Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2018 Apr 4.
Published in final edited form as: Arch Biochem Biophys. 2016 Jan 14;592:27–37. doi: 10.1016/j.abb.2016.01.009

Functional importance of αIle-346 and αIle-348 in the catalytic sites of Escherichia coli ATP synthase

Chao Zhao 1,#, Hiba Syed 1, Sherif S Hassan 2,4, Vineet K Singh 3, Zulfiqar Ahmad 1,*
PMCID: PMC5884630  NIHMSID: NIHMS754288  PMID: 26775572

Abstract

We studied the functional role of highly conserved VISIT-DG sequence residues αIle-346 and αIle-348 in the catalytic sites of Escherichia coli F1Fo ATP synthase. αIle-346 is in close proximity, 2.98 and 3.63 Å, to the two known phosphate binding residues αR376 and βR182; αIle-348 is situated within 3.66 Å from βR182. Single or double mutants of both αI346 and αI348 resulted in a variable loss of oxidative phosphorylation and ATPase activity. Azide, fluoroaluminate, and fluoroscandium caused insignificant to significant inhibition of mutants. Whereas the wild-type enzyme was completely inhibited by NBD-Cl (7-chloro-4-nitrobenzo-2-oxa-1, 3-diazole), a variable extent of inhibition was observed for αI346 and αI348 mutants. MgPi protection against NBD-Cl induced inhibition of wild-type, αI346, and αI348 demonstrated that, although strongly conserved, αI346 and αI348 have no direct role in phosphate binding. Insertion of Arginine in the form of αI346R/βR182A, αI346R/αR376A, or αI348R/βR182A was able to compensate for the absence of known phosphate-binding Arginine residues βR182 and αR376. Results also suggest that αIle-346 and αIle-348 seem to have functional importance in upholding the phosphate-binding subdomain and transition state stabilization in the catalytic sites of E. coli ATP synthase.

Keywords

Keywords: F1Fo ATP synthase, E. coli ATP synthase, ATPase inhibition, oxidative phosphorylation, Pi binding residues

Introduction

F1Fo ATP synthase, the smallest known biological nanomotor, is the main source of ATP generation in almost all organisms. Structurally, Escherichia coli has the simplest form of ATP synthase with five subunits arranged in the water-soluble F1 sector (α3β3γδε) and three subunits in the membrane-associated Fo sector (ab2c10) [1, 2]. Structural and functional aspects of membrane bound F1Fo ATP synthase enzyme are highly conserved among different species. ATP hydrolysis and synthesis take place at the α/β interface, whereas proton transport occurs through the membrane-embedded Fo sector [3, 4].

Catalytic and motor functions of ATP synthase are connected to the Pi (inorganic phosphate) binding residues and to residues surrounding the Pi binding subdomain in the catalytic sites [5]. MgPi protection against 7-chloro-4-nitrobenzo-2-oxa-1, 3,-diazole (NBD-Cl) induced inhibition of ATPase activity provides an indirect but useful method to measure Pi binding [6]. Because NBD-Cl covalently interacts with β297 in the βE catalytic site [7], the protection by Pi specifies that Pi binds at the βE (empty) catalytic site. Modification of the Pi protection assay initially used in mitochondrial membranes for E. coli, purified F1 or membrane bound F1Fo, allowed us to previously investigate the role of nine residues, βArg-246, βAsn-243, αArg-376, βLys-155, βArg-182, αPhe-291, αSer-347, Thr-349, and αGly-3511, in Pi binding. Four residues, βArg-246, αArg-376, βLys-155, and βArg-182, were directly involved in Pi binding by forming a triangle across Pi, and two residues, αSer-347 and αThr-349, were indirectly involved in Pi binding through their interaction with βArg-246 and βArg-182 (see Fig. 1) [5, 8–15]. Three residues, βAsn-243, αPhe-291, and αGly-351, did not have a direct role in Pi binding even though all the above residues are positioned in close proximity to the phosphate analogs AlF3 or SO42− in X-ray structures of catalytic sites. [16, 17]. Fig.1A shows an SO42− ion thought to mimic phosphate while in Fig.1B fluoroaluminate is in the position of the phosphate. αSer-347, αThr-349, and αGly-351 are all part of the highly conserved VISIT-DG sequence. The VISIT-DG sequence is situated in close proximity to the α/β interface flanking the Pi binding subdomain in the catalytic sites (Fig. 1B).

Figure 1. X-ray structures of ATP synthase catalytic sites showing spatial relationship of α-VISIT-DG sequence residue αI346 and αI348.

Figure 1

Open in a new tab

(A) The βADP+Pi (β-half-closed site) site in the AlF4−-inhibited enzyme [17]. The sulfate ion is thought to occupy the position of natural Pi. (B) The βDP site in the AlF4−-inhibited enzyme. [17]. Figure was generated by PDB files 1H8E using Rasmol software. Residue numbers are based on E. coli numbering.

Menz et al [17] determined the bovine ATP synthase X-ray crystallographic structure that showed the transition state analog MgADP.AlF4− trapped in catalytic sites (Fig. 1B). In this complex, the fluoroaluminate group occupies the position of the ATP-γ-phosphate in the predicted transition state. Senior et al [3] proposed the mechanism of Pi and MgADP condensation. Pedersen’s group [18] reported the transition state-like structure of F1 from rat liver crystallized with the Pi analog vanadate (Vi). The MgVi-F1 complex inhibited the catalytic activity to the same extent as the MgADP-Vi-F1 complex, suggesting that ADP was not essential. In another study, we observed that neither purified F1 nor membrane bound F1Fo from E. coli was inhibited by MgVi or MgADP-Vi [9]. Therefore, fluoroaluminate and fluoroscandium were used to assess the potential to stabilize the transition state complex [5, 8–11, 14, 15].

The first high-resolution crystal structure of E. coli F1 sector was resolved by Cingolani and Duncan [19]. Resolution of the E. coli structure provides more opportunities for the development of effective antimicrobial drugs in comparison to mitochondrial ATP synthase [19, 20], such as the newly developed anti-tuberculosis drug bedaquiline that targets bacterial ATP synthase [21]. Unfortunately, the E. coli crystallographic structure [20] does not contain sulfate, phosphate, fluoroaluminate, fluoroscandium, or bound NBD-Cl making it unsuitable for the identification, characterization, and molecular modeling of Pi binding residues in the catalytic sites of E. coli. However, the mitochondrial ATP synthase structure with bound phosphate analogs and about 70% homology to the E. coli sequence can be used to study the Pi binding residues [16, 17, 22].

The well-preserved nature and contiguous location of VISIT-DG sequence residues with the Pi binding subdomain in the catalytic sites is indicative of their direct or indirect role in Pi binding and maintenance of the Pi binding subdomain. In the absence of direct Pi binding or release assay MgPi protection against NBD-Cl inhibition and the transition state analog induced inhibition profiles confidently allow us to investigate the direct or indirect role of residues in Pi binding. This manuscript describes the functional importance of two highly conserved α-subunit VISIT-DG sequence residues, αIle-346 and αIle-348, in Pi binding and their possibility of compensating for the other known Pi binding residues. Figure 1B shows the position of αIle-346 and αIle-348 residues with respect to other known Pi binding residues in the catalytic sites. The strongly conserved nature and proximity of αI346 and αI348 to the Pi binding subdomain residues resulted in the following study questions: What is the purpose of non-polar hydrophobic side chains of αI346 and αI348 in the polar Pi binding subdomain? Do αIle-346 and αIle-348 directly or indirectly participate in Pi binding? Will the mutations αI346A/D/Q/R or αI348A/D/Q/R have any effect on transition state formation? Moreover, will αI346R or αI348R be able to compensate for the nearby known Pi binding residues βArg-246, βArg-182, or αArg-376?

Materials and Methods

E.coli wild-type and mutant strains

The wild-type E. coli strain used was pBWU13.4/DK8 [23]. Mutant strains were generated by the Vandeyar et al method [24]. Oligonucleotide-directed mutagenesis was performed using the M13mp18 template containing the HindIII-Xba1 fragment from pSN6. Plasmid pSN6 expresses all the ATP synthase genes and has the βY331W mutation from plasmid pSWM4 [25] introduced on a Sac1-Eag1 fragment into pBWU13.4 [23]. Mutagenic oligonucleotides used in this study are listed in Table 1. The presence of correct mutations and absence of undesired changes in sequence was confirmed by DNA sequencing. All the mutations were transferred to pSN6 on a Csp451 (an isoschizomer of BstBI) and Pml1 fragment, generating the new single plasmids pZA65(αI346A), pZA66(αI346D), pZA67(αI346Q), pZA68(αI346R), pZA69(αI348A), pZA70(αI348D), pZA71(αI348Q), pZA72(αI348R), and pZA73(αR376A). Double mutants pZA74(αI346R/αR182A), pZA75(αI346R/αR376A), pZA76(αI346R/βR246A), pZA77(αI348R/αR182A), pZA78 (αI348R/αR376A), and pZA79 (αI348R/βR246A) were generated by combining pZA65-pZA72 fragments on pZA24, pZA73, and pZA7 plasmids. All plasmids were transformed into the DK8 strain [26] from which ATP synthase genes were deleted for expression of the mutant enzymes. All mutant strains also contained the βY331W mutation. This mutation is valuable tool for measuring nucleotide binding parameters [25] and has no significant effect on enzyme function. Although Trp mutation was not used in this study, the βY331W mutation was included for possible future use.

TABLE 1.

List of oligonucleotides

Plasmids Mutations Sequence
pZA65 αI346A CGACCAACGTGGCGTCCATTACCGATGG
pZA66 αI346D CCGACCAACGTAGACTCCATTACCGATGG
pZA67 αI346Q CCGACCAACGTACAGTCCATTACCGATGG
pZA68 αI346R CGACCAACGTAAGATCTATTACCGATGG
pZA69 αI348A CCAACGTAATCAGCGCTACCGATGGTCAG
pZA70 αI348D CCAACGTAATCTCAGATACCGATGGTCAG
pZA71 αI348Q CCAACGTAATCTCCCAGACCGATGGTCAG
pZA72 αI348R CGTAATCTCTAGAACCGATGGTCAGATC
pZA24 βR182Aa GGCGTAGGTGAAGCTACTCGTGAGGG
pZA73 αR376A CGGGTATTTCCGTATCGGCCGTTGGTGGTGCAGC
pZA7 βR246Ab GACAACATCTATGCATACACCCTGGC
pZA74 αI346R/αR182A pZA24 fragment added on plasmid pZA68
pZA75 αI346R/αR376A pZA73 fragment added on plasmid pZA68
pZA76 αI346R/βR246A pZA768 fragment added on plasmid pZA7
pZA77 αI348R/αR182A pZA24 fragment added on plasmid pZA72
pZA78 αI348R/αR376A pZA73 fragment added on plasmid pZA72
pZA79 αI348R/βR246A pZA72 fragment added on plasmid pZA7
Open in a new tab

Bold and underline bases introduce the mutation and new restriction site.

a

taken from ref (9)

b

taken from ref (15)

Preparation of E. coli membranes, measurement of growth yield in limiting glucose medium, and assay of membrane bound F1Fo ATPase activity

E. coli membrane bound F1Fo ATP synthase were prepared by the Senior et al method [27]. Notably in this procedure, initial membrane bound F1Fo pellets are washed three times. The first wash is done in a buffer containing 50 mM TES pH 7.0, 15% glycerol, 40 mM 6-aminohexanoic acid, and 5 mM p-aminobenzamidine. The next two washes are carried out in a buffer containing 5 mM TES pH 7.0, 15% glycerol, 40 mM 6-aminohexanoic acid, 5 mM p-aminobenzamidine, 0.5 mM DTT, and 0.5 mM EDTA. Before the experiments, membranes are washed two additional times by resuspension and ultracentrifugation in 50 mM TrisSO4 pH 8.0 and 2.5 mM MgSO4. These extra washes are meant to reduce the null mutant to a true zero activity. Thus, low activities observed for mutants are their own and not that of any contaminants. Growth yield in limiting glucose was measured as described previously [28]. ATPase activity was measured in a 1 ml ATP assay buffer containing 10 mM NaATP, 4 mM MgCl2, and 50 mM TrisSO4 pH 8.5 at 37°C. Reactions were started by addition of membrane bound F1Fo and stopped by addition of 1 ml SDS to a final concentration of 3.3%. Taussky and Shorr reagent was used to measure the released Pi [29]. Reaction times for 20–30 µg wild-type membrane bound F1Fo protein were 5–10 min, and reaction times for 40–60 µg membrane bound F1Fo protein were 30–50 min. All reactions were found to be linear with respect to time and protein concentration. The purity of membrane bound F1Fo was checked by SDS-gel electrophoresis on 10% acrylamide gels and by immunoblotting with rabbit polyclonal anti-F1-α and anti-F1-β antibodies as described previously [30] and shown in Fig 2.

Figure 2. Immunoblot of wild-type purified F1, wild-type membrane bound F1Fo, and mutant membrane bound F1Fo ATP synthase with anti-F1-α antibody.

Figure 2

Open in a new tab

Wild-type (WT) purified F1 (0.4µg), WT membrane bound F1Fo, and mutant membrane bound F1Fo preparations (4µg) were run on 10% SDS-polyacrylamide gel along with null mutant pUC118 (4µg). Protein bands were transferred to nitrocellulose and immunoblotted using anti-F1-α antibody.

Inhibition of ATPase activity by NBD-Cl and protection by MgADP or MgPi

NBD-Cl stock solution was prepared in dimethyl sulfoxide (DMSO) and protected from light. Membrane bound F1Fo (0.2–0.5 mg/ml) were reacted with NBD-Cl for 60 min in the dark, in T8 buffer (50 mM TrisSO4 pH 8.0), containing 2.5 mM MgSO4 at room temperature then 50 µl aliquots were transferred to 1ml of ATP assay buffer to determine ATPase activity. For protection from NBD-Cl inhibition, F1Fo membranes were preincubated 60 min with ADP or Pi at room temperature before addition of NBD-Cl. MgSO4 and ADP or Pi were present in equimolar concentrations in the reaction assay. Blank controls contained protein in T8 buffer with no added NBD-Cl. Up to 10 mM of MgADP or 50 mM of MgPi alone were shown to have no inhibitory effect. [9, 15].

Reversal of NBD-Cl inhibited ATPase activity by DTT

For DTT induced reversal of NBD-Cl inhibition, membrane bound F1Fo were first reacted with NBD-Cl (150 µM) for 1 h at room temperature in the dark. Then, 4 mM DTT was added and incubation continued for 1 h at room temperature before ATPase assay. Control samples without NBD-Cl or DTT were included and incubated for the same time periods.

Inhibition of ATPase activity by azide, fluoroaluminate, or fluoroscandium

Azide induced inhibition was measured by preincubating membrane bound F1Fo with varied concentrations of sodium azide for 30 min. Then, 1 ml ATPase assay buffer was added to measure the activity. Fluoroaluminate or fluoroscandium induced inhibition was measured by incubating membrane bound F1Fo for 60 min at room temperature in 50 mM TrisSO4, 2.5 mM MgSO4, 1 mM NaADP, and 10 mM NaF at a protein concentration of 0.2–0.5 mg/ml in the presence of varied concentrations of AlCl3 or ScCl3. A 1 ml ATPase assay buffer was then added to 50 µl reaction samples to measure the ATPase activity. Omission of MgSO4, NaADP, or NaF resulted in no inhibition of membranes.

Results

Growth properties of single and double mutants of E. coli ATP synthase

Nine new single mutants, αI346A, αI346D, αI346Q, αI346R, αI348A, αI348D, αI348Q, αI348R, and αR376A, and six double mutants, αI346R/βR182A, αI346R/βR246A, αI346R/αR376A, αI348R/βR182A, αI348R/βR246A, and αI348R/αR376A, were generated. Despite non-polar hydrophobic side chains, αIle-346 and αIle-348 are strongly conserved in the αVISIT-DG sequence and are also in close proximity to positively charged Pi binding residues in the catalytic sites of ATP synthase. αI346A and αI348A mutants were constructed to appreciate the role of non-polar hydrophobic side chains in Pi binding and the transition state. αI346Q and αI348Q mutants were designed to investigate the impact of the larger side chain of Gln on αI346 and αI348. αI346D, αI348D, αI346R, and αI348R were generated to determine the impact of negative and positive charges on the nearby known Pi binding residues βR246, βR182, and αR376. Growth properties of βR246A, βR182A, and αR376A were in excellent agreement with previously published data [3, 9, 12, 15, 31]. Our motivation for the double mutants αI346R/βR182A, αI346R/βR246A, αI346R/αR376A, αI348R/βR182A, αI348R/βR246A, and αI348R/αR376A was to determine if the presence of the Arg side chain on αI346R or αI348R could compensate for absence of the Arg side chain on βR182A or αR376A.

Table 2 shows that the introduction of Ala, Asp, Gln, or Arg as αI346A, αI346D, αI346Q, αI346R, αI348A, αI348D, αI348Q, and αI348R caused some loss of oxidative phosphorylation as represented by loss of growth on succinate and limiting glucose mediums. Replacement of Arg into Ala in three known Pi binding residues βR182A, βR246A, and αR376A resulted in significant loss of oxidative phosphorylation and reduction in ATPase activity. Considerable oxidative phosphorylation was retained by the double mutants αI346R/βR182A, αI346R/αR376A, and αI348R/βR182A. Comparative specific ATPase activity values of membrane bound F1Fo preparations containing wild-type, null, and mutant enzymes are also shown in Table 2. Variable reduction in ATPase activity was observed for all mutant enzymes. Double mutants αI346R/βR182A, αI346R/αR376A, and αI348R/βR182A augmented the ATPase activity by about 70-fold from 0.07, 0.065 to 4.61, 4.97, and 4.87, respectively. Purity and integrity of α and β subunits in wild-type and mutant membrane bound F1Fo were in excellent agreement with previously published data [8, 30]. This result also confirmed that the reduced ATPase in mutants was not due to contaminants, impaired assembly of ATP synthase, or loss of F1 during membrane preparation, thus attributing the low mutant activities to mutant F1.

TABLE 2.

Effects of single and double α I346 and α I348 mutations on cell growth and ATPase activity

aMutation bGrowth
On succinate		 Growth yield in
in limiting glucose
(%)		 c ATPase
Activity
(µmol/min/mg)
Wild-type ++++ 100 28
Null − 47 0
α I346A +++ 90 6.9
α I346D ++ 76 2.56
α I346Q ++ 67 6.81
α I346R ++ 74 3.74
α I348A +++ 93 5.54
α I348D ++ 78 0.08
α I348Q ++ 66 4.54
α I348R + 64 0.04
α R182A − 47 0.07
α R376A − 56 0.065
β R246Ad − 50 0.25
α I346R/α R182A +++ 77 4.61
α I346R/α R376A +++ 83 4.97
α I346R/β R246A + 60 1.24
α I348R/α R182A +++ 79 4.87
α I348R/α R376A + 53 1.32
α I348R/β R246A + 55 0.95
Open in a new tab
a

Wild-type, pBWU13.4/DK8; Null, pUC118/DK8. All mutants were expressed with the βY331W mutation also present, which does not significantly affect growth. Data are means of four experiments each.

b

Growth on succinate plates after 3 days estimated by eye. ++++, heavy growth; +++, substantial growth; ++, light growth; +,very light growth; −, no growth. Qualitative growth estimation on succinate plates is a widely used and more reliable method then the growth estimation on liquid succinate media as the rate of growth for wild-type and mutants could be different.

c

ATPase activity measured at 37°C and expressed as µmol ATP hydrolyzed/min/mg of membrane protein. Individual experimental points are the mean of duplicate assay tubes. Data are derived from at least two separate membrane preparations. Results from separate membrane preparations were in excellent agreement within ±10%.

d

Data taken from ref (9)

Inhibition of membrane bound F1Fo ATPase activity by NBD-Cl and reversal by DTT

In previous studies, both membrane bound F1Fo and purified F1 preparations provided equivalent assay results [5, 8, 9, 14, 15, 30, 32–35]. Therefore, all the inhibition assays in this study were carried out using membrane bound F1Fo because it is convenient and less time consuming. Figure 3 shows NBD-Cl induced inhibition of wild-type and mutant membranes in the presence of varied concentrations of NBD-Cl. NBD-Cl resulted in complete inhibition of wild-type with no residual activity, which was consistent with previous studies [5, 8–12, 14, 15]. αI346A, αI346Q, αI346R, αI348A, αI348Q, αI346R/βR182A, αI346R/αR376A, and αI348R/βR182A mutants were also almost completely inhibited. Variable degrees of inhibition were observed for other single or double mutants at about 59% for αI346D, 34% for αI348D, 40% for αI348R, 61% for αR376A, 54% for αI346R/βR246A, 64% for αI348R/βR246A, and 88% for αI348R/αR376A (Fig. 3). Several examples of incomplete or partial inhibition of mutant enzymes by NBD-Cl are documented in previous studies [5, 8–12, 14, 15]. To validate that the maximal reaction with NBD-Cl had been reached, partially inhibited membrane bound F1Fo mutant enzymes were incubated with 150 µM NBD-Cl for 1 h as in Figure 3, followed by an additional amount of 200 µM NBD-Cl (totaling 350 µM) and continuing the incubation for an extra hour before measuring ATPase activity. No significant change in inhibition confirmed that the reaction of NBD-Cl was complete and that fully reacted αI346D, αI348D, αI348R, αR376A, αI346R/βR182A, αI348R/βR246, and αI348R/αR376A membrane bound F1Fo mutants retained residual activity (Fig. 4A). We also determined if inhibition by NBD-Cl could be reversed by the addition of the reducing agent DTT since reversibility by DTT has been shown to be indicative of reaction specificity at βTry-297 [36, 37]. For this experiment, DTT restored near normal ATPase activity in all cases (Fig. 4B), verifying that NBD-Cl reacts specifically with residue βTyr-297 in the wild-type and in mutants.

Figure 3. Inhibition of wild-type and mutant membrane bound F1Fo ATP synthase by NBD-Cl.

Figure 3

Open in a new tab

Membranes were preincubated for 60 min at room temperature with varied concentrations of NBD-Cl. 1 ml ATP cocktail assay buffer was added to start the reaction. More details are provided in the Materials and Methods. A: wild-type (○); B: αI346A (⬡), αI346D (□), αI346Q (Δ), and αI346R (◇); C: αI348A (⬡), αI348D (□), αI348Q (Δ), and αI348R (◇); D: αR376A (○); E: αI346R/βR182A (○), αI346R/βR246A (□), and αI346R/αR376A (Δ); F: αI348R/βR182A (○), αI348R/βR246A (□), and αI348R/αR376A (Δ). Each data point represents an average of at least three experiments with duplicate samples, using 2–3 independent membrane bound F1Fo preparations. Results agreed within ± 10%.

Figure 4. Effect of an extra pulse of NBD-Cl and reversal of NBD-Cl effect in the presence of DTT.

Figure 4

Open in a new tab

A: Membrane bound F1Fo ATP synthase was inhibited with 150 µM NBD-Cl for 60 min under conditions as described in Fig. 3. Then, an additional amount of 200 µM NBD-Cl was added and incubation continued for 1 hr before assay. B: Membrane bound F1Fo ATP synthase (Mbr) was incubated with or without 150 µM NBD-Cl for 60 min under conditions as described in Fig. 3. The degree of inhibition was examined. In parallel samples, 4 mM DTT was then added, and incubation continued for a further 60 min before assay. Each bar graph represents wild-type, αI346D, αI348D, αI348R, αR376A, αI346R/βR246A, and αI348R/βR246A from left to right. For clarity, only mutants retaining residual activity after NBD-Cl inhibition are shown.

Protection against NBD-Cl inhibition of ATPase activity by MgADP or MgPi

Figure 5 shows the MgADP protection data against NBD-Cl in wild-type and mutant membrane bound F1Fo enzymes. Previous research has shown that protection of NBD-Cl-induced inhibition of wild-type and a variety of mutant membrane bound F1Fo or water soluble F1 occurs at high concentrations of MgADP. In this study too, high concentrations of MgADP were required to protect wild-type and mutant enzymes against NBD-Cl inhibition. High MgADP concentrations efficiently keep the βE site occupied in time average and thus hold back the access to NBD-Cl by sterically obstructing the site [5, 8–15]. Therefore, these results prove that NBD-Cl is reacting in βE in the mutants and that the ATPase activities measured in the mutants are actually of ATP synthase enzyme and not due to any contaminant. This scheme is consistent with the X-ray crystallographic studies of Orris et al concluding NBD-Cl reacts specifically in the βE catalytic site [7].

Figure 5. MgADP induced protection against NBD-Cl inhibition.

Figure 5

Open in a new tab

Wild-type and mutant membrane bound F1Fo were preincubated for 1h at room temperature with varied concentrations of MgADP, then 150 µM NBD-Cl was added, and incubation continued at room temperature in the dark for 1 hour. Aliquots were assayed for ATPase activity. A: wild-type (○), αI346A (⬡), αI346D (□), αI346Q (Δ), and αI346R (◇); B: wild-type (○), αI348A (⬡), αI348D (□), αI348Q (Δ), and αI348R (◇); C: wild-type (○), αI346R/βR182A (⬡), αI346R/βR246A (□), and αI346R/αR376A (Δ); D: wild-type (○), αI348R/βR182A (⬡), αI348R/βR246A (□), and αI348R/αR376A (Δ). Results are means of at least three independent experiments and agreed within ± 10%.

MgPi protection against NBD-Cl reaction is shown in Figure 6. Pi protected fully against NBD-Cl inhibition of ATPase activity in wild-type and in αI346A, αI346D, αI346Q, αI346R, αI348A, αI348D, αI348Q, αI348R, αI346R/βR182A, αI346R/αR376A, and αI348R/βR182A mutants. Pi did not protect against NBD-Cl inactivation in αI346R/βR246A, αI348R/βR246A, or αI348R/αR376A mutants.

Figure 6. MgPi protection against NBD-Cl inhibition of membrane bound F1Fo ATPase activity.

Figure 6

Figure 6

Figure 6

Open in a new tab

F1Fo membranes were preincubated with MgPi at zero, 2.5, 5, or 10 mM concentration as shown, for 60 min at room temperature. Then 150 µM NBD-Cl was added and aliquots withdrawn for assay at time intervals as shown. Remaining ATPase activity was plotted against time of incubation with NBD-Cl. ○, no Pi added; □, 2.5 mM Pi; Δ, 5mM Pi; ⬡, 10 mM Pi. Each data point represents the average of at least three individual experiments using 2–3 independent membrane preparations. Results agreed within ± 10%.

Inhibition of ATPase activity by fluoroaluminate, fluoroscandium, and azide

Effects of transition and ground state analogs were studied. Figures 7A and 7B show the inhibition of wild-type and mutant enzymes by fluoroaluminate and fluoroscandium, respectively. AlCl3 induced complete inhibition of wild-type, αI346A, αI346Q, and αI348A. Maximal inhibition by AlCl3 for other mutants was observed at about 17% for αI346D, 84% for αI346R, 23% for αI348D, 86% for αI348Q, 0% for αI348R, 93% for αI346R/βR182A, 32% for αI346R/βR246A, 80% for αI346R/αR376A, 84% for αI348R/βR182A, 20% for αI348R/βR246A, and 42% for αI348R/αR376A. ScCl3 induced nearly complete inhibition of wild-type. ScCl3 caused variable degrees of inhibition at about 66% for αI346A, 0% for αI346D, 80% for αI346Q, 15% for αI346R, 84% for αI348A, 30% for αI348D, 65% for αI348Q, 30% for αI348R, 80% for αI346R/βR182A, 6% for αI346R/βR246A, 45% for αI346R/αR376A, 75% for αI348R/βR182A, 20% for αI348R/βR246A, and 30% for αI348R/αR376A in mutants. Sodium azide is a known potent inhibitor of ATP synthase. As seen in Figure 8, azide strongly inhibited wild-type enzyme and caused varied degrees of inhibition in mutants at about 44% for αI346A, 20% for αI346D, 20% for αI346Q, 43% for αI346R, 29% for αI348A, 0% for αI348D, 0% for αI348Q, 0 for αI348R, 69% for αI346R/βR182A, 12% for αI346R/βR246A, 20% for αI346R/αR376A, 60% for αI348R/βR182A, 0% for αI348R/βR246A, and 0% for αI348R/αR376A.

Figure 7. Fluoroaluminate and fluoroscandium induced inhibition of membrane bound F1Fo ATPase activity.

Figure 7

Figure 7

Open in a new tab

Membranes were preincubated for 60 min at room temperature with 1 mM MgADP, 10 mM NaF, and reported concentrations of AlCl3 (7A) or ScCl3 (7B). Then 1 ml of ATP cocktail was added and ATPase activity determined. A: wild-type (○), αI346A (⬡), αI346D (□), αI346Q (Δ), and αI346R (◇); B: wild-type (○), αI348A (⬡), αI348D (□), αI348Q (Δ), and αI348R (◇); C: wild-type (○), αI346R/βR182A (⬡), αI346R/βR246A (□), and αI346R/αR376A (Δ); D: wild-type (○), αI348R/βR182A (⬡), αI348R/βR246A (□), and αI348R/αR376A (Δ). All the data points are means of at least three duplicate experiments using 2–3 independent membrane preparations. Variation was ± 10% between different experiments.

Figure 8. Sodium azide induced inhibition of membrane bound F1Fo ATPase activity.

Figure 8

Open in a new tab

Sodium azide was added directly to the membranes and incubated for 30 min before ATPase assay. More details are provided in materials and Methods. A: wild-type (○), αI346A (⬡), αI346D (□), αI346Q (Δ), and αI346R (◇); B: wild-type (○), αI348A (⬡), αI348D (□), αI348Q (Δ), and αI348R (◇); C: wild-type (○), αI346R/βR182A (⬡), αI346R/βR246A (□), and αI346R/αR376A (Δ); D: wild-type (○), αI348R/βR182A (⬡), αI348R/βR246A (□), and αI348R/αR376A (Δ). All the data points are means of at least three different experiments using 2–3 independent membrane preparations. Variation was ± 10% between different experiments.

Discussion

The purpose of this study was to understand the functional importance of non-polar hydrophobic side chains of αIle-346 and αIle-348 residues in the highly conserved αVISIT-DG sequence of E. coli ATP synthase. All the VISIT-DG sequence residues are located in close proximity to the positively charged Pi binding residues in the catalytic sites. αI346 is only 2.98 and 3.63 Å from αR376 and βR182, two known Pi binding residues. βR246, another known Pi binding residue, is 7.41 Å apart from αI346. The distance between αI348 and βR182 is only 3.66 Å, but αR376 and βR246 are located at 5.29 and 5.77 Å (Fig. 1B). The side chains of αI346 and αI348 are also in close proximity to the bound Pi analogs AlF3, AlF4−, and SO42− [16, 17]. AlF4− is located within 4.08 and 4.74 Å from αI346 and αI348 (Fig. 1). Pi binding is a prerequisite for ATP synthesis by ATP synthase. Mutagenic analysis along with molecular modulations provides the opportunity to elucidate and understand the functional role of residues in Pi binding.

In previously published studies that used inhibitory effects of Pi analogs and the MgPi protection assay against NBD-Cl inhibition on mutant and wild-type ATP synthase, we demonstrated the functional role(s) of Pi binding subdomain and surrounding residues in Pi binding [5, 8–15]. Biochemical and biophysical characterization of nine catalytic site residues identified six residues, αArg-376, βArg-182, βArg-246, βLys-155, αSer-347, and αThr-349, directly or indirectly involved in Pi binding. While four residues, αArg-376, βArg-182, βArg-246, and βLys-155, were directly involved in Pi binding, the two residues, αSer-347 and αThr-349, supported Pi binding and transition state stabilization through their interaction with βArg-246 and βArg-182 [5, 8–15]. These residues were shown to form a triangular subdomain around the Pi analogs AlF3, AlF4−, or SO42− within the catalytic site (Fig. 1B). Three other residues, βN243, αF291, and αG351, although important for function were not involved in direct Pi binding. In previous studies, we also demonstrated that the introduction of a negative or positive charge in Pi binding subdomain resulted in strong variations of Pi binding [8, 10, 14, 15], indicating the presence of charged residues in the vicinity of the triangle was an important determinant of Pi binding. In this study, we used a similar approach by replacing αIle-346 and αIle-348 residues with a variety of residues Ala, Asp, Gln, or Arg.

Construction of αI346A, αI346D, αI346Q, αI346R, αI348A, αI348D, αI348Q, αI348R, αI346R/βR182A, αI346R/βR246A, αI346R/αR376A, αI348R/βR182A, αI348R/βR246A, or αI348R/αR376A mutants did not affect assembly or structural integrity of the membrane bound ATP synthase. The content of F1-α and F1-β subunits in mutant enzymes was comparable to wild-type. As shown in Table 2, Mutations caused insignificant to substantial loss of oxidative phosphorylation and reduction in ATPase activity in mutant enzymes as suggested by growth on succinate or limiting glucose medium. A wide range of reduction in ATPase activity between 4-fold to 700–fold was observed for the mutant enzymes.

As shown in Figure 6, MgPi protected against NBD-Cl inhibition of all αIle-346 and αIle-348 single mutants, demonstrating Pi binding in the absence of αI346 or αI348. These results suggest that α-subunit VISIT-DG sequence residues αIle-346 and αIle-348 play no direct role in catalysis. While no Pi binding was observed in double mutants αI346R/βR246A, αI348R/βR246A, or αI348R/αR376A, the double mutants αI346R/βR182A, αI346R/αR376A, and αI348R/βR182A allowed Pi binding with substantial retention of oxidative phosphorylation and ATPase activity (Fig. 6). Clearly, insertion of Arg at αIle-346 or αIle-348 positions can compensate for the loss of Arg at βArg-182 or αArg-376 but not at βArg-246.

MgADP-fluoroaluminate and MgADP-fluoroscandium are known potent inhibitors of wild-type E. coli ATP synthase, and both are believed to mimic the chemical transition state [5, 8–12, 14, 15, 31, 38]. Transition state-like structures involving bound MgADP-AlF4− complex have been seen in catalytic sites in ATP synthase by X-ray crystallography [17]. As shown in Figure 7, fluoroaluminate caused complete inhibition of wild-type, αI346A, αI346Q, and αI348A but resulted in variable degrees of inhibition for other mutants, indicating a partial to strong destabilization of the transition state. As expected, fluoroscandium also induced almost complete inhibition of wild-type enzyme but caused nearly complete to no inhibition of mutants, suggesting no destabilization to strong destabilization of the transition state. These results correspond with the amount of oxidative phosphorylation and ATPase activity found in each of the mutants. The higher degree of inhibition in double mutants αI346R/βR182A, αI346R/αR376A, and αI348R/βR182A indicates some rescue of the transition state. Overall, these results suggest αIle-346 and αIle-348 play a direct role in the transition state.

Azide induced X-ray crystallographic studies of ATP synthase [39] showed that azide inhibits ATP synthase by forming a tight-binding MgADP-azide complex in βDP catalytic sites resembling MgADP-beryllium fluoride. Therefore, azide may be considered an analog of the MgATP ground-state. In the MgADP-azide complex, the azide position corresponds to MgATP gamma phosphate [39]. As shown in Figure 8, azide caused almost complete inhibition of wild-type membrane bound F1Fo and resulted in variable degrees of inhibition for mutants. Thus, all mutants seem to have some effect on substrate binding because of an effect at the gamma-P position. In single molecule experiments, Pi binding and release events have been directly linked to rotation of the central stalk [40]. Perturbation of the Pi binding site might disturb the integrity of the link between Pi binding and rotation and result in uncoupling. Therefore, αIle-346 and αIle-348 mutation data strongly suggest that both residues are required for transition state stabilization and not for Pi binding.

Because Arg residues occur frequently in catalytic sites in proteins (30), modulating the number of Arg residues in the Pi binding subdomain of ATP synthase is an advantageous approach to study their role in catalysis or Pi binding. Residues αIle-346 and αI348 are 3.63Å and 3.66 Å, 7.41Å and 5.77 Å, 2.98Å and 5.29 Å from known Pi binding residues βArg-182, βR246, and αArg-376, respectively. Phosphate analogs AlF4 and SO42− are 4.08 Å and 5.65 Å from αI346 and 4.74 Å and 6.56 Å from αI348. The distance between αI346 and αI348 is 5.10 Å (nearest atom distances quoted in all cases) using PDB 1H8E coordinates [17]. Thus, one of the experimental approaches we used was to introduce the mutation αI346R or αI348R in the wild-type background (with βArg-182, βArg-246, αArg-376) and in the presence of the βR182A, βR246A, or αR376A mutation. The position of αI346 and αI348 on top of the Pi binding pocket across the catalytic α/β interface with side-chains pointing toward the bound Pi analogs also makes αI346 and αI348 suitable candidates for the insertion of a new Arg. Introduction of Arg at αI346R or αI348R places extra positive charge fairly close to Pi. Further, double mutations αI346R/βR182A, αI346R/βR246A, αI346R/αR376A, αI348R/βR182A, αI348R/βR246A, and αI348R/αR376A will allow the Arg to fit into the large “hole” generated by βAla-182, βAla-246, or αAla-376 mutation. The βR182A, βR246A, or αR376A mutants did not allow Pi binding, but the αI346R or αI348R "rescued" Pi binding in combination with βR182A or αR376A but not with βR246A (Fig. 6). Previously [9] it was observed that introduction of Lys as a positive in place of Arg in the form of βR246K could not compensate for the loss of Arg from the known Pi binding residue βR246 therefore we have focused on introduction of Arg residue. Moreover, Lys in many other studies failed to compensate for the loss of Arg (Z. Ahmad unpublished data). Although, not checked in this study but it would be interesting to see if Lys can support the loss of Arg in phosphate binding subdomain.

Based on the loss of oxidative phosphorylation as manifested by growth on succinate or limiting glucose medium along with an almost 6-fold lower ATPase activity, αArg-346 and αArg-348 could be expected to assume the identical stereochemical interactions of βArg-182 or αArg-376. Electrostatic interactions are critical for the catalysis process, and we conclude that the presence of at least one positive charge at this general location is an essential determinant for the initiation of Pi binding in βE catalytic site. In addition, extra positive charge in the form of αI346R or αI348R or extra negative charge in the form of αI346D or αI348D in wild-type background did not abrogate Pi binding (Fig. 6). Although, we previously found that the presence of negative charge in the form of αT349D prevented Pi binding by virtue of neutralizing the positive charge of nearby residue βArg-182 [15].

In summary, the highly conserved α-subunit VISIT-DG sequence residues αIle-346 and αIle-348 in E. coli ATP synthase seem to be required for function and transition state stabilization but appear to have no direct role in Pi binding. Introduction of Arg at these sites can compensate for the absence of Arg at known Pi binding residue sites βArg-182 or αArg-376.

Highlights.

  • Role of highly conserved αI346 and αI348 VISIT-DG sequence residues in Pi binding is proposed

  • Both αI346 and αI348 residues are required for upholding the phosphate binding sub-domain.

  • Both αI346 and αI348 residues are required for the transition state stabilization.

  • Introduction of Arg in place of Ile can compensate for the loss of an Arg involved in Pi binding

Acknowledgments

We are thankful to Deborah Goggin, scientific writer, research support, A.T. Still University for reviewing the manuscript. This work was supported by the National Institutes of Health, grant no. GM085771, and by an A.T. Still University Warner/Fermaturo Research Grant, grant no. 501-461, to ZA.

Abbreviations used

NBD-Cl

7-chloro-4-nitrobenzo-2-oxa-1,3-diazole

DTT

dithiothreitol

EDTA

Ethylenediaminetetraacetic acid

TES

2-[Tris(hydroxymethyl)methylamino]-1-ethanesulfonic acid

DMSO

dimethyl sulfoxide

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

1

E. coli residue numbers used throughout.

References

  • 1.Senior AE. J Biol Chem. 2012;287:30049–30062. doi: 10.1074/jbc.X112.402313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Ahmad Z, Cox JL. The Scientific World Journal. 2014;2014:10. [Google Scholar]
  • 3.Senior AE, Nadanaciva S, Weber J. Biochim. Biophys. Acta. 2002;1553:188–211. doi: 10.1016/s0005-2728(02)00185-8. [DOI] [PubMed] [Google Scholar]
  • 4.Abrahams JP, Leslie AGW, Lutter R, Walker JE. Nature. 1994;370:621–628. doi: 10.1038/370621a0. [DOI] [PubMed] [Google Scholar]
  • 5.Li W, Brudecki LE, Senior AE, Ahmad Z. J. Biol. Chem. 2009;284:10747–10754. doi: 10.1074/jbc.M809209200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Perez JA, Greenfield AJ, Sutton R, Ferguson SJ. FEBS Lett. 1986;198:113–118. doi: 10.1016/0014-5793(86)81195-4. [DOI] [PubMed] [Google Scholar]
  • 7.Orriss GL, Leslie AG, Braig K, Walker JE. Structure. 1998;6:831–837. doi: 10.1016/s0969-2126(98)00085-9. [DOI] [PubMed] [Google Scholar]
  • 8.Ahmad Z, Senior AE. J. Biol. Chem. 2005;280:27981–27989. doi: 10.1074/jbc.M503955200. [DOI] [PubMed] [Google Scholar]
  • 9.Ahmad Z, Senior AE. J. Biol. Chem. 2004;279:31505–31513. doi: 10.1074/jbc.M404621200. [DOI] [PubMed] [Google Scholar]
  • 10.Ahmad Z, Senior AE. J. Biol. Chem. 2004;279:46057–46064. doi: 10.1074/jbc.M407608200. [DOI] [PubMed] [Google Scholar]
  • 11.Ahmad Z, Senior AE. J. Bioenerg. Biomembr. 2005;37:437–440. doi: 10.1007/s10863-005-9486-8. [DOI] [PubMed] [Google Scholar]
  • 12.Ahmad Z, Senior AE. FEBS Lett. 2005;579:523–528. doi: 10.1016/j.febslet.2004.12.022. [DOI] [PubMed] [Google Scholar]
  • 13.Ahmad Z, Senior AE. FEBS Lett. 2006;580:517–520. doi: 10.1016/j.febslet.2005.12.057. [DOI] [PubMed] [Google Scholar]
  • 14.Brudecki LE, Grindstaff JJ, Ahmad Z. Arch. Biochem. Biophys. 2008;471:168–175. doi: 10.1016/j.abb.2008.01.013. [DOI] [PubMed] [Google Scholar]
  • 15.Ahmad Z, Winjobi M, Kabir MA. Biochemistry. 2014;53:7376–7385. doi: 10.1021/bi5013063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Braig K, Menz RI, Montgomery MG, Leslie AG, Walker JE. Structure. 2000;8:567–573. doi: 10.1016/s0969-2126(00)00145-3. [DOI] [PubMed] [Google Scholar]
  • 17.Menz RI, Walker JE, Leslie AG. Cell. 2001;106:331–341. doi: 10.1016/s0092-8674(01)00452-4. [DOI] [PubMed] [Google Scholar]
  • 18.Chen C, Saxena AK, Simcoke WN, Garboczi DN, Pedersen PL, Ko YH. J Biol Chem. 2006;281:13777–13783. doi: 10.1074/jbc.M513369200. [DOI] [PubMed] [Google Scholar]
  • 19.Cingolani G, Duncan TM. Nat Struct Mol Biol. 2011;18:701–707. doi: 10.1038/nsmb.2058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Roy A, Hutcheon ML, Duncan TM, Cingolani G. Acta Crystallogr Sect F Struct Biol Cryst Commun. 2012;68:1229–1233. doi: 10.1107/S1744309112036718. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Andries K, Verhasselt P, Guillemont J, Gohlmann HW, Neefs JM, Winkler H, Van Gestel J, Timmerman P, Zhu M, Lee E, Williams P, de Chaffoy D, Huitric E, Hoffner S, Cambau E, Truffot-Pernot C, Lounis N, Jarlier V. Science. 2005;307:223–227. doi: 10.1126/science.1106753. [DOI] [PubMed] [Google Scholar]
  • 22.Walker JE, Saraste M, Runswick MJ, Gay NJ. EMBO J. 1982;1:945–951. doi: 10.1002/j.1460-2075.1982.tb01276.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Ketchum CJ, Al-Shawi MK, Nakamoto RK. Biochem. J. 1998;330:707–712. doi: 10.1042/bj3300707. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Vandeyar MA, Weiner MP, Hutton CJ, Batt CA. Gene. 1988;65:129–133. doi: 10.1016/0378-1119(88)90425-8. [DOI] [PubMed] [Google Scholar]
  • 25.Weber J, Wilke-Mounts S, Lee RS, Grell E, Senior AE. J. Biol. Chem. 1993;268:20126–20133. [PubMed] [Google Scholar]
  • 26.Klionsky DJ, Brusilow WS, Simoni RD. J. Bacteriol. 1984;160:1055–1060. doi: 10.1128/jb.160.3.1055-1060.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Senior AE, Langman L, Cox GB, Gibson F. Biochem. J. 1983;210:395–403. doi: 10.1042/bj2100395. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Senior AE, Latchney LR, Ferguson AM, Wise JG. Arch. Biochem. Biophys. 1984;228:49–53. doi: 10.1016/0003-9861(84)90045-6. [DOI] [PubMed] [Google Scholar]
  • 29.Taussky HH, Shorr E. J. Biol. Chem. 1953;202:675–685. [PubMed] [Google Scholar]
  • 30.Ahmad Z, Laughlin TF, Kady IO. PLoS One. 2015;10:e0127802. doi: 10.1371/journal.pone.0127802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Nadanaciva S, Weber J, Senior AE. Biochemistry. 2000;39:9583–9590. doi: 10.1021/bi000941o. [DOI] [PubMed] [Google Scholar]
  • 32.Chinnam N, Dadi PK, Sabri SA, Ahmad M, Kabir MA, Ahmad Z. Int. J. Biol. Macromol. 2010;46:478–486. doi: 10.1016/j.ijbiomac.2010.03.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Dadi PK, Ahmad M, Ahmad Z. Int. J. Biol. Macromol. 2009;45:72–79. doi: 10.1016/j.ijbiomac.2009.04.004. [DOI] [PubMed] [Google Scholar]
  • 34.Laughlin TF, Ahmad Z. Int. J. Biol. Macromol. 2010;46:367–374. doi: 10.1016/j.ijbiomac.2010.01.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Ahmad Z, Ahmad M, Okafor F, Jones J, Abunameh A, Cheniya RP, Kady IO. Int. J. Biol. Macromol. 2012;50:476–486. doi: 10.1016/j.ijbiomac.2012.01.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Ferguson SJ, Lloyd WJ, Radda GK. Eur. J. Biochem. 1975;54:127–133. doi: 10.1111/j.1432-1033.1975.tb04121.x. [DOI] [PubMed] [Google Scholar]
  • 37.Ferguson SJ, Lloyd WJ, Lyons MH, Radda GK. Eur. J. Biochem. 1975;54:117–126. doi: 10.1111/j.1432-1033.1975.tb04120.x. [DOI] [PubMed] [Google Scholar]
  • 38.Nadanaciva S, Weber J, Senior AE. J. Biol. Chem. 1999;274:7052–7058. doi: 10.1074/jbc.274.11.7052. [DOI] [PubMed] [Google Scholar]
  • 39.Bowler MW, Montgomery MG, Leslie AG, Walker JE. Proc Natl Acad Sci U S A. 2006;103:8646–8649. doi: 10.1073/pnas.0602915103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Adachi K, Oiwa K, Nishizaka T, Furuike S, Noji H, Itoh H, Yoshida M, Kinosita K., Jr Cell. 2007;130:309–321. doi: 10.1016/j.cell.2007.05.020. [DOI] [PubMed] [Google Scholar]

RESOURCES