Endophyte-Mediated Modulation of Defense-Related Genes and Systemic Resistance in Withania somnifera (L.) Dunal under Alternaria alternata Stress

ABSTRACT

Endophytes have been explored and found to perform an important role in plant health. However, their effects on the host physiological function and disease management remain elusive. The present study aimed to assess the potential effects of endophytes, singly as well as in combination, in Withania somnifera (L.) Dunal, on various physiological parameters and systemic defense mechanisms against Alternaria alternata. Seeds primed with the endophytic bacteria Bacillus amyloliquefaciens and Pseudomonas fluorescens individually and in combination demonstrated an enhanced vigor index and germination rate. Interestingly, plants treated with the two-microbe combination showed the lowest plant mortality rate (28%) under A. alternata stress. Physiological profiling of treated plants showed improved photosynthesis, respiration, transpiration, and stomatal conductance under pathogenic stress. Additionally, these endophytes not only augmented defense enzymes and antioxidant activity in treated plants but also enhanced the expression of salicylic acid- and jasmonic acid-responsive genes in the stressed plants. Reductions in reactive oxygen species (ROS) and reactive nitrogen species (RNS) along with enhanced callose deposition in host plant leaves corroborated well with the above findings. Altogether, the study provides novel insights into the underlying mechanisms behind the tripartite interaction of endophyte-A. alternata-W. somnifera and underscores their ability to boost plant health under pathogen stress.

IMPORTANCE W. somnifera is well known for producing several medicinally important secondary metabolites. These secondary metabolites are required by various pharmaceutical sectors to produce life-saving drugs. However, the cultivation of W. somnifera faces severe challenge from leaf spot disease caused by A. alternata. To keep pace with the rising demand for this plant and considering its capacity for cultivation under field conditions, the present study was undertaken to develop approaches to enhance production of W. somnifera through intervention using endophytes. Application of bacterial endophytes not only suppresses the pathogenicity of A. alternata but also mitigates excessive ROS/RNS generation via enhanced physiological processes and antioxidant machinery. Expression profiling of plant defense-related genes further validates the efficacy of bacterial endophytes against leaf spot disease.

INTRODUCTION

According to the FAO, it has been estimated that nearly 80% of people in developing countries rely on plant-derived drugs for their health care, which reflects the high global importance of medicinal plants (1). Withania somnifera (L.) Dunal, popularly known as “Ashwagandha,” is an erect, evergreen, perennial, branched undershrub that has been extensively used in traditional medicinal systems for over 3,000 years. The therapeutic properties of this plant are attributed to its ample number of therapeutically important compounds, such as alkaloids, withanolides, glycowithanolides, flavanol glycosides, steroidal lactones, and polyphenolics (2). With a worldwide increase in demand for herbal products and compounds obtained from W. somnifera, the need to boost its commercial cultivation has been accentuated. In India, about 1,500 metric tons (1,500,000 kg) of W. somnifera plant parts are produced through cultivation, in contrast to an annual requirement of about 7,000 metric tons (7,000,000 kg) (3). Under natural conditions, the plant is vulnerable to a number of pests and pathogens, among which leaf spot disease, caused by Alternaria alternata, is considered the most prominent one (4, 5).

To date, only a few chemical fungicides, like bavistin, mancozeb, antracol, and captra, were found to be effective in inhibiting A. alternata spore germination in dose-dependent manners (6). Due to the adverse effects of chemical fungicides, a suitable biological control of leaf spot disease of W. somnifera is the need of the hour for better yield and sustainable agriculture. Thus, to find safer and eco-friendly strategies to manage the pathogenicity of A. alternata in W. somnifera, exploitation of bacterial endophytes as biocontrol agents is an intriguing alternative to the use of chemical fungicides. Antagonistic endophytic microbes are promising groups of microorganisms that can provide frontline resistance and encourage growth by different modes of actions (7–9). Host plant resistance against the diverse group of pathogens is provoked by various microbial elicitors, i.e., those linked with a range of defense regulatory enzymes, such as phenylalanine ammonia lyase (PAL), peroxidase (PO), polyphenol oxidase (PPO), superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APx), guaiacol peroxidase (GPx), and induced accumulation of phenols and flavonoids (10). The increased activity of the antioxidant and reactive oxygen species (ROS)-scavenging machinery may also be important in the resistance process observed in plants (11). Plant-pathogen-microbe interaction is a complex process and must be studied at multiple levels (structural, physiological, and biochemical levels) using different approaches. Understanding the microbe-pathogen-associated changes in the host is a prerequisite for designing a target-based approach for disease management. The expression level of defense-induced genes during disease progression in W. somnifera has been previously described (12–14). However, to date, no information regarding the possible mechanism of the synergistic effect of bacterial endophytes on host physiology along with the modulation of the defense signaling pathway to endure biotic stress is available. Considering the above facts, efforts were made to examine the effects of synergistic antagonistic endophytes on the structural, physiological, and biochemical parameters and the possible defense mechanism adopted by W. somnifera under A. alternata stress.

RESULTS

Effects of selected isolates on plant biomass and mortality.

Application of the endophytic bacterial isolates, viz., Bacillus amyloliquefaciens and Pseudomonas fluorescens (Fig. 1), singly and in combination, caused significant differences in plant biomass and mortality compared to the pathogen (A. alternata)-inoculated, non-endophyte-treated control plants (Fig. 2). Plants treated with a combination of the two microbial endophytes (here referred to as combination treatment) significantly enhanced the vigor index (1.47-fold) and seed germination (1.32-fold) compared to control plants (see Fig. S1 in the supplemental material). Treatment with endophytes significantly (P ≤ 0.05) promoted plant growth in term of fresh and dry yield when plants were grown in pots with or without fungal infection (Table 1). Compared to controls, plants treated with the endophytes showed a significant enhancement in fresh and dry weight (1.7- to 2.5-fold and 1.43- to 2.19-fold, respectively) (Table 1). A. alternata infection significantly suppressed plant growth compared to that seen in noninfected pots. After A. alternata inoculation, the efficacy of treatment with endophytes against the pathogen was demonstrated by a drastic reduction in plant mortality (Table 1). The most efficient pathogen management occurred with the combination treatment (P ≤ 0.05), which yielded 28% plant mortality, followed by use of B. amyloliquefaciens singly (36%) and P. fluorescens singly (40%) (Table 1). The correlation analysis was further confirmed by the fact that linear and significant associations were observed among various plant growth parameters (see Table S1 in the supplemental material).

FIG 1.

Scanning electron micrographs of mycolytic activity of bacterial endophytes B. amyloliquefaciens (BA) and P. fluorescens (PF) against A. alternata (AA).

FIG 2.

Effects of endophytic bacteria B. amyloliquefaciens (BA) and P. fluorescens (PF) singly as well as in combination on W. somnifera during A. alternata (AA) infection under greenhouse conditions.

TABLE 1.

Effects of endophytic bacteria B. amyloliquefaciens and P. fluorescens singly as well as in combination in W. somnifera inoculated with pathogen A. alternata for promotion of plant health parameters and mortality rate under greenhouse conditions^a

Treatment	Shoot length (cm)	Root length (cm)	Fresh wt (g)	Dry wt (g)	Mortality rate (%)
Control	41.60 ± 1.38ab	11.20 ± 1.50a	31.88 ± 1.22c	7.74 ± 1.30a	0.00 ± 0.00d
Control + AA	32.40 ± 2.07b	8.60 ± 1.11a	19.38 ± 1.51d	5.56 ± 1.40a	76.00 ± 2.30a
BA + AA	48.60 ± 1.96ab	13.20 ± 1.23a	37.36 ± 1.52bc	8.58 ± 1.20a	36.20 ± 2.13b
PF + AA	43.80 ± 1.80ab	11.80 ± 1.57a	33.00 ± 0.58c	7.98 ± 0.60a	40.50 ± 1.15b
BA + PF + AA	45.80 ± 2.42ab	16.20 ± 1.15a	41.42 ± 1.48ab	11.04 ± 0.55a	28.60 ± 1.09c
BA	52.60 ± 1.40a	18.80 ± 1.15a	39.04 ± 2.04bc	9.08 ± 11.68a	0.00 ± 0.00d
PF	48.20 ± 1.03ab	13.80 ± 2.03a	34.82 ± 1.78bc	8.54 ± 2.57a	0.00 ± 0.00d
BA + PF	56.40 ± 1.38a	19.00 ± 1.70a	49.26 ± 1.58a	12.18 ± 2.20a	0.00 ± 0.00d

^aValues are means ± standard errors (SE) for three replicates. Means followed by the same lowercase letter(s) within a column are not significantly different according to Tukey's multiple-comparison test (P < 0.05). The data presented are from representative experiments that were repeated at least twice with similar results. BA, B. amyloliquefaciens; PF, P. fluorescens; AA, A. alternata.

Physiological performance of plants under different treatments.

Microbial application significantly ameliorated the plants' physiological performance under biotic stress by increasing the rate of photosynthesis, ranging from 1.83- to 2.67-fold increments compared to the rate seen in infected control plants (Fig. 3a). The leaf transpiration rate was diminished progressively in all treatments compared to their respective controls. Plants treated with microbes showed 1.46- to 2.7-fold increments compared to the infected plants, and the maximum value was recorded for combination-treated plants (2.7-fold) (Fig. 3b). Similarly, greater levels of stomatal conductance were observed (1.65-, 1.75-, and 2.58-fold) with the application of P. fluorescens, B. amyloliquefaciens, and combination treatments, respectively (Fig. 3c). Water use efficiency (WUE) was found to be maximal under B. amyloliquefaciens (1.30-fold), P. fluorescens (1.10-fold), and combination (2.10-fold) treatments in plants undergoing pathogenic stress (Fig. 3d), whereas the leaf average relative conductivity of the infected plants was elevated up to 1.73-fold in the combination treatment compared to control plants, signifying that the leaf plasma membrane was injured because of pathogenicity (Fig. 3e). Additionally, the levels of total chlorophyll, carotenoids, and anthocyanin were improved after B. amyloliquefaciens (2.16-, 1.97-, and 2.09-fold), P. fluorescens (2.11-, 1.53-, and 2.31-fold), and the combination (2.46-, 2.34-, and 2.57-fold) treatments compared to the pathogen-infected control (Fig. 4a to d). Positive and direct associations were found between net photosynthesis and stomatal conductance (r = 0.92), between transpiration rate and net photosynthesis (r = 0.92), and between transpiration rate and stomatal conductance (r = 0.86). Similarly, WUE and anthocyanin were found to be correlated with net photosynthesis (r values of 0.84 and 0.903, respectively), stomatal conductance (r values of 0.84 and 0.80, respectively), and transpiration rate (r values of 0.95 and 0.74, respectively) (Table S1).

FIG 3.

Effects of endophytic bacteria B. amyloliquefaciens (BA) and P. fluorescens (PF) singly as well as in combination on net photosynthesis (a), transpiration rate (b), stomatal conductance (c), water use efficiency (WUE) (d), and relative conductivity (e) of W. somnifera in the presence and absence of A. alternata. Error bars represent the standard errors for six replicates. Significance of differences between treatments and pathogen control: *, P < 0.05; **, P < 0.01; NS, nonsignificant.

FIG 4.

Effects of endophytic bacteria B. amyloliquefaciens (BA) and P. fluorescens (PF) singly as well as in combination on total chlorophyll a + b (a), total chlorophyll a/b (b), carotenoids (c), and anthocyanin (d) contents of W. somnifera in the presence and absence of A. alternata. Error bars represent the standard errors for six replicates. Significance of differences between treatments and pathogen control: *, P < 0.05; **, P < 0.01; NS, nonsignificant.

Plant defense and antioxidant enzyme profiling.

In our study, temporal alterations were observed at 24 to 96 h after pathogen inoculation (hapi) in defense and antioxidant enzymes. Significantly, the highest phenylalanine ammonia lyase (PAL) activity was observed in B. amyloliquefaciens- and P. fluorescens-treated plants (1.68- to 2.35-fold) after 24 hapi, and this activity was slightly reduced at 72 hapi (1.61- to 2.15-fold) compared to what was observed in infected plants (see Fig. S2a in the supplemental material). The maximum PPO activity (2.03-fold) was observed to be higher at 72 hapi in the combination-treated plants than in the infected control (Fig. S2b). To further investigate the impact of potent inducers during pathogenicity, total phenolic content was monitored in all treatments at different time intervals. The level of total phenolics showed a pattern similar to that of PAL and was higher in the plants treated with the two endophytes (109.65 mmol gallic acid g⁻¹ fresh weight [FW]) at 48 hapi under pathogenic stress conditions (Fig. S2c).

In an early response to pathogen infection, alterations in the levels of the different ROS-scavenging molecules were also monitored over a period of 24 to 96 hapi. The levels of SOD and PO activities were observed to increase constantly and achieved a maximum at 72 hapi in the combination treatment (2.23- and 2.3-fold, respectively), followed by plants treated with a single inoculation with pathogen, and finally the infected control plants (Fig. S2d and S2e). However, a decrease in the activity of lipid peroxidation (LPX) was detected in all the single-microbe-treated as well as the combination-treated plants throughout the experimental period compared to nontreated, infected plants. Moreover, the maximum reduction in LPX (3.10-fold) was observed in the combination-treated plants under pathogenic stress (Fig. S2f). Further, the highest CAT activity was recorded in the combination-treated plants (1.37-fold) at 72 hapi (Fig. S3a). The maximum APx activity was observed in combination-treated plants with pathogen inoculation and was initiated early (24 hapi) with 71.9 U, reaching a maximum of 112.33 U (1.70-fold increase) at 72 hapi and after that remaining stable (Fig. S3b). Similarly, GPx and total flavonoid content (TFC) activities in the combination treatment challenged with A. alternata were significantly higher (1.77- and 1.91-fold, respectively) at 72 hapi and further declined at 96 hapi compared to A. alternata control plants (Fig. S3c and S3d). The results obtained from the present study were further validated by principal-component analysis (PCA), as clustering of different treatments was observed, with the first group having healthy control and endophyte-treated plants without pathogen, the second with pathogen-inoculated control (Control + AA), the third with single-microbe treatment (B. amyloliquefaciens or P. fluorescens) with pathogen, and the fourth with the two-microbe combination treatment with pathogen (Fig. 5). The combination treatment with pathogen formed a separate cluster in which the defense- and antioxidant-related parameters such as PAL, PPO, total phenolic content (TPC), SOD, CAT, PO, APx, GPx, and TFC were increased and LPX and plant mortality were significantly reduced (Fig. 5).

FIG 5.

Principal-component analysis (PCA) of various defense enzymes, plant growth, and mortality with respect to different treatments, viz., B. amyloliquefaciens (BA) and P. fluorescens (PF) singly as well as in combination, in the presence and absence of A. alternata (AA) (shown by circles).

Histological detection of H₂O₂, O₂⁻, and cell death.

The maximum DAB (3, 3′-diaminobenzidine) polymerization (brown color deposition) was detected in the leaves of control plants challenged with pathogen, whereas no visible deposition was localized in the leaves of microbe-treated plants under pathogenic stress (Fig. 6a). Also, less localization was observed in single-microbe (B. amyloliquefaciens or P. fluorescens) inoculation treatments of plants infected with pathogen. Similarly, leaves stained with Nitro Blue Tetrazolium (NBT) dye for the detection of the superoxide (O₂⁻) free radicals showed a significant enhancement in the level of superoxide radicals in pathogen-infected plants only, which was observed as a purple deposition on treated leaves (Fig. 6b). However, the combination-treated plants showed a reduction in superoxide radical formation. Additionally, trypan blue staining further confirmed the potential role of endophytes in programmed cell death (PCD), as less colorization was seen in the endophyte-treated plants than in the infected control (Fig. 6c).

FIG 6.

Histochemical detection of H₂O₂ by DAB staining (a), superoxide radical by NBT staining (b), and programmed cell death by trypan blue (c) in leaves of W. somnifera by DAB staining after treatment with endophytic bacteria inoculated with or without A. alternata (AA). Control, untreated and uninoculated; control + AA, untreated, A. alternata inoculated; BA, B. amyloliquefaciens used singly; PF, P. fluorescens used singly; BA + PF, B. amyloliquefaciens and P. fluorescens used in combination.

Detection of ROS, RNS, and callose deposition.

High deposition levels of callose in guard cells were found in the leaves of plants treated with the two microbes, whereas infected controls showed only necrotic regions of infection (Fig. 7). The individual microbial treatments were also able to immunize the leaf tissue (by callose deposition) against pathogenic stress (Fig. 7). Furthermore, H₂DCFDA (2′,7′-dichlorodihydrofluorescein diacetate) was used to determine the level of reactive oxygen species in treated leaves (Fig. 7). This observation demonstrated that the combination-treated plants efficiently reduced the effect of pathogenicity, which was evident through lesser ROS detection than in the pathogen-alone control (Fig. 7). Similarly, the detection of NOS-like activity by DAF-FM DA (4-amino-5-(N-methylamino)-2′,7′-difluorofluorescein diacetate) staining revealed an intensification of fluorescence signal in the pathogenic control compared to healthy control (Fig. 7). The intensity of nitric oxide (NO) was further completely abolished in the combination-treated plants under stress conditions, suggesting that the endophytes effectively suppressed the toxic effects of a nitro-oxidative burst. Additionally, in the individual microbial treatments smaller amounts of NO were localized near the guard cell (primary site of the infection) (Fig. 7).

FIG 7.

Microscopic detection of callose deposition and reactive oxygen and nitrogen species (magnification, ×10; bar, 100 μm) in leaves of W. somnifera after treatment with endophytic bacteria inoculated with or without A. alternata (AA). Control, untreated and uninoculated; control + AA, untreated, A. alternata inoculated; BA, B. amyloliquefaciens used singly; PF, P. fluorescens used singly; BA + PF, B. amyloliquefaciens and P. fluorescens used in combination.

Expression analysis of genes confirming defense.

The expression levels of pathogenesis-related (PR) genes were analyzed to further validate the contribution of both inducers (B. amyloliquefaciens and P. fluorescens) in induction of plant resistance. Most of the defense-modulating genes showed maximum upregulation in the combination-treated plants at 72 hapi. Among all genes, the maximum increment was observed in lignin-forming anionic peroxidase (39.9-fold), followed by PR-3 (a class IV chitinase), PR-3 (a class II chitinase), PR-12 (defensin), hevein-like protein (HEL), lipoxygenase (LOX), β-1,3-glucanase, and PR-1 with 18.70-, 16.22-, 14.64-, 13.1-, 10.90-, 10.40-, and 7.23-fold-greater expression at 72 hapi in the combination-treated plants under pathogen stress (Fig. 8; see also Fig. S4, S5, S6, and S7 in the supplemental material). Furthermore, in pathogen-infected controls, a gradual reduction in fold expression increase was recorded as the severity of pathogenicity increased, while the other treatments showed the reduction after 72 hapi. The expression levels of 12 defense and oxidative stress responsive marker genes in W. somnifera at different time intervals are shown as an expression matrix (Fig. 8).

FIG 8.

Differential expression of pathogenesis-related genes in W. somnifera inoculated with endophytic bacteria B. amyloliquefaciens (BA) and P. fluorescens (PF) singly as well as in combination, with and without challenge with pathogen A. alternata. The heat map was generated based on the fold change values in the treated samples compared with untreated pathogen-challenged control plants. The color scale for fold change values is shown at the top.

DISCUSSION

This study clearly demonstrated that when applied singly and in combination, B. amyloliquefaciens and P. fluorescens enhanced the tolerance of W. somnifera plants against biotic stress at both physiological and molecular levels. The enhanced seed germination, seedling vigor index, and yield attributes along with reduced mortality rate could be possibly due to the growth-promoting properties of endophytes. The higher availability of nutrients might be effectively utilized by the plant, which resulted in its enhanced growth. Similar results have been reported in previous studies in which the enhanced seed germination and seedling vigor index were observed in endophyte-treated seeds over the control (15, 16).

It was previously suggested that the progression of foliar disease caused a devastating effect on the plant's physiological processes, i.e., net photosynthesis, stomatal conductance, transpiration rate, and water use efficiency (17). When pathogens invade the leaves, they can either pass through the stomatal pores or breach the cuticle (18). This might lead to a decrease in net photosynthetic rate and a disruption in the metabolic pathways of pathogen control. The findings were well corroborated with a previous report in which plant photosynthesis, transpiration rate, stomatal conductivity, and water use efficiency were found to be higher in microbe-treated chickpea plants infected with Sclerotium rolfsii (19). The rate of photosynthesis is interconnected with stomatal apertures and water use efficiency. The fungal infection affects the plant photosynthetic pathway via decreasing the activity of mesophyll cells and ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) along with disruption of stomatal regulation during transpiration (20). The improved rate of photosynthesis, stomatal conductance, transpiration rate, and water use efficiency in endophyte-treated plants may be the explanation for the low plant mortality. The incremental rise in the photosynthesis rate might accelerate one or more mechanisms, such as those promoting an increase in the concentrations of chlorophyll, anthocyanin, and carotenoids, which are accompanied by enhanced plant growth (21).

Under various biotic stresses, a decrease in the generation of ROS and RNS initiates programmed cell death and therefore performs a vital role in suppressing the pathogenic infection (22). ROS include H₂O₂ and O₂⁻, which are frequently accumulated in the plant tissues as by-products of several biochemical reactions and whose production is triggered by pathogen invasion (23). Alternatively, the decrease in localization of ROS, RNS, H₂O₂, O₂⁻, and PCD in endophyte-treated plants might be due to the potentiality of endophytes that enhance the antioxidant machinery, such as SOD, CAT, PO, APx, GPx, and TFC. These findings corroborated well with a previously published result whereby these antioxidants were found to be higher in chickpea treated with endophytes under pathogenic stress than in untreated chickpea (8).

Since our results confirmed reductions in ROS, RNS, H₂O₂, O₂⁻, and PCD, which are reported to play a role in defense mechanisms, in endophyte-treated plants, we next studied the level of defense enzymes in different treatments. In the present study, the selected endophytes not only reduced plant mortality and but also systemically stimulated tolerance via enhancing the host plant defense system. Collectively, the improved activities of PAL, PPO, and TPC, which are essential defense enzymes of plants, can be positively correlated with the enhanced host resistance under pathogenic stress (24). The stimulation of phenolics is directly interconnected with disease resistance as well as plant resistance against fungal phytopathogens. Additionally, generation of phenols is also connected with PAL activity, which is well known to stimulate resistance to biotic stress in the host plants (25). The enhanced level of LPX in pathogen-infected plants could also be integrated with higher plant mortality. In addition to the above-described defense enzymes, callose plays a vital function in plants' defensive system against pathogens and strengthens cell walls during pathogenic invasion (26). The PCA further reconfirmed maximum accumulation of defense and antioxidant-related parameters such as PAL, PPO, TPC, SOD, PO, CAT, APx, GPx, and TFC in the combination treatment with pathogen.

Plants employ several mechanisms to protect themselves against various pathogen infections, which include the activation of defense-related genes, resulting in the synthesis of various antimicrobial substances (27). Most of the defense-related genes are induced by the activation of different signaling molecules such as salicylic acid (SA), jasmonic acid (JA), or ethylene (ET) to govern antimicrobial activity via hydrolysis of fungal cells, synthesis of toxic substances, and stimulation of antioxidants (28). In the present study, the biocontrol efficiency of endophytes against leaf spot disease in W. somnifera was further validated by the expression profiling of SA- and JA-responsive genes. The temporal upregulation of defense response genes was recorded in plants subjected to the combination treatment under pathogenic stress, which is directly or indirectly involved in inducing the host plant immunity. Overall, the previous findings of the lowest mortality of pathogen-infected plants after application of endophytes in tomato (7), olive (29), rice (30), and chickpea (8) via SA- or JA-mediated defense mechanisms were further proved in the present study.

Results of the present investigation suggest that endophytic bacteria B. amyloliquefaciens and P. fluorescens in the inert tissues of W. somnifera possibly execute a significant role in enhancing physiological performance, the expression of defense genes, including those encoding enzymes, and callose deposition under biotic stress. Additionally, we have demonstrated that the interaction between endophytes and fungal pathogen leads to significant alterations in ROS-mitigating pathways in the host plant. Our findings strongly highlight reduced pathogen growth in two-microbe combination-treated plants compared to growth in non-endophyte-treated controls, showing the potential of these microbes to act as resistance inducers. For future prospects, we propose that the reduction of the pathogenicity of leaf spot disease by the application of these endophytes can improve the health of W. somnifera under natural conditions.

MATERIALS AND METHODS

Host-pathogen-endophyte interaction under greenhouse conditions.

Freshly grown cultures of pure endophytic bacterial isolates Bacillus amyloliquefaciens KT962915 and Pseudomonas fluorescens KY630510 were incubated at 28 ± 2°C on a rotary shaker (120 rpm) for 24 h for mass production, and the pellet density was maintained in 0.85% saline to 1 × 10⁸ CFU ml⁻¹. We previously isolated B. amyloliquefaciens and P. fluorescens with high antifungal and chitinase activity against A. alternata (Fig. 1). The fungal pathogen A. alternata was isolated from naturally infected leaves of W. somnifera (4), and its spore suspension was maintained at up to 3 × 10⁵ spores ml⁻¹. Surface-sterilized (with 2% NaOCl) seeds of W. somnifera (NMITLI-135) were coated with selected isolates, individually as well as in combination (1:1, vol/vol) by using 2% (wt/vol) carboxyl methyl cellulose (HiMedia, India) in 0.85% saline. Treated seeds were propagated according to the treatments in the growth chamber (12-h photoperiod at 24 ± 2°C) for 15 days. After proper germination, seedlings of uniform length (7 to 9 cm; 2-leaf stage) were transplanted in plastic pots (15 cm by 10 cm) filled with 0.5 kg sandy soil. The treatments were as follows: B. amyloliquefaciens and P. fluorescens singly and in combination were inoculated with or without pathogen along with two controls, one noninfected and the other infected with the pathogen, respectively. A spore suspension of A. alternata was applied on the aerial part of the plant 1 week after transplantation (4). Simultaneously, B. amyloliquefaciens and P. fluorescens individually and in combination were further introduced to the aerial part of plants soon after pathogen treatment. All the treated plants were arranged in a randomized block design under greenhouse conditions with 12 replicates, and the experiment was repeated three times.

Physiological performance.

Physiological parameters, such as root length, shoot length, fresh weight, dry weight, and mortality rate, were recorded at the fruiting stage of the plant (19). Furthermore, the percentage of seed germination and the vigor index of treated seeds were determined by using the “between-paper method” (31). Fundamental plant processes such as net photosynthesis (A), stomatal conductance (g_s), transpiration (E), and water use efficiency (WUE) were observed in the complete extended leaf (at the 3rd node of the plant) at the flowering stage by using the LI-COR 6400 gas exchange portable photosynthesis system (LI-COR, Lincoln, NE, USA). Subsequently, the concentrations of anthocyanin, carotenoid, and chlorophyll in the treated plants were estimated by spectrophotometric assays (32–34).

Defense-related enzymes and antioxidant profiling.

Seedlings of W. somnifera were harvested regularly at 0, 24, 48, 72, and 96 h after pathogen inoculation (hapi). Plants were uprooted randomly from each pot and stored in liquid nitrogen. Plant material (1 g) from each treatment was homogenized in extraction buffer (10 mM sodium phosphate buffer, pH 6.0, containing 1% [wt/vol] polyvinylpolypyrrolidone, 0.3 mM phenylmethylsulfonyl fluoride, and 1 mM EDTA) at 4°C. All the enzymatic assays were repeated six times in triplicate.

Phenylalanine ammonia lyase (PAL) activity was analyzed and calculated by using the calibration curve of mole trans-cinnamic acid gram⁻¹ protein hour⁻¹ (35). The activity of phenol peroxidase (PPO) was expressed as change in optical density (OD) minute⁻¹ gram⁻¹ FW, and the absorbance was recorded at 495 nm at 30-s intervals up to 3 min (36). Total phenolic content (TPC) was expressed as gallic acid equivalent gram⁻¹ of plant tissue (37). Superoxide dismutase (SOD) activity was examined by evaluating its efficacy to inhibit photochemical reduction of NBT (Nitro Blue Tetrazolium) using the riboflavin-methionine system (38). Further, peroxidase (PO) activity was measured by the addition of enzymatic extract (50 μl) in 0.05 M pyrogallol and 1% H₂O₂ (39). The lipid peroxidation (LPX) activity of treated leaves was determined using thiobarbituric acid (TBA) and was expressed as nanomole gram⁻¹ FW (40). Catalase (CAT) activity was determined on the basis of the rate of oxidation of H₂O₂ (41). Ascorbate peroxidase (APx) was measured according to a previously described method (42) and was expressed as nanomole ascorbate oxidized minute⁻¹ milligram⁻¹ protein. Glutathione peroxidase (GPx) was measured according to the protocol of Hemeda and Klein (43) and was expressed as units at 470 nm (milligram protein)⁻¹ minute⁻¹. Total flavonoid content (TFC) was calculated as described earlier (44).

Histochemical detection of H₂O₂, O₂⁻, and programmed cell death.

DAB (3,3′-diaminobenzidine) staining was carried out to detect the H₂O₂ in plant leaves (45). Leaves were collected after 72 h of A. alternata infection and stained in sodium phosphate buffer (10 mM; pH 7.0) containing DAB (1 mg ml⁻¹) and 0.05% Tween 20. Brown depositions on the surface of leaves were localized after 4 to 5 h of incubation in staining solution in the dark. Stained leaves were fixed in bleaching solution (ethanol-acetic acid-glycerol, 3:1:1 [vol/vol]) at 40°C until the complete elimination of chlorophyll. Leaves were visualized against a contrasting background for proper documentation. For superoxide detection, leaves were immersed in a staining solution (10 mM potassium phosphate buffer, pH 7.8, containing 0.1% NBT and 10 mM sodium azide) and were infiltrated under vacuum (∼10,000 to 11,500 Pa) for 2 to 5 min and further incubated for 2 to 3 h in the dark (46). The reaction was stopped by the addition of bleaching solution at 40°C. Purple depositions on leaves indicated the presence of superoxide radicals. Trypan blue staining was carried out to detect cell death in treated leaves (47). Briefly, the leaves were placed in staining solution containing trypan blue overnight at room temperature and subsequently bleached using bleaching solution prior to visualization.

Detection of ROS, RNS, and callose deposition.

For ROS localization, treated leaves were immersed in H₂DCF-DA (Molecular Probes, Invitrogen) solution for 5 min and washed with phosphate buffer (47). Green fluorescence on the adaxial side of leaves was visualized under a confocal laser scanning microscope (Carl Zeiss LSM 510 META) with excitation at 480/40 nm and emission at 527/30 nm. For RNS, the treated leaves were incubated in a 20 μM solution of DAF-FM DA for 30 min in the dark. After incubation, the leaf samples were washed with 20 mM phosphate buffer (pH 7.0) and were visualized under the microscope with excitation at 488 nm and emission at 505/30 nm (48). To detect the callose deposition, the leaves were placed in K₂HPO₄ (150 mM; pH 9.5) containing 0.1% aniline blue for 1 h followed by washing with sterile distilled water, and the stained leaves were examined under the microscope (49).

Real-time gene expression profiling of defense-related genes.

Total RNA was extracted from leaves of different treatment groups along with their respective controls by using the plant total RNA kit (Sigma-Aldrich). The cDNA was reverse transcribed by 5 μg of total RNA with oligo(dT) primer (Thermo Fisher Scientific, United States). A reverse transcription quantitative-PCR (qRT-PCR) was carried out in a Stratagene Mx3005P instrument (Agilent Technologies, USA) using Brilliant III Ultra-Fast SYBR green qPCR master mix (Agilent Technology, USA). Actin was used as a control, and the primers used in this study are listed in Table 2. The heat map was generated using MEV software. The various treatments are clustered according to the similarity of their gene expression using hierarchical clustering.

TABLE 2.

Details of primer pairs for pathogenesis-related genes in W. somnifera used for qRT-PCR data

Gene	Protein	Forward/reverse primer sequences, 5′–3′	Reference
WsAct	Actin	AGATATTCAGCCTCTTGTCTGTG/ATTGAGCCTCATCACCAACATA	Dasgupta et al. (12)
WsPR1	PR-1-type pathogenesis-related protein	GCTTCTCATCGACCCACATCTT/GGAAAGCGGCGGCTAGA	Singh et al. (13)
WsB13G	β-1,3-Glucanase (WsB13G)	ACATTGCTTCGTCTATCAAAGTTTC/CACCATGAGGTAAGAACCAGTT	Dasgupta et al. (12)
WsCHTN1	JA-dependent-class I chitinase (PR-3)	CCCCATGAATAGGGACCATCT/GAGAAGTCTGAGCCAGAAAGGC	Singh et al. (13)
WsCHTNII	Class II chitinase (PR-3)	CACAAGACAACAAGCCATCATG/TAGAATCCAATTCGATCATCCACTT	Dasgupta et al. (12)
WsCHTNIV	Class IV chitinase (PR-3)	CTTCAAGCAATAATGGAGGTTCAG/CTCACGCTTAGAATCATCAGTAGA	Dasgupta et al. (12)
WsTHAU	Thaumatin-like protein (PR-5)	ACGTCTTTGACACCGATGAATA/ACATAGTCAGTAGAAGAGCAAGTG	Dasgupta et al. (12)
WsSPI	Serine protease inhibitor-like protein (PR-6)	ATGCCCGTCAAATTCATTAAGTTT/TCCTCCAGTCTCCAACAATCTA	Dasgupta et al. (12)
WsHEL	JA-dependent hevein-like protein (PR-4)	AATGTTGATCCTGGGGAAAAC/GCATCGACCTCATTCAAACAT	This study
WsPRX	Lignin-forming anionic peroxidase (PR-9)	TCCACATTCTATGATCGCACTT/AACGCAGTCTTCTCACTAACAA	Dasgupta et al. (12)
WsPR10	JA-dependent PR-10-type pathogenesis related-protein (PR-10)	AGTTGCTCATATAGAAGTCAAGTGT/TCCATCATAGTTCAATCTCCATTCA	Dasgupta et al. (12)
WsDFSN	Defensin (PR-12)	TGCTGGTTTTTGCTACTGAGGCA/CAGAAGCAACGGCGACGGAATC	Dasgupta et al. (12)
WsLOX	JA-dependent lipoxygenase (LOX)	GCTGAATGGACAAAGGACAAA/CACCTTCACTTGTTGGGAAAA	This study

Statistical analysis.

The results were analyzed using SPSS version 18.0 software with advanced models (SPSS Japan, Tokyo, Japan). Differences between means were analyzed using Tukey's multiple-comparison test (P < 0.05). The Student t test was used for statistical analysis of the data in the experiments of gas exchange parameters and defense enzyme/gene(s) between control and treated plants. Linear correlation coefficients were calculated among various physiological and biochemical parameters. The principal-component analysis (PCA) was applied to produce components suitable to be used as response variables in the present analysis.