Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2018 Apr 4;8:5609. doi: 10.1038/s41598-018-23139-2

Differential expression of microRNAs and other small RNAs in muscle tissue of patients with ALS and healthy age-matched controls

Anja Kovanda 1, Lea Leonardis 2, Janez Zidar 2, Blaž Koritnik 2,3, Leja Dolenc-Groselj 2, Stanislava Ristic Kovacic 2, Tomaž Curk 4, Boris Rogelj 1,5,6,✉
PMCID: PMC5884852  PMID: 29618798

Abstract

Amyotrophic lateral sclerosis is a late-onset disorder primarily affecting motor neurons and leading to progressive and lethal skeletal muscle atrophy. Small RNAs, including microRNAs (miRNAs), can serve as important regulators of gene expression and can act both globally and in a tissue-/cell-type-specific manner. In muscle, miRNAs called myomiRs govern important processes and are deregulated in various disorders. Several myomiRs have shown promise for therapeutic use in cellular and animal models of ALS; however, the exact miRNA species differentially expressed in muscle tissue of ALS patients remain unknown. Following small RNA-Seq, we compared the expression of small RNAs in muscle tissue of ALS patients and healthy age-matched controls. The identified snoRNAs, mtRNAs and other small RNAs provide possible molecular links between insulin signaling and ALS. Furthermore, the identified miRNAs are predicted to target proteins that are involved in both normal processes and various muscle disorders and indicate muscle tissue is undergoing active reinnervation/compensatory attempts thus providing targets for further research and therapy development in ALS.

Introduction

Amyotrophic lateral sclerosis (ALS) is a late-onset disorder primarily affecting upper and lower motor neurons leading to progressive and severe skeletal muscle atrophy. Whether the denervation is initiated primarily in the CNS or by the muscle itself remains under debate1. What is becoming increasingly clear, however, is that a complex molecular interplay contributes to this disorder, of which many components are closely involved in RNA metabolism.

One of the main pathogenic features of ALS are cytoplasmic aggregates of an otherwise predominantly nuclear DNA- and RNA-binding protein TDP-43 (TAR DNA-binding protein) in affected neurons, however, mutations of this protein in patients are too rare to explain this phenomenon2–4. TDP-43 is an RNA processing protein and is known to be intricately involved in RNA metabolism5–7. In addition to TDP-43, mutations and mislocalizations of other RNA-binding proteins, such as FUS and other hnRNPs (heterogeneous ribonucleoprotein) have also been shown to be associated with ALS8–13. The intronic (G4C2) hexanucleotide repeat expansion within the C9ORF72 gene has been shown to be the main genetic feature of ALS14–16. As well as giving rise to exotic DNA features such as G-quadruplexes and i-motifs17,18, the expanded repeats undergo both aberrant and unconventional processing (reviewed in Vatovec et al.19), which further supports disease-associated changes in RNA metabolism as a core mechanism in ALS pathogenesis.

MicroRNAs (miRNAs) are around 22 nucleotide long non-coding RNA molecules that serve as regulators of transcriptional and post-transcriptional gene expression20,21. They regulate their target messenger RNAs (mRNAs) through either their binding and inactivation and/or degradation22. A single miRNA may often bind up to several hundred mRNAs, while several different miRNAs can bind the same mRNA23,24. Muscle miRNAs or myomiRs are a large group of miRNAs enriched in skeletal and/or cardiac muscle. Although many myomiRs are exclusive for muscle tissue, some can also be found in other tissues. MyomiRs are normally involved in processes such as myogenesis and muscle homeostasis but can become differentially expressed both in general atrophy (due to immobility or caloric restriction) and muscle disorders (reviewed in Kovanda et al.25). So far over 200 myomiRs have been shown to be deregulated in different pathological conditions, such as Duchenne muscular dystrophy (DMD), Becker muscular dystrophy, facioscapulohumeral muscular dystrophy, limb-girdle muscular dystrophies, Miyoshi myopathy, nemaline myopathy, polymyositis, dermatomyositis, inclusion body myositis, etc.26–28. At the same time, several myomiRs have also shown potential as targets for therapeutic intervention in various models of muscular atrophy29–33.

In ALS, information on global miRNA expression is lacking, and the expression of only 7 miRNAs, involved in the regulation of HDAC4, has recently been examined34 in the muscle tissue of ALS patients. MiR-206 and miR-133b have been reported to be increased on disease onset in a SOD-1-G93A ALS mouse model35, with miR-206 KO mice showing delayed reinnervation, an increase in HDAC4, and faster disease progression compared to SOD-1-G93A controls. However, only miR-155, which is increased in the spinal cord of ALS patients, has so far been used as a non-muscle therapeutic target in ALS, its inhibition extending the survival SOD-1-G93A mice36, despite promising results with myomiR targeting in other muscle disorder models such as Duchenne muscular dystrophy and spinal and bulbar muscular atrophy37,38.

Despite the relatively high evolutionary conservation of miRNAs, the molecular differences between humans and existing animal and cellular models of ALS39 mean the information on global miRNA expression in ALS patients is crucial for any future therapy design.

The aim of our study was to determine the global differential expression of miRNAs and other small RNAs in the muscle tissue of ALS patients using small RNA Seq, in order to suggest novel disease mechanisms and identify most likely candidates for novel directions in therapy development.

Results

Patients and controls

We obtained muscle biopsies from 12 patients with ALS and 11 control subjects, however, due to low RNA integrity number (RIN) one patient sample was excluded from the analysis. The average age of patients vs. controls was 62.2 (±11.1) vs. 61.1 (±12.3) years, and females constituted 45.5% (5/11) and 54.5% (6/11) of patients and controls included in the study, respectively. The mean age of patients at disease onset was 58.0 (±10.9) years. 72.7% (8/11) of patients had spinal and 27.3% (3/11) had bulbar disease onset. 54.5% (6/11) patients had definite, 27.3% (3/11) had a probable, and 18.2% (2/11) had a possible ALS diagnosis according to revised El Escorial criteria40. Genetic analyses were previously performed for 54.5% (6/11) patients, with no known ALS related mutations discovered41. 18.2% (2/11) patients had a family history of the disease. Clinically, all patients had both lower and upper motor neuron involvement. The ALS FRS score of patients ranged from 18 to 43 (average 28.3 (±6.9)), however only patients who could walk were included in the study as we assumed that the severity of muscle atrophy in immobile patients would not allow for adequate comparison of muscle tissue. Therefore, all patients had ALS FRS walking scores above 1, and all but 2 patients could still use stairs to some extent. The biopsy was performed on the less affected leg in all cases. Detailed characteristics of patients and controls are shown in Table 1.

Table 1.

Characteristics of patients (ALS) and controls (K).

Study ID Gen-der ALS diagnosis (revised El Escorial) Age at disease onset Age at muscle biopsy ALS muta-tions Bulbar/ Spinal onset Stag-ing Lower/Upper motor neuron Famil-ial ALS ALS FRSr Spe-ech Saliva-ting Swallowing Wri-ting Use of utensils Gastro-stomy Dressing/personal hygiene Turn-ing in bed Wal-king Walk-ing up stairs Leg use = waking + steps Dys-pnea Orth-opnea Breathing insuffi-ciency Quad-riceps strength
ALS-01 F probable 63 67 no S 3 L/U no 32 4 4 4 3 0 — 0 3 2 1 3 3 4 4 5
ALS-02 F definite 50 51 nd S 4 L/U yes 34 4 3 3 4 4 — 1 0 3 0 3 4 4 4 5
ALS-03 F definite 65 68 no S 4 L/U no 22 3 1 3 3 0 — 0 0 1 0 1 4 3 4 4
ALS-04 M probable 77 80 nd B 4 L/U no 18 0 0 1 1 1 — 0 0 3 1 4 4 4 3 5
ALS-05 F possible 59 64 nd S 1 L* no 43 4 4 4 4 4 — 4 4 2 1 3 4 4 4 nd
ALS-06 F definite 70 71 nd B 4 L/U no 25 2 1 1 2 — yes 1 3 2 1 3 3 4 3 5
ALS-07 M possible 45 50 no S 2 L/U yes 35 4 4 4 1 1 — 0 1 4 4 8 4 4 4 5
ALS-08 M possible 52 58 no S 2 L/U no 35 4 4 4 2 2 — 2 2 3 1 4 3 4 4 nd
ALS-09 M definite 40 45 no S 3 L/U no 23 2 2 3 0 0 — 0 0 3 1 4 4 4 4 5
ALS-10 M probable 61 73 nd S 2 L/U no 39 4 4 4 3 3 — 3 3 2 1 3 4 4 4 5
ALS-11 M definite 59 66 no S 4 L/U no 23 3 1 1 0 0 — 0 2 4 4 8 3 2 2 5
ALS-12 F definite 54 55 nd B 3 L/U no 25 2 0 2 2 0 — 1 3 3 1 4 3 4 4 5
K-01 F 76
K-02 M 69
K-03 F 58
K-04 M 72
K-05 F 60
K-06 F 43
K-07 F 70
K-08 M 57
K-09 F 45
K-10 M 46
K-11 M 75

Legend: ALS = patient group, K = control group, nd = no data, S = spinal, B = bulbar, L = lower motor neuron, U = upper motor neuron. *Sample ALS-05 was excluded from furter analyses due to low RIN.

Next generation sequencing

Based on the quality control (QC) of sample isolation prior to library preparation, one patient sample (ALS 5) was excluded from further analyses based on its low RIN. 75 base single strand small RNA next-generation sequencing of 22 samples was performed on the NextSeq 500 instrument using the high output flow cell format. One human brain total RNA sample was analyzed in parallel as a positive control. Raw data have been deposited to NCBI’s Gene Expression Omnibus42,43 and are accessible through GEO Series accession number GSE100188. Trimming and sequence QC was performed commercially by IMGM Laboratories GmbH using CLC Genomics Workbench 8.5.1 (CLC bio). The tags were then annotated using small RNA databases human miRBase 21 and Ensemble Non-coding RNA (GRCh38ncrna). In total between 22.1% and 30.8% reads could be annotated in this way, using both databases (Fig. 1, Supplementary Table S1).

Figure 1.

Figure 1

(A) Distribution of sequence tag annotations and differentially expressed small RNA species in ALS patients. (B) Plots of mean normalized counts against log2 fold change. Dots represent individual tags. Significantly differentially expressed tags are shown in red. Significant miRNA (C) and other small RNAs (D) identified by both differential analyses and identified in separate patient groups.

Differential expression

Both annotated and unannotated small RNA tags were analyzed for significantly differentially expressed small RNAs in two separate CLC Genomics Workbench experiments. The p-value was calculated using the Baggerly’s test44 and the p-value was FDR-corrected by using the Benjamini and Hochberg method45. Only tags with at least 5 read counts were included in the analysis. Significant results include only those differentially expressed small RNAs with an FDR corrected p-value ≤0.05 and fold-change FC ≥2.0. The summary overview of the changed small RNAs is given by Fig. 1.

Of the unannotated tags, 117 were significantly (FDR corrected p-value ≤0.05) up-regulated (FC ≥2.0), while 641 were significantly down-regulated (FC ≤2.0, see Supplementary Table S2 and S3, respectively). Many of the unannotated tags could be assigned to a specific genomic location or several genomic locations using BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The analysis of these sequences is not yet part of established bioinformatic pipelines and is made difficult either because of their mapping to many or poorly characterized genomic locations. Although these tags may represent potential novel miRNAs or other small RNAs that could be involved in the pathogenesis of ALS, they will be analyzed in depth as part of a separate study.

Data quality assessment was subsequently performed with sample clustering and visualization using DESeq46 (Figs 1, 2 and 3). MA plots of all annotated and unannotated tags are shown in Fig. 1B. The principal component analysis plot (PCA) showed four ALS samples and one control sample did not cluster with their respective groups. Based on the PCA (Fig. 2) and sample clustering (Fig. 3), that indicated a high presence of miRNAs (such as miR-143) associated with fat tissue, the control sample in question (K10) was excluded from the further analysis using DESeq. The subsequent check of the control’s weight showed a high BMI, suggesting a higher intramuscular fat content, which supports this result. Results of DESeq comparisons of all ALS patients against controls without control K10 (Supplementary Table S4) are summarized in Table 2.

Figure 2.

Figure 2

PCA plot of all annotated unique sequences, first two components are shown. ALS and control samples are clustered together, with the exception of control sample K10 and ALS samples ALS4, ALS7, ALS8, and ALS9.

Figure 3.

Figure 3

Clustering of ALS and control samples according to the 50 most highly expressed annotated small RNA sequences.

Table 2.

Significantly (FDR corrected p-value ≤0.05, FC ≥2.0) differentially expressed small RNA groups in ALS patients vs. controls.

Small RNA group:miRNAs Expression All ALS vs. controls* All ALS vs. controls** All ALS vs. controls w/o K10** ALS group 1 vs. controls w/o K10** ALS group 2 vs. controls w/o K10**
hsa-miR-100-5p up √ √ √ √
hsa-miR-10a precursor up √ √ √
hsa-miR-125a-5p + precursor up √ √ √
hsa-miR-125b-1/miR-125b-5p + precursor up √
hsa-miR-1260a-5p up √
hsa-miR-126-5p down √
hsa-miR-128-2-3p up √
hsa-miR-1285-1-3p, hsa-miR-1285-1 /miR-1285-2-3p down √
hsa-miR-1291 precursor up √ √ √
hsa-miR-1303-3p down √ √ √ √
hsa-miR-132-5p up √
hsa-miR-133a-1/miR-133a-2-3p + precursor up/down √ √
hsa-miR-150-5p down √ √ √
hsa-miR-151a-5p up √
hsa-miR-191-5p down √
hsa-miR-199a-1//miR-199a-2//miR-199b-3p + precursor up √
hsa-miR-212-5p up √
hsa-miR-214-3p up √
hsa-miR-22 precursor up √
hsa-miR-24-1-5p up √
hsa-miR-26a-1//miR-26a-2-5p down √ √
hsa-miR-26a-1/miR-26a-2-5p + precursor up √
hsa-miR-27a-5p up √
hsa-miR-28-3p down √
hsa-miR-30d precursor down √
hsa-miR-3607-3p up √
hsa-miR-362 up √ √
hsa-miR-378a -3p + miR-378a//miR-378d-2//miR-378c//miR-378d-1//miR-378e precursor down √
hsa-miR-378c precursor down √
hsa-miR-378d-3p down √
hsa-miR-424-5p up √
hsa-miR-450a-1//miR-450a-2-5p up √
hsa-miR-450b-5p up √
hsa-miR-4662a-5p up √
hsa-miR-486-1//miR-486-2-5p down √ √ √
hsa-miR-494-3p down √
hsa-miR-500a-3p up √ √
hsa-miR-501-3p up √ √
hsa-miR-502-3p up √ √ √
hsa-miR-542-3p up √
hsa-miR-542-5p up √ √
hsa-miR-5699-5p down √
hsa-miR-584-5p down √
hsa-miR-625-3p up √
hsa-miR-660-5p up √
hsa-miR-855-3p down √
hsa-miR-99a-5p + precursor up √ √ √
snoRNAs Expression All ALS vs. controls* All ALS vs. controls** All ALS vs. controls w/o K10** ALS group 1 vs. controls w/o K10** ALS group 2 vs. controls w/o K10**
SNORD100-201 up √
SNORD10-201 up √ √
SNORD102–201 up √
SNORD104–201 up √ √ √
SNORD105B-201 up √
SNORD110–201 up √
SNORD115 group up √ √ √ √
SNORD116 group up √ √ √ √ √
SNORD12–201 group (hsa-miR-1259) up √
SNORD12C-201 up √
SNORD13–201 up √
SNORD14C-201 up √
SNORD14D-201 up √
SNORD18A-201 up √
SNORD20-201 up √
SNORD22 group down √
SNORD24 group up √
SNORD26 group up √
SNORD27 group up √
SNORD32A-201 up √
SNORD33–201 up √
SNORD35B-201 up √
SNORD36B group up √
SNORD43 group up √
SNORD45 group up √ √
SNORD46 group up √
SNORD48 group – RNU48 up √ √ √ √
SNORD52 group up √
SNORD5–201 up √
SNORD60–201 up √ √
SNORD61–201 up √
SNORD63–201 up √
SNORD64 group up √
SNORD68–201 up √
SNORD69–201 up √
SNORD8–201 up √
SNORD84 group up √ √ √ √
SNORD93 up √
SNORD95–201 up √ √ √ √
SNORD97–201 up √ √ √ √
SNORD99–201 up √
Mitochondrial origin Expression All ALS vs. controls* All ALS vs. controls** All ALS vs. controls w/o K10** ALS group 1 vs. controls w/o K10** ALS group 2 vs. controls w/o K10**
MT-RNR2–201 up √ √ √ √
MT-TE-201 down √
MT-TF-201 up √ √
MT-TH-201 down √
MT-TL1–201 up √ √ √
MT-TL2-201 up/down √ √
MT-TN down √
MT-TP-201 up √ √
MT-TQ up √
MT-TS2–201 down √
MT-TV-201 up √
MT-TY-201 up/down √ √
MT-TM-201 up √
MT-TC-21 up √
Other ncRNAs Expression All ALS vs. controls* All ALS vs. controls** All ALS vs. controls w/o K10** ALS group 1 vs. controls w/o K10** ALS group 2 vs. controls w/o K10**
AC006041.1–001 lincRNA up √
AC074212.5-002 retained intron down √
AC084082.3-001 lincRNA up √
AP000233.2-002 lincRNA up √
CTD-2562J15.4 known antisense RNA up √
CTD-2651B20.7-001 CTD-2651B20.6-001 up √ √ √ √
GAS5-006 (growth arrest-specific 5) retained intron up √
GAS5-007 (growth arrest-specific 5) retained intron up √
GAS5-014 (growth arrest-specific 5) lincRNA up √
GAS5-015 (growth arrest-specific 5) lincRNA up √
GAS5-022 (growth arrest-specific 5) retained intron up √
LIMD1-AS1-002 (LIMD1 antisense RNA 1) up √
LINC00293 up √
LINC00324 up √ √ √
LINC01470-006 up √
LINC01783-001 up √
Retired novel miRNA ENST00000616457.1//ENST00000612700.1// ENST00000611802.1//ENST00000611393.1//ENST00000612047.1//ENST00000617883.1 down √
Retired miRNA ENST00000614470.1//ENST00000611934.1//ENST00000488123.2//ENST00000617236.1 down √
RNA5-8S5 down √ √
RNA5-8SP6-201 (RNA, 58S pseudogene 6) up √
RNVU1-7-201RNA, variant U1 small nuclear 7 up √
RP11-3B12.3-001 up √ √ √
RP11-395B7.2 down √
RP11-473M20.16-001 up √ √ √ √
RP11-1260E13.4 group down √
RP4-561L24.3-001 up √ √ √
RP4-671O14.6-001 known sense overlapping up √
SNHG1-003//SNHG1-024//SNHG1-013 up √ √ √
snoU18.1-201 space novel snoRNA up √
U1 spliceosomal RNA up √
XXbac-BCX254L4.4-001//RP5-1186N24.3-001 down √ √
ZNF436-AS1-201 down √

ALS group 1 samples include ALS 1, 2, 3, 6, 10, 11, 12, while ALS group 2 samples include samples ALS 4, 7, 8, 9. *Baggerly’s test, **DESeq analysis.

Among the annotated tags, the CLC Genomic Workbench experiment identified a total of 134 tags that differed significantly between the ALS and control groups. Within the 115 up-regulated annotated tags, 19 groups of miRNAs and 24 other ncRNAs were represented (Supplementary Table S5), while within the 19 down-regulated annotated tags, 10 groups of miRNAs and 5 ncRNAs were represented (Supplementary Table S6), respectively. The DESeq calculation re-identified 6 of these differentially expressed miRNAs and 11 of the differentially expressed other small RNAs with FDR statistical significance, as well as identified additional 7 miRNAs and 8 other small RNAs, respectively (Fig. 1C,D).

The four ALS samples (ALS 4, ALS 7, ALS 8, and ALS 9) that were nested within the control group in the PCA analysis all had high leg-use scores (walking and using steps) and only one of the patients had a definite ALS diagnosis (Table 1). This particular patient happened to be the youngest of our patients at 45 years of age. These factors, combined with our choice of the less affected leg, may explain these results. This is also in line with the hypothesis that active muscle regeneration attempts precede the development of noticeable clinical atrophy in case of ALS1,34, and thus in our case may mask some disease-associated changes.

Therefore, we also separated the ALS patients into two groups, group 1 (patients ALS 1, ALS 2, ALS 3, ALS 6, ALS 10, ALS 11, ALS 12), and group 2 (patients ALS 4, ALS 7, ALS 8, and ALS 9) and compare them to controls with the aim of identifying any group-specific molecular markers that could be associated with disease severity.

Comparisons of ALS group 1 with controls excluding K10 (Supplementary Table S7), indeed resulted in the identification of 11 additional microRNA groups as well as 50 other small ncRNAs, among them 2 retired novel miRNAs, 26 snoRNAs, and 5 mitochondrial RNAs (Table 2 and Fig. 1C,D). However, the results of DESeq comparisons of ALS group 2 patients with controls excluding K10 (Supplementary Table S8) did not show any significantly changed miRNAs and only showed one significantly changed ncRNA, which was snoRNA-116 (Table 2, Fig. 1C,D). This may be interesting in that it may represent an early marker of disease and will be further discussed below (See other differentially expressed small RNAs.).

Target, KEGG, and GO analyses of differentially expressed miRNAs

In silico Tarbase analysis of miRNA targets based on the comparison of all patients against all controls showed over 14,000 genes to be targeted, some of which by more than one of the differentially expressed miRNAs. Of these targets, approx. 40 have already been implicated in neuronal ALS pathology or other disorders involving muscle wasting, while several hundred others are suggested to be involved in muscle contraction, muscle organ development, skeletal muscle cell differentiation, muscle morphogenesis etc. (Supplementary Table S9).

KEGG pathways (Fig. 4) and GO genes union analyses were performed on targets of all differentially expressed miRNAs identified by both the Baggerly’s test as well as the various DESeq group analyses (Supplementary Tables S10 and S11). Of note is that the top hits among the KEGG pathways (Fig. 4) include signaling pathways regulating pluripotency of stem cells, ubiquitin-mediated proteolysis, axon guidance, regulation of actin cytoskeleton, and TGF-beta signaling pathway which could be expected to be affected in a tissue undergoing both degenerative/apoptotic and regenerative processes. Additionally, both fatty acid biosynthesis and metabolism have been previously implicated in ALS and may present targets for therapy development47. Although cancer pathways, such as proteoglycans in cancer and glioma are also among the top hits, this is most probably coincidental due to an overabundance of miRNAs studies in cancer and possible muscle atrophy pathway overlap between ALS and cancer-associated cachexia.

Figure 4.

Figure 4

Heatmap of KEGG union significance clusters based on miRNA species identified by both Baggerly’s test and DESeq.

GO molecular function categories included various parts of RNA metabolism, such as RNA binding, and nucleic acid and protein binding transcription factor activity, which are known to be affected in ALS. GO cellular compartment categories also included established ALS associated terms, such as protein complex. Interestingly, nucleoplasm – the role of which is currently under intense investigation48,49, as well as platelet alpha-granule lumen (that contains insulin-like growth factor 1), which has been linked to Alzheimer’s disease50, were also among the top GO compartment hits. GO biological processes included over a hundred terms, among them, expected apoptotic signaling pathways, but also neurotrophin TRK receptor signaling pathway and muscle cell differentiation, supporting previously observed findings that muscle tissue is actively making attempts at regeneration during ALS progression51. Additionally, cellular lipid metabolic process, insulin receptor signaling pathway, synaptic transmission and axon guidance were also among the biological process GO hits.

Other differentially expressed small RNAs

Our analyses identified over 40 groups of small nucleolar RNAs (snoRNAs) to be differentially expressed, of which all but one were upregulated in ALS patients (Table 2). All belonged to the C/D box snoRNA family (SNORD) which is associated with methylation of ribosomal RNAs and may, therefore, reflect the increased ribosomal turnover as part of the increased protein metabolism during compensatory efforts52.

Small RNAs of mitochondrial origin were also significantly differentially expressed, which is in line with aberrant mitochondrial function in ALS. Tags mapping to the MT-RNR2 (mitochondrial 16 S RNA) were the only ones to be significantly upregulated by both the Baggerly and the DESeq analyses.

Additional differentially expressed ncRNAs include spliced transcripts SNHG1-003//SNHG1-024//SNHG1-013, involved in neural-stem-cell differentiation53, and GAS5 (growth arrest-specific 5) - small nucleolar RNA host gene, that can serve as a decoy for the glucocorticoid and related receptors and promotes apoptosis54.

Discussion

In our analysis of the global differential expression of small RNAs, we identified 758 un-annotated and 134 annotated tags (including miRNAs, snoRNAs, and mtRNAs) to be differentially expressed in the muscle tissue of ALS patients. This previously unknown diversity at the level of regulatory RNA molecules may point us toward finding novel disease mechanisms as well as the most likely candidates for novel directions in therapy development.

The KEGG and GO analyses of the differentially expressed miRNAs suggest their likely involvement in both degenerative/apoptotic processes, as well their involvement in muscle regeneration attempts. Furthermore, several of the differentially expressed miRNAs identified in the muscle tissue of ALS patients have previously been linked with ALS.

Our results show partial overlap with neuronal studies of associations between miRNAs and ALS. In neuronal models, TDP-43 mutations have been shown to cause differential expression of miR-132, miR-143 and miR-558, and TDP-43 deficiency was shown to impair neurite outgrowth in Neuro2a cells, which could then be rescued by miR-132 overexpression55. Similarly, FUS has been shown to promote the biogenesis miR-9, miR-132 and miR-13456, which are miRNAs with a known function in neuronal development and synaptic plasticity57–62. Additionally, miR-9 down-regulation was observed in induced pluripotent stem cell derived neurons from an ALS patient with a TDP-43 mutation63, whereas miR-155, which is increased in the spinal cord of ALS patients, was suggested as a therapeutic target and its inhibition extended surivival in SOD-1-G93A mice36. Recently, miR-218 has also been suggested to affect motor-neuron loss in a rat hSOD1 WT ALS model rats64.

Of the miRNAs with proposed CNS involvement in ALS, miR-132 and miR-125b, were up-regulated in our study. While miR-132 is directly affected by mutations in both TDP-43 and FUS in neuronal models of ALS55,56, miR-125b has been connected to neuro-inflammation through NF-kB activation in a SOD-1-G93A microglia culture model65. Whether miR-125b may act in a similar way in muscle and whether its origin may be the motor neurons or neuro-muscular junctions within the muscle tissue, remains to be determined.

A classical myomiR, miR-133a is predicted to target TUBA4A, which was recently shown to be involved in ALS66,67, and has also been shown to change during myogenesis68, in response to physical activity69,70, aging71 as well as during neuromuscular regeneration and reinnervation in a rat denervation model72, and has recently been shown to be increased in early-stage and slow-progressing ALS patients34. Interestingly, our comparison of all patients against the controls showed a significant increase, while the comparison of ALS group 1 patients (higher disease severity) against controls showed a significant decrease in miR-133a, suggesting it may undergo change during disease progression.

Furthermore, miR-133 and miR-30d (that was down-regulated in all patients vs. controls) are repressed by insulin in skeletal muscle tissue73 and may be involved in the observed protective role of diabetes against the development of ALS74. Of the miRNAs that have already been therapeutically targeted in mice and rats30,36, only miR-133a was identified as being differentially expressed in our study and therefore likely represents a good target for human therapy development.

In contrast, we did not find changes in the expression of miR-1 or miR-206, despite them being among the most highly expressed miRNAs in muscle tissue in general, and despite miR-206 being recently identified as a potential biomarker in serum from ALS patients75, as well as increased in muscles of four early-stage ALS patients34. This likely reflects the differences in our study populations, i.e., serum of ALS patients with varying scores of leg-use in the Waller study, and the muscle tissue of ALS patients with above-average leg-use in our study. As miR-206 is highly expressed in human muscle, we postulate that the observed time-dependent differences in miR-206 observed in the Waller study as well as our observations, indicate that miR-206 may bear direct correlation with the deterioration of the muscle tissue, rather than this miRNA being directly involved in ALS pathogenesis. The observed difference with the study by Di Pietro et al., is expected, given the different patient cohorts, as they have observed a difference in miR-206 expression only in the four patients with early-stage disease (less than 10 months after onset), whereas our study included only two such patients (one year after onset), whereas both studies agreed and showed no difference in patients with longer progression.

Similarly, miR-133a and miR-26a were also the only ones, of the differentially expressed miRNAs previously observed in muscle tissue of ALS patients using qPCR methods34,51,76, that could be confirmed by our study. Indeed, in muscle tissue of ALS patients, miR-29 has been previously observed to increase together with miR-23a, miR-29b, miR-206 and miR-45576. Recently, however, the expression of some of these myomiRs (miR-1, miR-23a, miR-26a, miR-27b, miR-29b, miR-133a, miR-206, and miR-455) has been re-examined by using qPCR methods in muscle samples of ALS patients and controls51, and miR-1, miR-26a, miR-133a, and miR-455 were shown to be significantly decreased in patients. The reason for this discordance is likely methodological, as there are no reliable internal control standards for miRNA qPCR yet77–79. Choosing controls for qPCR remains a tremendous challenge because, during atrophy, skeletal muscle is subject to global morphological changes affecting fiber type and overall muscle, vascular and adipose cell content, which in turn affects housekeeping genes51,80–82. Furthermore, as will be discussed further, in our study we have detected a significant up-regulation of SNORD48, or RNU48, which is a common qPCR control molecule.

Five of our differentially expressed miRNAs have so far also been shown in normal muscle tissue processes. MiR-24, miR-26, miR-27, miR-214, and miR-502 were up-regulated, both in cellular models of differentiation of satellite cells into myoblasts and myotubules83–89, as well as in our study. This observation strongly suggests the myomiRs are actively involved in muscle differentiation and likely play a part in compensatory attempts during ALS progression. While miR-125b was found to be down-regulated in the mentioned cellular models of muscle differentiation83–89, in our study it was found to be up-regulated, likely reflecting previously discussed neuro-inflammatory mechanisms relating to ALS pathogenesis65.

Interestingly, apart from our study, a decrease of miR-468 has so far been observed after acute or chronic exercise90. Although counterintuitive, this may be explained by fasciculations that precede atrophy in ALS. Indeed, rather than being inactive and senescent, muscle tissue in ALS is in effect overly active in parallel to atrophy development1.

Furthermore, miR-1260a, miR-214, and miR-501 are strongly (miTG score of >0,9) predicted to have binding sites for controlling TDP-43, a protein central to ALS pathogenesis. Similarly, miR-30d is predicted to target C9ORF72, a gene whose intronic expansion mutation is the most common genetic cause of ALS. MiR-30d can additionally target CARF, TRPM7, and CHMP3B, all of which were shown to be involved in ALS to various extents91, and TRPM7 and CARF are also predicted to be targeted by miR-22 and miR-26a, respectively. Furthermore, miR-378c may target hnRNPA1, another protein central to ALS pathology9. Finally, miR-1291 is predicted to target ATXN2 and DCTN1, while miR-10a is predicted to target ALS2 protein.

Of the differentially expressed snoRNAs, unexpectedly SNORD115, SNORD116, SNORD48, SNORD84, SNORD95, and SNORD97 were significantly upregulated in both the Baggerly and DESeq analyses, as well as in the ALS group 1 comparisons. Interestingly, SNORD64, SNORD115, and particularly SNORD116 are absent in Prader-Willi syndrome92,93, which is characterized by severe hypotonia at birth and later development of obsessive eating, morbid obesity and type-2 diabetes94. Additionally, SNORD115 may also target serotonin receptor 5HT-2C mRNA95. In our study all three were shown to be up-regulated, providing a possible molecular link between the observed inverse relationship between ALS, fatty acid metabolism, and diabetes47,74. Unexpectedly, SNORD116 was the only small RNA significantly differentially expressed when comparing the ALS group 2 patients to controls, indicating it may be one of the first observable changes in the muscle tissue of ALS patients during disease progression.

SNORD48 also known as RNU48, was shown to be significantly upregulated in ALS patients, adding to mounting evidence that this commonly used qPCR internal control should be used with care96,97. While the role of SNORD84 and SNORD97 are unknown, SNORD95 is expressed from the intron of the RACK1 (GNB2L1) gene, which is involved in translational repression and ribosomal quality control98,99. Moreover, SNORD20 originates from an intron of the human nucleolin gene, defects in which have been linked with C9ORF72 repeat related ALS100.

Of note, MT-RNR2 encodes for humanin peptide, which is associated with apoptosis and insulin sensitivity and is thought to be protective in Alzheimer’s and Huntington’s disease101–103. Furthermore, it was found to be increased in endurance exercise, again suggesting a link to fasciculations in ALS104.

Caveats

The technical challenges faced in our study include a relatively low number of samples, lack of stable normalizers for qPCR validation105–107, and difficulties with functional validation of miRNA targets.

The number of samples in our study was limited by inclusion criteria and ethical considerations. The ability to walk was chosen as our main inclusion criteria because the hallmark of ALS is rapidly progressive loss of muscle tissue. In immobile patients, the procedure would be unethical, and over three-quarters of the interested patients were excluded due to this issue. Despite their low number the collected samples nevertheless represent a valuable resource as they were collected from functional muscles of ALS patients, and we were therefore in a unique position to identify processes taking place before functional muscle loss.

A traditional approach in expression studies has been to validate global expression results using qPCR. For this stable normalizers are needed, but identifying such molecules is often challenging, and needs to be identified on a case-by-case basis105–107. Despite attempting to identify appropriate small RNAs for qPCR validation, we have not found such molecules, either through the NormFinder108 software nor by in-house methods. The most likely explanation is that muscle atrophy, regardless of its cause, is a global process also affecting the expression of housekeepers or normalizers. An additional issue is that it is not clear how the numerous identified sub-, super-, and precursor variants, would, if at all, be detected by qPCR assays, which specifically target mature miRNAs.

Finally, under ideal conditions, functional validation of miRNA’s target proteins would be performed, as the expression on the mRNA level does not directly correlate with miRNA expression. Unfortunately, small muscle biopsy size, the large number of changing small RNA molecules and last but not least limited availability of adequate commercial antibodies for target human proteins prevented us from achieving this goal.

Therefore, due to the mentioned caveats and technical limitations, we would like to emphasize that some of our conclusions remain speculative, however, they are for the most part consistent with current knowledge and we hope our findings will form the basis for further research in this direction.

Conclusions

Our study represents the first, comprehensive differential analysis of small RNA expression in muscle tissue of ALS patients. We have identified many differentially expressed miRNAs, some of which have been previously suggested to be associated with known or postulated pathways in ALS, muscle differentiation, and reinnervation, and we comment on the similarities and differences with differential expression of miRNAs in ALS in blood, shown so far, hopefully highlighting molecules promising as biomarkers or targets in therapy development. We furthermore show that differential expression of small RNAs in ALS includes molecules such as RNU48, considered as housekeepers, as well as mtRNAs and snoRNAs involved in other diseases.

Materials and Methods

Ethics statement

Ethical approval of the study (No. 58/11/14) was obtained from the Republic of Slovenia National Medical Ethics Committee – NMEC. Written informed consent was obtained from all patients and controls. All methods were performed in accordance with the relevant guidelines and regulations.

Patients and controls

Slovenian patients with amyotrophic lateral sclerosis as well as their spouses or other non-blood relatives were invited to participate in the study by either the ALS team coordinator and/or treating neurologist at the Ljubljana ALS Centre, Institute of Clinical Neurophysiology, University Medical Centre Ljubljana.

The inclusion criteria for all volunteers were the ability to walk/still walk, and having no counter-indications for the biopsy procedure, such as receiving anticoagulant therapy. Muscle biopsy samples were collected from 12 patients and 11 controls, from February until August 2015. In addition to the muscle biopsies, clinical data were also collected at or just prior to the visit. Data collected included the ALS diagnosis according to the revised El Escorial score40, staging, age at diagnosis, ALS mutation status, bulbar/spinal onset, upper/lower motor neuron deficits, family history of ALS, ALS FRSr and quadriceps strength.

Muscle biopsy procedure

Muscle biopsy procedures were performed on the vastus lateralis muscle using a standard procedure by trained physicians who routinely perform the procedure for diagnostic purposes. In case of patients, the less affected leg was chosen for the biopsy in order to minimise the possibility of obtaining connective tissue and fat rather than muscle.

In short, the site of the biopsy was disinfected and then anesthetized by injecting 2% Xylocaine. After anesthetic took hold, a small cut to the skin and fascia was made through which the biopsy sample (10–100 mg) was taken using a rongeur instrument. The sample was quickly visually inspected for fat/blood vessels, which were removed if present, and then immediately snap frozen in liquid nitrogen and then transferred to −80 °C until further analyses. The incision was closed using steri-strips bands and the biopsy site was pressure bandaged for a few hours. Instructions were given as to the home care of the biopsy site. One adverse event (hematoma) was noted in connection with the biopsy in one of the controls. No adverse events were noticed in any of the patients or other controls.

Isolation and sequencing of small RNAs

Extraction of total RNA, library preparation, and next-generation small RNA sequencing were performed commercially by IMGM Laboratories GmbH (Martinsried, Germany) on Illumina NextSeq 500.

Isolation and quality control

Total RNA was isolated using miRNeasy kit (Qiagen) according to the protocol of the manufacturer. The final RNA concentration and purity were determined using NanoDrop ND-1000 spectral photometer (peqlab). In order to determine RNA integrity number (RIN), samples were analyzed on the 2100 Bioanalyzer (Agilent Technologies) using the RNA 6000 Nano LabChip Kit (Agilent Technologies). Based on the quality of RIN, and RNA concentration and purity, 22 of the 23 samples were selected for small RNA library preparation for NextSeq sequencing, while one ALS sample (ALS-5) was excluded from any further analyses.

Small RNA library preparation

Illumina® TruSeq® Small RNA Library Prep Kit (Illumina) was used to generate small RNA libraries of 22 samples according to manufacturer’s instructions with one human brain total RNA sample processed and analyzed in parallel as a positive control. An input of 800–1000 ng of RNA was used for library generation.

PCR amplification was performed on the generated single strand cDNA with index primers in order so that the samples could be multiplexed for further library analyses. PCR products were purified and size selected using gel purification (6% Novex TBE gels) and the purified cDNA constructs were concentrated by ethanol precipitation. Quality control of each library sample was performed using the High Sensitivity DNA LabChip Kit (Agilent Technologies) on the 2100 Bioanalyzer (Agilent Technologies) before and after size selection. Library quantification prior to normalization was performed using Qubit® dsDNA HS Assay kit (Invitrogen). Post-purification, all samples ranged in size between 70 and 155 bp (including adaptor sequences) and were of sufficient concentration for RNA sequencing analysis. Libraries were pooled in equimolar ratios for sequencing.

Next generation sequencing

Two single-end 75 base sequencing runs (1x 75 bp SE) were performed with the final library on the NextSeq 500 sequencing system (Illumina) under the control of the NextSeq® Control Software (NCS) (Illumina), using a PhiX v3 control library spike-in (Illumina). Cluster densities ranged from 107–119 k/mm2 and two runs per sample were performed in order to obtain a sufficiently high yield per sample. The two 1 × 75 SE runs had 96.5% and 95.8% >Q30 bases, respectively. Real-Time Analysis 2.4.6 Software (RTA) was used to process the primary image on the NextSeq 500 instrument, while primary data analysis was performed using the bcl2fastq 2.15.0.4 software package. Sequencing run performance was imaged and evaluated using the Illumina Sequence Analysis Viewer (SAV) 1.11.0. QC Results of sequenced samples are summarised in Supplementary Table S1.

Bioinformatic analysis

QC, mapping and differential expression analysis

The first part of the bioinformatic data analysis was performed commercially by IMGM Laboratories GmbH using CLC Genomics Workbench 8.5.1 (CLC bio). Sequencing reads were trimmed, removing the adaptor (RTP 5′ GCCTTGGCACCCGAGAATTCCA), and only reads with the length between 15 and 55 bp were selected for further analyses. The number of unique tags (unique nucleotide sequence) was counted in each sample (Supplementary Table S1) and the tags were annotated using small RNA databases human miRBase 21 and Ensemble Non-coding RNA (GRCh38ncrna), and the ‘Annotate and Merge’ tool from CLC Genomics Workbench. Up to two mismatches, no gaps and + /−2 nucleotides were allowed to be counted up- and/or downstream from known small RNA sequences in the databases. The mapping was performed by allowing no mismatches in the first round of analysis, then allowing one mismatch for the unmapped reads in the second round, and finally allowing two mismatches for the remaining unmapped reads in the final round of mapping. Each included tag (unique nucleotide sequence) had to be detected at least five times, in order to remove possible sequencing artifacts. The analysis resulted in annotated and unannotated set of sequences, which were then compared in a pairwise manner between the reference and ALS group (please see statistical analyses).

The second part of the bioinformatic data analysis was performed at the Laboratory of Bioinformatics at the University of Ljubljana Faculty of Computer and Information Science.

Additional differential expression analyses including data quality assessment by sample clustering and visualization were performed with the DESeq software package46 based on the IMGM annotated and unannotated reads of ALS patients and controls, as well as on total unique tag counts. For the DESeq analysis based on the IMGM annotated and unannotated tags of ALS patients and controls, the reads were filtered prior to the analysis with only those tags detected at least five times in at least six samples included in the analysis.

Target, GO and KEGG Pathway analysis

Target analysis was performed on-line using the DIANA tools MR-microT software109,110 (Updated to Ensembl v84). The list of identified target proteins was then compared against the Ensembl databases and with the help of Ensembl Biomart111,112 to identify proteins known to be involved in ALS, other dystrophies, muscle development, and muscle disease.

Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were conducted online using the DIANA-miRPath v3.0. tools113,114 on all 49 differentially expressed miRNAs, including their 3′ and 5′ species, identified by both the Baggerly’s test and DESeq in order to identify relevant pathways and gene ontologies. All DIANA-miRPath analyses using Tarbase v7.0 were performed with FDR correction and conservative statistics options.

Statistical analysis

Patients’ and controls’ characteristics were analyzed by using descriptive methods (average, standard deviation (SD)).

Statistical analysis performed commercially by IMGM Laboratories GmbH consisted of a pairwise comparison of annotated sequences of ALS patients vs. controls, and unannotated sequences of ALS patients vs. controls, using the Baggerley et al.’s test44. Benjamini and Hochberg method was used to calculate the false discovery rate (FDR)45. Only tags with at least 5 counts were included in the analysis. In order to achieve significance, both a p-value and corrected p-value of ≤0.05 needed to be reached by the changed small RNA. Additionally, a proportion fold change cut-off of 2.0 was implemented, meaning small RNAs were considered induced if the proportions fold change (FC) values ≥2.0 and repressed if the value was ≤−2.

In order to validate the results, the count data were further analyzed using the DESeq as an R/Bioconductor package, as previously described46.

Electronic supplementary material

Acknowledgements

We would like to profoundly thank all the patients and controls for participating in the study. We would also like to thank nurses Špela Jamšek and Ana Goričan for their helpful assistance. This work was funded by the Slovenian Research Agency (ARRS) Postdoctoral Grant Z3-6802 to AK. LL, JZ, BK, and LDG were funded by the ARRS programme P3-0338. TC was funded by ARRS programme P2-0209. BR was funded by ARRS grants P4-0127; J3-5501; J3-6789 and J3-5460.

Author Contributions

A.K. and B.R. designed the study. L.L., J.Z., B.K., L.D.G., and S.R.K. collected samples and/or patient data. T.C. performed specialized bioinformatic analyses. A.K. performed the experiments, analyzed data, performed bioinformatics analyses and wrote the manuscript. All authors reviewed and contributed to the final manuscript.

Competing Interests

The authors declare no competing interests.

Footnotes

Electronic supplementary material

Supplementary information accompanies this paper at 10.1038/s41598-018-23139-2.

Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Dadon-Nachum M, Melamed E, Offen D. The ‘dying-back’ phenomenon of motor neurons in ALS. J. Mol. Neurosci. MN. 2011;43:470–477. doi: 10.1007/s12031-010-9467-1. [DOI] [PubMed] [Google Scholar]
  • 2.Lagier-Tourenne C, Polymenidou M, Cleveland DW. TDP-43 and FUS/TLS: emerging roles in RNA processing and neurodegeneration. Hum. Mol. Genet. 2010;19:R46–64. doi: 10.1093/hmg/ddq137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Mackenzie IR, Rademakers R, Neumann M. TDP-43 and FUS in amyotrophic lateral sclerosis and frontotemporal dementia. Lancet Neurol. 2010;9:995–1007. doi: 10.1016/S1474-4422(10)70195-2. [DOI] [PubMed] [Google Scholar]
  • 4.Sreedharan J, et al. TDP-43 Mutations in Familial and Sporadic Amyotrophic Lateral Sclerosis. Science. 2008;319:1668–1672. doi: 10.1126/science.1154584. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Ling S-C, Polymenidou M, Cleveland DW. Converging mechanisms in ALS and FTD: disrupted RNA and protein homeostasis. Neuron. 2013;79:416–438. doi: 10.1016/j.neuron.2013.07.033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Nishimura AL, et al. Nuclear import impairment causes cytoplasmic trans-activation response DNA-binding protein accumulation and is associated with frontotemporal lobar degeneration. Brain J. Neurol. 2010;133:1763–1771. doi: 10.1093/brain/awq111. [DOI] [PubMed] [Google Scholar]
  • 7.Tollervey JR, et al. Characterizing the RNA targets and position-dependent splicing regulation by TDP-43. Nat. Neurosci. 2011;14:452–458. doi: 10.1038/nn.2778. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Darovic, S. et al. Phosphorylation of C-terminal tyrosine 526 in FUS impairs its nuclear import. J. Cell Sci, 10.1242/jcs.176602 (2015). [DOI] [PubMed]
  • 9.Kim HJ, et al. Mutations in prion-like domains in hnRNPA2B1 and hnRNPA1 cause multisystem proteinopathy and ALS. Nature. 2013;495:467–473. doi: 10.1038/nature11922. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Mackenzie IRA, et al. Pathological heterogeneity in amyotrophic lateral sclerosis with FUS mutations: two distinct patterns correlating with disease severity and mutation. Acta Neuropathol. (Berl.) 2011;122:87–98. doi: 10.1007/s00401-011-0838-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Štalekar M, et al. Proteomic analyses reveal that loss of TDP-43 affects RNA processing and intracellular transport. Neuroscience. 2015;293:157–170. doi: 10.1016/j.neuroscience.2015.02.046. [DOI] [PubMed] [Google Scholar]
  • 12.Vance C, et al. Mutations in FUS, an RNA Processing Protein, Cause Familial Amyotrophic Lateral Sclerosis Type 6. Science. 2009;323:1208–1211. doi: 10.1126/science.1165942. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Vance C, et al. ALS mutant FUS disrupts nuclear localization and sequesters wild-type FUS within cytoplasmic stress granules. Hum. Mol. Genet. 2013;22:2676–2688. doi: 10.1093/hmg/ddt117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.DeJesus-Hernandez M, et al. Expanded GGGGCC Hexanucleotide Repeat in Noncoding Region of C9ORF72 Causes Chromosome 9p-Linked FTD and ALS. Neuron. 2011;72:245–256. doi: 10.1016/j.neuron.2011.09.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Majounie E, et al. Frequency of the C9orf72 hexanucleotide repeat expansion in patients with amyotrophic lateral sclerosis and frontotemporal dementia: a cross-sectional study. Lancet Neurol. 2012;11:323–330. doi: 10.1016/S1474-4422(12)70043-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Renton AE, et al. A hexanucleotide repeat expansion in C9ORF72 is the cause of chromosome 9p21-linked ALS-FTD. Neuron. 2011;72:257–268. doi: 10.1016/j.neuron.2011.09.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Kovanda A, Zalar M, Šket P, Plavec J, Rogelj B. Anti-sense DNA d(GGCCCC)n expansions in C9ORF72 form i-motifs and protonated hairpins. Sci. Rep. 2015;5:17944. doi: 10.1038/srep17944. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Šket, P. et al. Characterization of DNA G-quadruplex species forming from C9ORF72 G4C2 expanded repeats associated with amyotrophic lateral sclerosis and frontotemporal lobar degeneration. Neurobiol. Aging10.1016/j.neurobiolaging.2014.09.012 (2014). [DOI] [PubMed]
  • 19.Vatovec S, Kovanda A, Rogelj B. Unconventional features of C9ORF72 expanded repeat in amyotrophic lateral sclerosis and frontotemporal lobar degeneration. Neurobiol. Aging. 2014;35:2421.e1–2421.e12. doi: 10.1016/j.neurobiolaging.2014.04.015. [DOI] [PubMed] [Google Scholar]
  • 20.Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004;116:281–297. doi: 10.1016/S0092-8674(04)00045-5. [DOI] [PubMed] [Google Scholar]
  • 21.Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell. 2009;136:215–233. doi: 10.1016/j.cell.2009.01.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Morozova N, et al. Kinetic signatures of microRNA modes of action. RNA N. Y. N. 2012;18:1635–1655. doi: 10.1261/rna.032284.112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Lewis BP, Burge CB, Bartel DP. Conserved Seed Pairing, Often Flanked by Adenosines, Indicates that Thousands of Human Genes are MicroRNA Targets. Cell. 2005;120:15–20. doi: 10.1016/j.cell.2004.12.035. [DOI] [PubMed] [Google Scholar]
  • 24.Shin C, et al. Expanding the microRNA targeting code: functional sites with centered pairing. Mol. Cell. 2010;38:789–802. doi: 10.1016/j.molcel.2010.06.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kovanda, A., Režen, T. & Rogelj, B. MicroRNA in skeletal muscle development, growth, atrophy and disease. Wires RNA (2014). [DOI] [PubMed]
  • 26.Chen J-F, Callis TE, Wang D-Z. microRNAs and muscle disorders. J. Cell Sci. 2008;122:13–20. doi: 10.1242/jcs.041723. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Eisenberg I, et al. Distinctive patterns of microRNA expression in primary muscular disorders. Proc. Natl. Acad. Sci. 2007;104:17016–17021. doi: 10.1073/pnas.0708115104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Wang, X. H. MicroRNA in myogenesis and muscle atrophy. Curr. Opin. Clin. Nutr. Metab. Care10.1097/MCO.0b013e32835f81b9 (2013). [DOI] [PMC free article] [PubMed]
  • 29.Karakikes I, et al. Therapeutic cardiac-targeted delivery of miR-1 reverses pressure overload-induced cardiac hypertrophy and attenuates pathological remodeling. J. Am. Heart Assoc. 2013;2:e000078. doi: 10.1161/JAHA.113.000078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Nakasa T, et al. Acceleration of muscle regeneration by local injection of muscle-specific microRNAs in rat skeletal muscle injury model. J. Cell. Mol. Med. 2010;14:2495–2505. doi: 10.1111/j.1582-4934.2009.00898.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Wada S, et al. Translational Suppression of Atrophic Regulators by MicroRNA-23a Integrates Resistance to Skeletal Muscle Atrophy. J. Biol. Chem. 2011;286:38456–38465. doi: 10.1074/jbc.M111.271270. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Wang XH, et al. Decreased miR-29 Suppresses Myogenesis in CKD. J. Am. Soc. Nephrol. 2011;22:2068–2076. doi: 10.1681/ASN.2010121278. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Xu J, et al. Transcription factor FoxO1, the dominant mediator of muscle wasting in chronic kidney disease, is inhibited by microRNA-486. Kidney Int. 2012;82:401–411. doi: 10.1038/ki.2012.84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Di Pietro, L. et al. Potential therapeutic targets for ALS: MIR206, MIR208b and MIR499 are modulated during disease progression in the skeletal muscle of patients. Sci. Rep. 7 (2017). [DOI] [PMC free article] [PubMed]
  • 35.Williams AH, et al. MicroRNA-206 delays ALS progression and promotes regeneration of neuromuscular synapses in mice. Science. 2009;326:1549–1554. doi: 10.1126/science.1181046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Koval, E. D. et al. Method for widespread microRNA-155 inhibition prolongs survival in ALS-model mice. Hum. Mol. Genet. 10.1093/hmg/ddt261 (2013). [DOI] [PMC free article] [PubMed]
  • 37.Miyazaki Y, et al. Viral delivery of miR-196a ameliorates the SBMA phenotype via the silencing of CELF2. Nat. Med. 2012;18:1136–1141. doi: 10.1038/nm.2791. [DOI] [PubMed] [Google Scholar]
  • 38.Cacchiarelli D, et al. miR-31 modulates dystrophin expression: new implications for Duchenne muscular dystrophy therapy. EMBO Rep. 2011;12:136–141. doi: 10.1038/embor.2010.208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Scott S, et al. Design, power, and interpretation of studies in the standard murine model of ALS. Amyotroph. Lateral Scler. Off. Publ. World Fed. Neurol. Res. Group Mot. Neuron Dis. 2008;9:4–15. doi: 10.1080/17482960701856300. [DOI] [PubMed] [Google Scholar]
  • 40.Ludolph A, et al. A revision of the El Escorial criteria - 2015. Amyotroph. Lateral Scler. Front. Degener. 2015;16:291–292. doi: 10.3109/21678421.2015.1049183. [DOI] [PubMed] [Google Scholar]
  • 41.Vrabec K, et al. Genetic analysis of amyotrophic lateral sclerosis in the Slovenian population. Neurobiol. Aging. 2015;36:1601.e17–1601.e20. doi: 10.1016/j.neurobiolaging.2014.11.011. [DOI] [PubMed] [Google Scholar]
  • 42.Barrett T, et al. NCBI GEO: archive for functional genomics data sets–updat. e. Nucleic Acids Res. 2013;41:D991–995. doi: 10.1093/nar/gks1193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Edgar R, Domrachev M, Lash AE. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res. 2002;30:207–210. doi: 10.1093/nar/30.1.207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Baggerly KA, Deng L, Morris JS, Aldaz CM. Differential expression inSAGE: accounting for normal between-library variation. Bioinforma. Oxf. Engl. 2003;19:1477–1483. doi: 10.1093/bioinformatics/btg173. [DOI] [PubMed] [Google Scholar]
  • 45.Benjamini Y, Hochberg Y. Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing. J R Stat Soc Ser B Methodol. 1995;57:289–300. [Google Scholar]
  • 46.Anders S, Huber W. Differential expression analysis for sequence count data. Genome Biol. 2010;11:R106. doi: 10.1186/gb-2010-11-10-r106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Schmitt, F., Hussain, G., Dupuis, L., Loeffler, J.-P. & Henriques, A. A plural role for lipids in motor neuron diseases: energy, signaling and structure. Front. Cell. Neurosci. 8 (2014). [DOI] [PMC free article] [PubMed]
  • 48.Schmidt HB, Rohatgi R. In Vivo Formation of Vacuolated Multi-phase Compartments Lacking Membranes. Cell Rep. 2016;16:1228–1236. doi: 10.1016/j.celrep.2016.06.088. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Taylor JP, Brown RH, Cleveland DW. Decoding ALS: from genes to mechanism. Nature. 2016;539:197–206. doi: 10.1038/nature20413. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Van Nostrand WE, Schmaier AH, Farrow JS, Cunningham DD. Protease nexin-II (amyloid beta-protein precursor): a platelet alpha-granule protein. Science. 1990;248:745–748. doi: 10.1126/science.2110384. [DOI] [PubMed] [Google Scholar]
  • 51.Jensen L, Jørgensen LH, Bech RD, Frandsen U, Schrøder HD. Skeletal Muscle Remodelling as a Function of Disease Progression inAmyotrophic Lateral Sclerosis. BioMed Res. Int. 2016;2016:1–12. doi: 10.1155/2016/5930621. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Bratkovič T, Rogelj B. Biology and applications of small nucleolar RNAs. Cell. Mol. Life Sci. CMLS. 2011;68:3843–3851. doi: 10.1007/s00018-011-0762-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Mercer TR, et al. Long noncoding RNAs in neuronal-glial fate specification and oligodendrocyte lineage maturation. BMC Neurosci. 2010;11:14. doi: 10.1186/1471-2202-11-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Pickard MR, Williams GT. The hormone response element mimic sequence of GAS5 lncRNA is sufficient to induce apoptosis in breast cancer cells. Oncotarget. 2016;7:10104–10116. doi: 10.18632/oncotarget.7173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Kawahara Y, Mieda-Sato A. TDP-43 promotes microRNA biogenesis as a component of the Drosha and Dicer complexes. Proc. Natl. Acad. Sci. 2012;109:3347–3352. doi: 10.1073/pnas.1112427109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Morlando M, et al. FUS stimulates microRNA biogenesis by facilitating co-transcriptional Drosha recruitment: FUS participates in microRNA biogenesis. EMBO J. 2012;31:4502–4510. doi: 10.1038/emboj.2012.319. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Dajas-Bailador F, et al. microRNA-9 regulates axon extension and branching by targeting Map1b in mouse cortical neurons. Nat. Neurosci. 2012;15:697–699. doi: 10.1038/nn.3082. [DOI] [PubMed] [Google Scholar]
  • 58.Edbauer D, et al. Regulation of Synaptic Structure and Function by FMRP-Associated MicroRNAs miR-125b and miR-132. Neuron. 2010;65:373–384. doi: 10.1016/j.neuron.2010.01.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Fiore R, et al. Mef2-mediated transcription of the miR379–410 cluster regulates activity-dependent dendritogenesis by fine-tuning Pumilio2 protein levels. EMBO J. 2009;28:697–710. doi: 10.1038/emboj.2009.10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Hébert SS, Sergeant N, Buée L. MicroRNAs and the Regulation of Tau Metabolism. Int. J. Alzheimers Dis. 2012;2012:1–6. doi: 10.1155/2012/406561. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Shaltiel G, et al. Hippocampal microRNA-132 mediates stress-inducible cognitive deficits through its acetylcholinesterase target. Brain Struct. Funct. 2013;218:59–72. doi: 10.1007/s00429-011-0376-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Smith PY, et al. MicroRNA-132 loss is associated with tau exon 10 inclusion in progressive supranuclear palsy. Hum. Mol. Genet. 2011;20:4016–4024. doi: 10.1093/hmg/ddr330. [DOI] [PubMed] [Google Scholar]
  • 63.Zhang Z, et al. Downregulation of microRNA-9 in iPSC-derived neurons of FTD/ALS patients with TDP-43 mutations. PloS One. 2013;8:e76055. doi: 10.1371/journal.pone.0076055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Hoye ML, et al. MicroRNA Profiling Reveals Marker of Motor Neuron Disease in ALS Models. J. Neurosci. 2017;37:5574–5586. doi: 10.1523/JNEUROSCI.3582-16.2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Parisi C, et al. MicroRNA-125b regulates microglia activation and motor neuron death in ALS. Cell Death Differ. 2016;23:531–541. doi: 10.1038/cdd.2015.153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Perrone F, et al. Investigating the role of ALS genes CHCHD10 and TUBA4A in Belgian FTD-ALS spectrum patients. Neurobiol. Aging. 2017;51:177.e9–177.e16. doi: 10.1016/j.neurobiolaging.2016.12.008. [DOI] [PubMed] [Google Scholar]
  • 67.Smith BN, et al. Exome-wide rare variant analysis identifies TUBA4A mutations associated with familial ALS. Neuron. 2014;84:324–331. doi: 10.1016/j.neuron.2014.09.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Chen X, et al. In Vitro Evidence Suggests That miR-133a-mediated Regulation of Uncoupling Protein 2 (UCP2) Is an Indispensable Step in Myogenic Differentiation. J. Biol. Chem. 2008;284:5362–5369. doi: 10.1074/jbc.M807523200. [DOI] [PubMed] [Google Scholar]
  • 69.Lewis A, et al. Downregulation of the serum response factor/miR-1 axis in the quadriceps of patients with COPD. Thorax. 2011;67:26–34. doi: 10.1136/thoraxjnl-2011-200309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Nielsen S, et al. Muscle specific microRNAs are regulated by endurance exercise in human skeletal muscle. J. Physiol. 2010;588:4029–4037. doi: 10.1113/jphysiol.2010.189860. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Drummond MJ, et al. Aging and microRNA expression in human skeletal muscle: a microarray and bioinformatics analysis. Physiol. Genomics. 2011;43:595–603. doi: 10.1152/physiolgenomics.00148.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Jeng S-F, et al. Profiling muscle-specific microRNA expression after peripheral denervation and reinnervation in a rat model. J. Neurotrauma. 2009;26:2345–2353. doi: 10.1089/neu.2009.0960. [DOI] [PubMed] [Google Scholar]
  • 73.Granjon A, et al. The microRNA Signature in Response to Insulin Reveals Its Implication in the Transcriptional Action of Insulin in Human Skeletal Muscle and the Role of a Sterol Regulatory Element-Binding Protein-1c/Myocyte Enhancer Factor 2C Pathway. Diabetes. 2009;58:2555–2564. doi: 10.2337/db09-0165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Kioumourtzoglou M-A, et al. Diabetes Mellitus, Obesity, and Diagnosis of Amyotrophic Lateral Sclerosis: A Population-Based Study. JAMA Neurol. 2015;72:905. doi: 10.1001/jamaneurol.2015.0910. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Waller R, et al. Serum miRNAs miR-206, 143-3p and 374b-5p as potential biomarkers for amyotrophic lateral sclerosis (ALS) Neurobiol. Aging. 2017;55:123–131. doi: 10.1016/j.neurobiolaging.2017.03.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Russell AP, et al. Disruption of skeletal muscle mitochondrial network genes and miRNAs in amyotrophic lateral sclerosis. Neurobiol. Dis. 2013;49:107–117. doi: 10.1016/j.nbd.2012.08.015. [DOI] [PubMed] [Google Scholar]
  • 77.Chugh P, Dittmer DP. Potential pitfalls in microRNA profiling. Wiley Interdiscip. Rev. RNA. 2012;3:601–616. doi: 10.1002/wrna.1120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Moldovan L, et al. Methodological challenges in utilizing miRNAs as circulating biomarkers. J. Cell. Mol. Med. 2014;18:371–390. doi: 10.1111/jcmm.12236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Pritchard CC, Cheng HH, Tewari M. MicroRNA profiling: approaches and considerations. Nat. Rev. Genet. 2012;13:358–369. doi: 10.1038/nrg3198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Bergouignan A, Rudwill F, Simon C, Blanc S. Physical inactivity as the culprit of metabolic inflexibility: evidence from bed-rest studies. J. Appl. Physiol. Bethesda Md 1985. 2011;111:1201–1210. doi: 10.1152/japplphysiol.00698.2011. [DOI] [PubMed] [Google Scholar]
  • 81.Brocca L, et al. The time course of the adaptations of human muscle proteome to bed rest and the underlying mechanisms. J. Physiol. 2012;590:5211–5230. doi: 10.1113/jphysiol.2012.240267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Marimuthu K, Murton AJ, Greenhaff PL. Mechanisms regulating muscle mass during disuse atrophy and rehabilitation in humans. J. Appl. Physiol. Bethesda Md 1985. 2011;110:555–560. doi: 10.1152/japplphysiol.00962.2010. [DOI] [PubMed] [Google Scholar]
  • 83.Crist CG, et al. Muscle stem cell behavior is modified by microRNA-27 regulation of Pax3 expression. Proc. Natl. Acad. Sci. USA. 2009;106:13383–13387. doi: 10.1073/pnas.0900210106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Dmitriev P, et al. Simultaneous miRNA and mRNA transcriptome profiling of human myoblasts reveals a novel set of myogenic differentiation-associated miRNAs and their target genes. BMC Genomics. 2013;14:265. doi: 10.1186/1471-2164-14-265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85.Ge Y, Sun Y, Chen J. IGF-II is regulated by microRNA-125b in skeletal myogenesis. J. Cell Biol. 2011;192:69–81. doi: 10.1083/jcb.201007165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.Huang Z, Chen X, Yu B, He J, Chen D. MicroRNA-27a promotes myoblast proliferation by targeting myostatin. Biochem. Biophys. Res. Commun. 2012;423:265–269. doi: 10.1016/j.bbrc.2012.05.106. [DOI] [PubMed] [Google Scholar]
  • 87.Juan AH, Kumar RM, Marx JG, Young RA, Sartorelli V. Mir-214-Dependent Regulation of the Polycomb Protein Ezh2 in Skeletal Muscle and Embryonic Stem Cells. Mol. Cell. 2009;36:61–74. doi: 10.1016/j.molcel.2009.08.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88.Liu J, et al. MicroRNA-214 promotes myogenic differentiation by facilitating exit from mitosis via down-regulation of proto-oncogene N-ras. J. Biol. Chem. 2010;285:26599–26607. doi: 10.1074/jbc.M110.115824. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 89.Sun Q, et al. Transforming growth factor-beta-regulated miR-24 promotes skeletal muscle differentiation. Nucleic Acids Res. 2008;36:2690–2699. doi: 10.1093/nar/gkn032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Aoi, W. et al. Muscle-enriched microRNA miR-486 decreases in circulation in response to exercise in young men. Front. Physiol. 4 (2013). [DOI] [PMC free article] [PubMed]
  • 91.Corcia P, et al. Genetics of amyotrophic lateral sclerosis. Rev. Neurol. (Paris) 2017;173:254–262. doi: 10.1016/j.neurol.2017.03.030. [DOI] [PubMed] [Google Scholar]
  • 92.Bieth E, et al. Highly restricted deletion of the SNORD116 region is implicated in Prader–Willi Syndrome. Eur. J. Hum. Genet. 2015;23:252–255. doi: 10.1038/ejhg.2014.103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 93.Galiveti CR, Raabe CA, Konthur Z, Rozhdestvensky TS. Differential regulation of non-protein coding RNAs from Prader-Willi Syndrome locus. Sci. Rep. 2014;4:6445. doi: 10.1038/srep06445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 94.Angulo MA, Butler MG, Cataletto ME. Prader-Willi syndrome: a review of clinical, genetic, and endocrine findings. J. Endocrinol. Invest. 2015;38:1249–1263. doi: 10.1007/s40618-015-0312-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 95.Kishore S. The snoRNA HBII-52 Regulates Alternative Splicing of the Serotonin Receptor 2C. Science. 2006;311:230–232. doi: 10.1126/science.1118265. [DOI] [PubMed] [Google Scholar]
  • 96.Lawlor H, Meunier A, McDermott N, Lynch TH, Marignol L. Identification of suitable endogenous controls for gene and miRNA expression studies in irradiated prostate cancer cells. Tumor Biol. 2015;36:6019–6028. doi: 10.1007/s13277-015-3278-5. [DOI] [PubMed] [Google Scholar]
  • 97.Rice J, Roberts H, Rai SN, Galandiuk S. Housekeeping genes for studies of plasma microRNA: A need for more precise standardization. Surgery. 2015;158:1345–1351. doi: 10.1016/j.surg.2015.04.025. [DOI] [PubMed] [Google Scholar]
  • 98.Anger AM, et al. Structures of the human and Drosophila 80 S ribosome. Nature. 2013;497:80–85. doi: 10.1038/nature12104. [DOI] [PubMed] [Google Scholar]
  • 99.Sundaramoorthy E, et al. ZNF598 and RACK1 Regulate Mammalian Ribosome-Associated Quality Control Function by Mediating Regulatory 40 S Ribosomal Ubiquitylatio. n. Mol. Cell. 2017;65:751–760.e4. doi: 10.1016/j.molcel.2016.12.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 100.Haeusler AR, et al. C9orf72 nucleotide repeat structures initiate molecular cascades of disease. Nature. 2014;507:195–200. doi: 10.1038/nature13124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 101.Cobb LJ, et al. Naturally occurring mitochondrial-derived peptides are age-dependent regulators of apoptosis, insulin sensitivity, and inflammatory markers. Aging. 2016;8:796–809. doi: 10.18632/aging.100943. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 102.Romeo M, et al. Humanin Specifically Interacts with Amyloid-β Oligomers and Counteracts Their in vivo Toxicity. J. Alzheimers Dis. JAD. 2017;57:857–871. doi: 10.3233/JAD-160951. [DOI] [PubMed] [Google Scholar]
  • 103.Yen K, Lee C, Mehta H, Cohen P. The emerging role of the mitochondrial-derived peptide humanin in stress resistance. J. Mol. Endocrinol. 2013;50:R11–19. doi: 10.1530/JME-12-0203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 104.Gidlund, E.-K. et al. Humanin skeletal muscle protein levels increase after resistance training in men with impaired glucose metabolism. Physiol. Rep. 4 (2016). [DOI] [PMC free article] [PubMed]
  • 105.Schwarzenbach H, da Silva AM, Calin G, Pantel K. Data Normalization Strategies for MicroRNA Quantification. Clin. Chem. 2015;61:1333–1342. doi: 10.1373/clinchem.2015.239459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 106.Gee HE, et al. The small-nucleolar RNAs commonly used for microRNA normalisation correlate with tumour pathology and prognosis. Br. J. Cancer. 2011;104:1168–1177. doi: 10.1038/sj.bjc.6606076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 107.Brattelid T, et al. Normalization strategy is critical for the outcome of miRNA expression analyses in the rat heart. Physiol. Genomics. 2010;43:604–610. doi: 10.1152/physiolgenomics.00131.2010. [DOI] [PubMed] [Google Scholar]
  • 108.Andersen CL, Jensen JL, Ørntoft TF. Normalization of Real-Time Quantitative Reverse Transcription-PCR Data: A Model-Based Variance Estimation Approach to Identify Genes Suited for Normalization, Applied to Bladder and Colon Cancer Data Sets. Cancer Res. 2004;64:5245–5250. doi: 10.1158/0008-5472.CAN-04-0496. [DOI] [PubMed] [Google Scholar]
  • 109.Reczko M, Maragkakis M, Alexiou P, Grosse I, Hatzigeorgiou AG. Functional microRNA targets in protein coding sequences. Bioinformatics. 2012;28:771–776. doi: 10.1093/bioinformatics/bts043. [DOI] [PubMed] [Google Scholar]
  • 110.SSDBM 2014: proceedings of the 26th International Conference on Scientific and Statistical Database Management: June 30 - July 2, 2014, Aalborg, Denmark (9999).
  • 111.Aken BL, et al. The Ensembl gene annotation system. Database. 2016;2016:baw093. doi: 10.1093/database/baw093. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 112.Yates A, et al. Ensembl 2016. Nucleic Acids Res. 2016;44:D710–D716. doi: 10.1093/nar/gkv1157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 113.Vlachos IS, et al. DIANA-miRPathv3.0: deciphering microRNA function with experimental support. Nucleic Acids Res. 2015;43:W460–W466. doi: 10.1093/nar/gkv403. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 114.Vlachos IS, et al. DIANA-TarBase v7.0: indexing more than half a million experimentally supported miRNA:mRNA interactions. Nucleic Acids Res. 2015;43:D153–D159. doi: 10.1093/nar/gku1215. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES