem C, O'Reilly D, Thomas P. H., O'Hare P, Murphy S. 2014. Herpes simplex virus 1 (HSV-1) ICP22 protein directly interacts with cyclin-dependent kinase (CDK)9 to inhibit RNA polymerase II transcription elongation. PLoS One 9:e107654. doi: 10.1371/journal.pone.0107654. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Bastian TW, Rice SA. 2009. Identification of sequences in herpes simplex virus type 1 ICP22 that influence RNA polymerase II modification and viral late gene expression. J Virol 83:128–139. doi: 10.1128/JVI.01954-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Rice SA, Davido DJ. 2013. HSV-1 ICP22: hijacking host nuclear functions to enhance viral infection. Future Microbiol 8:311–321. doi: 10.2217/fmb.13.4. [DOI] [PubMed] [Google Scholar]
  • 27.Smith RW, Malik P, Clements JB. 2005. The herpes simplex virus ICP27 protein: a multifunctional post-transcriptional regulator of gene expression. Biochem Soc Trans 33:499–501. doi: 10.1042/BST0330499. [DOI] [PubMed] [Google Scholar]
  • 28.Sandri-Goldin RM. 2011. The many roles of the highly interactive HSV protein ICP27, a key regulator of infection. Future Microbiol 6:1261–1277. doi: 10.2217/fmb.11.119. [DOI] [PubMed] [Google Scholar]
  • 29.Kwong AD, Frenkel N. 1987. Herpes simplex virus-infected cells contain a function(s) that destabilizes both host and viral mRNAs. Proc Natl Acad Sci U S A 84:1926–1930. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Oroskar AA, Read GS. 1989. Control of mRNA stability by the virion host shutoff function of herpes simplex virus. J Virol 63:1897–1906. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Sorenson CM, Hart PA, Ross J. 1991. Analysis of herpes simplex virus-induced mRNA destabilizing activity using an in vitro mRNA decay system. Nucleic Acids Res 19:4459–4465. doi: 10.1093/nar/19.16.4459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Ray N, Enquist LW. 2004. Transcriptional response of a common permissive cell type to infection by two diverse alphaherpesviruses. J Virol 78:3489–3501. doi: 10.1128/JVI.78.7.3489-3501.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Taddeo B, Esclatine A, Roizman B. 2004. Post-transcriptional processing of cellular RNAs in herpes simplex virus-infected cells. Biochem Soc Trans 32:697–701. doi: 10.1042/BST0320697. [DOI] [PubMed] [Google Scholar]
  • 34.Taddeo B, Esclatine A, Roizman B. 2002. The patterns of accumulation of cellular RNAs in cells infected with a wild-type and a mutant herpes simplex virus 1 lacking the virion host shutoff gene. Proc Natl Acad Sci U S A 99:17031–17036. doi: 10.1073/pnas.252588599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Abrisch RG, Eidem TM, Yakovchuk P, Kugel JF, Goodrich JA. 2015. Infection by herpes simplex virus 1 causes near-complete loss of RNA polymerase II occupancy on the host cell genome. J Virol 90:2503–2513. doi: 10.1128/JVI.02665-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Rutkowski AJ, Erhard F, L'Hernault A, Bonfert T, Schilhabel M, Crump C, Rosenstiel P, Efstathiou S, Zimmer R, Friedel CC, Dolken L. 2015. Widespread disruption of host transcription termination in HSV-1 infection. Nat Commun 6:7126. doi: 10.1038/ncomms8126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Robinson JT, Thorvaldsdottir H, Winckler W, Guttman M, Lander ES, Getz G, Mesirov JP. 2011. Integrative genomics viewer. Nat Biotechnol 29:24–26. doi: 10.1038/nbt.1754. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Thorvaldsdottir H, Robinson JT, Mesirov JP. 2013. Integrative genomics viewer (IGV): high-performance genomics data visualization and exploration. Brief Bioinform 14:178–192. doi: 10.1093/bib/bbs017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Farthing CR, Ficz G, Ng RK, Chan CF, Andrews S, Dean W, Hemberger M, Reik W. 2008. Global mapping of DNA methylation in mouse promoters reveals epigenetic reprogramming of pluripotency genes. PLoS Genet 4:e1000116. doi: 10.1371/journal.pgen.1000116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Love MI, Huber W, Anders S. 2014. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15:550. doi: 10.1186/s13059-014-0550-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Tian B, Manley JL. 2013. Alternative cleavage and polyadenylation: the long and short of it. Trends Biochem Sci 38:312–320. doi: 10.1016/j.tibs.2013.03.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Watson S, Mercier S, Bye C, Wilkinson J, Cunningham AL, Harman AN. 2007. Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses. Virol J 4:130. doi: 10.1186/1743-422X-4-130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Feng P, Everly DN Jr, Read GS. 2005. mRNA decay during herpes simplex virus (HSV) infections: protein-protein interactions involving the HSV virion host shutoff protein and translation factors eIF4H and eIF4A. J Virol 79:9651–9664. doi: 10.1128/JVI.79.15.9651-9664.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Bedadala GR, Palem JR, Graham L, Hill JM, McFerrin HE, Hsia SC. 2011. Lytic HSV-1 infection induces the multifunctional transcription factor early growth Response-1 (EGR-1) in rabbit corneal cells. Virol J 8:262. doi: 10.1186/1743-422X-8-262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Gregory D, Hargett D, Holmes D, Money E, Bachenheimer SL. 2004. Efficient replication by herpes simplex virus type 1 involves activation of the IkappaB kinase-IkappaB-p65 pathway. J Virol 78:13582–13590. doi: 10.1128/JVI.78.24.13582-13590.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Patel A, Hanson J, McLean TI, Olgiate J, Hilton M, Miller WE, Bachenheimer SL. 1998. Herpes simplex type 1 induction of persistent NF-kappa B nuclear translocation increases the efficiency of virus replication. Virology 247:212–222. doi: 10.1006/viro.1998.9243. [DOI] [PubMed] [Google Scholar]
  • 47.Roberts KL, Baines JD. 2011. UL31 of herpes simplex virus 1 is necessary for optimal NF-kappaB activation and expression of viral gene products. J Virol 85:4947–4953. doi: 10.1128/JVI.00068-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Hargett D, McLean T, Bachenheimer SL. 2005. Herpes simplex virus ICP27 activation of stress kinases JNK and p38. J Virol 79:8348–8360. doi: 10.1128/JVI.79.13.8348-8360.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Hogue IB, Scherer J, Enquist LW. 2016. Exocytosis of alphaherpesvirus virions, light particles, and glycoproteins uses constitutive secretory mechanisms. mBio 7:e00820-. doi: 10.1128/mBio.00820-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Kalamvoki M, Du T, Roizman B. 2014. Cells infected with herpes simplex virus 1 export to uninfected cells exosomes containing STING, viral mRNAs, and microRNAs. Proc Natl Acad Sci U S A 111:E4991–E4996. doi: 10.1073/pnas.1419338111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Kalamvoki M, Roizman B. 2014. HSV-1 degrades, stabilizes, requires, or is stung by STING depending on ICP0, the US3 protein kinase, and cell derivation. Proc Natl Acad Sci U S A 111:E611–E617. doi: 10.1073/pnas.1323414111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Roller RJ, Baines JD. 2017. Herpesvirus nuclear egress. Adv Anat Embryol Cell Biol 223:143–169. doi: 10.1007/978-3-319-53168-7_7. [DOI] [PubMed] [Google Scholar]
  • 53.Birkenheuer CH, Brewster CD, Quackenbush SL, Rovnak J. 2015. Retroviral cyclin controls cyclin-dependent kinase 8-mediated transcription elongation and reinitiation. J Virol 89:5450–5461. doi: 10.1128/JVI.00464-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Huang da W, Sherman BT, Lempicki RA. 2009. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 4:44–57. doi: 10.1038/nprot.2008.211. [DOI] [PubMed] [Google Scholar]
  • 55.Huang da W, Sherman BT, Lempicki RA. 2009. Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res 37:1–13. doi: 10.1093/nar/gkn923. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

Data Availability Statement

All data from the DESeq2 statistical analysis can be found in the supplemental material.


Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES