Skip to main content
Chinese Medical Journal logoLink to Chinese Medical Journal
. 2018 Apr 5;131(7):813–817. doi: 10.4103/0366-6999.228232

In vitro Effects of Nerve Growth Factor on Cardiac Fibroblasts Proliferation, Cell Cycle, Migration, and Myofibroblast Transformation

神经生长因子对离体心脏成纤维细胞增殖、细胞周期、迁移以及肌成纤维细胞转化的影响

Yong Zhao 1, Chun-Hua Ding 2,
PMCID: PMC5887740  PMID: 29578125

Abstract

Background:

Recent research indicates that nerve growth factor (NGF) promotes cardiac repair following myocardial infarction by promoting angiogenesis and cardiomyocyte survival. The purpose of this study was to investigate the effects of NGF on cardiac fibroblasts (CFs) proliferation, cell cycle, migration, and myofibroblast transformation in vitro.

Methods:

CFs were obtained from ventricles of neonatal Sprague-Dawley rats and incubated with various concentrations of NGF (0, 0.01, 0.1, 1, 10, and 100 ng/ml; 0 ng/ml was designated as the control group). Cell proliferation and cell cycle of the CFs were measured by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and flow cytometry (FCM), respectively. A cell scratch wound model and transwell were carried out to observe effects of NGF on migration of CFs after 24 h of culture. Real-time polymerase chain reaction (RT-PCR) and Western blotting were used to measure α-smooth muscle actin (α-SMA) at mRNA and protein levels after CFs were incubated with various concentrations of NGF.

Results:

Expression of α-SMA measured by RT-PCR and Western blotting significantly increased in the 1 and 10 ng/ml NGF groups (P < 0.05). Absorbance values of CFs showed that NGF did not influence the proliferation of CFs (The A490 values were 0.178 ± 0.038, 0.182 ± 0.011, 0.189 ± 0.005, 0.178 ± 0.010, 0.185 ± 0.025, and 0.177 ± 0.033, respectively, in the 0, 0.01, 0.1, 1, 10, and 100 ng/ml NGF groups [P = 0.800, 0.428, 0.981, 0.596, and 0.913, respectively, compared with control group]), and FCM analysis showed that the percentage of CFs in G0/G1, S, and G2/M phases was not changed (P > 0.05). The cell scratch wound model and transwell showed that CFs migration was not significantly different (P > 0.05).

Conclusion:

NGF induces myofibroblast transformation but does not influence proliferation, cell cycle, or migration of CFs in vitro.

Keywords: Cell Cycle, Cell Movement, Cell Proliferation, Fibroblasts, Myofibroblasts, Nerve Growth Factor

INTRODUCTION

Cardiac fibroblasts (CFs) are the most abundant cell type in the heart and play a key role in maintaining cardiac structure and function by controlling proliferation and extracellular matrix (ECM) turnover. CFs are sources and targets of cardiac fibrosis during pathological myocardial remodeling such as myocardial infarction (MI) and hypertension.[1,2,3] Fibroblast proliferation, migration, and conversion to a myofibroblast phenotype in response to a variety of cytokines are related to cardiac injury and disease (such as transforming growth factor-β, connective tissue growth factor, platelet-derived growth factor, angiotensin II, endothelin-1, tumor necrosis factor-α, interleukin-6, and oxidative stress and mechanical stretch).[4,5]

Nerve growth factor (NGF) is a polypeptide that plays an important role in growth, differentiation, and survival of neurons. The biological activity of NGF is mediated by the tyrosine kinase receptor (trkA) and the low-affinity glycoprotein receptor p75 presenting on the surface of responsive cells.[6,7,8] NGF is expressed in normal hearts and upregulated following MI coupled with the regeneration of cardiac sympathetic nerves and heterogeneous innervation, which may result in ventricular tachycardia, ventricular fibrillation, and sudden cardiac death.[9,10] It was recently found that NGF promotes cardiac repair following MI by promoting angiogenesis and cardiomyocyte survival,[11] but little is known about the effects of NGF on the functions of CFs. Therefore, we aimed to investigate the in vitro effects of NGF on the profibrogenic properties of CFs in this study.

METHODS

Cell culture

CFs were obtained from the ventricles of neonatal Sprague-Dawley rats (1–3 days old) by the trypsin digestion method and characterized as previously described.[12] All experiments were performed in cells of the third to sixth passage after starvation in serum-free Dulbecco's Modified Eagle Medium (DMEM) for 24 h. Experimental procedures and protocols were approved by the Animal Care and Use Committee of Guangzhou University of Chinese Medicine and complied with the guidance suggestion of caring laboratory animals of the Ministry of Science and Technology of China.

Cell proliferation assay

Cell proliferation was evaluated by 3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Briefly, CFs were plated on 96-well plates (5000 cells/well), then starved by serum deprivation for 24 h, and treated with various concentrations (0, 0.01, 0.1, 1, 10, and 100 ng/ml; 0 ng/ml was designated as the control group) of NGF (R and D Systems, USA) in DMEM containing 0.5% FBS for 24 h. MTT reagent (20 μl) (Sigma, USA) was added to wells and incubated for 4 h. The cells were dissolved in DMSO, and optical density (A) was measured at 490 nm.

Cell cycle analysis

CFs were plated on 6-well plates at a density of 8 × 104 cells/well, 70–80% confluence and treated with various concentrations of NGF. After 24 h, cells were collected and washed one time with phosphate-buffered saline (PBS). Reagent A (1 ml) and reagent B (10 μl) (MultiSciences Biotech Co., China) were added and blended by vortexing for 5–10 s and incubated for 30 min at room temperature. Cell cycle distribution was then analyzed by flow cytometry (FCM) (Becton, Dickinson and Company, USA).

Cell migration assay

Cell migration was detected by two methods: scratch wound healing assay and transwell migration assay.[13] CFs (8 × 104) were cultured in 6-well plates until 70–80% confluence. The media were then replaced with serum-free DMEM to inhibit cell proliferation. The scratch wound was introduced using a blue pipette tip. The cultures were washed twice with PBS to remove debris and reincubated with serum-free media with vehicle or various NGF concentrations for 24 h. The images of scratch wounds of each culture for three independent repeats were captured by an Olympus 1X71 camera (Olympus, Japan) at 0 and 24 h time points during cell migration. Cells migrating into the wound site were quantified and compared with the control group. The original magnification of each image was ×40.

For transwell migration assay, serum-starved CFs (105) were loaded into the upper chamber of the migration apparatus (Corning, USA). DMEM containing 0.5% FBS was introduced into the lower chamber as a chemotactic stimulus. NGF at various concentrations (0, 0.1, 1.0, 10, and 100 ng/ml) was added to the lower chambers of the experimental wells. After incubation for 24 h at 37°C in a tissue culture incubator, nonmigrated cells remaining on the upper surface of the membrane were removed with a cotton swab and migrated cells were stained with 0.1% crystal violet for 30 min. Migrated cells were visualized and counted with a microscope at magnification ×200. Five fields were counted on each membrane. This analysis was performed in triplicate for each experimental condition. Migration was expressed as the mean value of the total number of migrated cells per field.

RNA isolation and real-time polymerase chain reaction analysis

After being treated with either 0, 0.01, 0.1, 1.0, 10, or 100 ng/ml NGF for 24 h, total RNA was extracted from the CFs using Trizol reagent according to the manufacturer's instructions and quantified using ultraviolet spectrophotometry. cDNA was generated from 1 mg total RNA using an AMV Reverse Transcriptase Kit. Real-time polymerase chain reaction (PCR) was performed in an Applied Biosystems 7300 Fast real-time PCR System (Foster City, CA, USA) with SYBR Green PCR Master Mix. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA amplified from the same samples served as an internal control. The relative expression of each targeted gene was normalized by subtracting the corresponding GAPDH threshold cycle (Ct) values using the 2−△△CT comparative method. The sequences of all primers used in this work were as follows: α-SMA: forward primer: AGCCAGTCGCCATCAGGAAC; reverse primer: GGGAGCATCATCACCAGCAA. GAPDH: forward primer: GCCCAGCAAGGATACTGAGA; reverse primer: TGGTATTCGAGAGAAGGGAGG.

Protein extraction and Western blotting analysis

Total CFs protein was isolated with RIPA lysis buffer (Sigma Aldrich, St. Louis, MO, USA). Protein concentrations were measured through BCA assay (Thermo Scientific, Waltham, MA, USA). Proteins were fractionated on a 10% polyacrylamide gel (Bio-Rad, Hercules, CA, USA), blotted onto nitrocellulose membrane, and probed with antibodies specific for α-SMA (Santa Cruz Biotechnology, Dallas, TX, USA). Signals were detected using ECL (Thermo Scientific, Waltham, MA, USA).

Statistical analysis

Data were expressed as the mean ± standard error (SE) of at least three independent experiments unless otherwise stated. The software of SPSS 13.0 for Windows (SPSS Inc., IL, USA) was used for analysis. Differences among groups were tested by one-way analysis of variance (ANOVA). P < 0.05 was considered statistically significant.

RESULTS

Effect of nerve growth factor on cardiac fibroblasts α-smooth muscle actin expression

The expression of a-SMA mRNA and a-SMA protein significantly increased upon 24 h treatment with 1 and 10 ng/ml NGF [Figures 1, 2a and 2b].

Figure 1.

Figure 1

Real-time polymerase chain reaction of α-SMA mRNA expression. 0.01, 0.1, 1, 10, and 100 ng/ml NGF effect on cardiac fibroblasts (n = 3). P = 0.586, 0.057, 0.000, 0.000, and 0.143, respectively, compared with control group (0 ng/ml NGF). *P < 0.05 compared with control group. α-SMA: α-smooth muscle actin; NGF: Nerve growth factor.

Figure 2.

Figure 2

(a and b) Western blotting of α-SMA expression. 0.01, 0.1, 1, 10, and 100 ng/ml NGF effect on cardiac fibroblasts (n = 3). P = 0.268, 0.383, 0.011, 0.028, and 0.332, respectively, compared with control group (0 ng/ml NGF). *P < 0.05 compared with control group. α-SMA: α-smooth muscle actin; NGF: Nerve growth factor.

Effect of nerve growth factor on cardiac fibroblasts proliferation

The various doses of NGF for 24 h had no effect on the proliferation of fibroblasts isolated from neonatal rat heart. The A490 values were 0.178 ± 0.038, 0.182 ± 0.011, 0.189 ± 0.005, 0.178 ± 0.010, 0.185 ± 0.025, and 0.177 ± 0.033, respectively, in the 0, 0.01, 0.1, 1, 10, and100 ng/ml NGF groups (P = 0.800, 0.428, 0.981, 0.596, and 0.913, respectively, compared with control group).

Effect of nerve growth factor on cardiac fibroblasts cell cycle

The cell cycle of CFs was determined by FCM. There was no significant difference in the percentage of cells in the G(0)/G(1) phase when compared to the control group (82.332% ± 4.001%, 82.298% ± 2.316%, 81.670% ± 2.469%, 80.628% ± 1.009%, and 80.652% ± 2.382% in the 0.01, 0.1, 1, 10, and 100 ng/ml NGF groups and 82.203% ± 3.002% in control) (P = 0.940, 0.956, 0.756, 0.362, and 0.370, respectively, compared with control group).

There was also no significant difference in the percentage of cells in the S phase when compared to the control group (10.283% ± 3.415%, 10.005% ± 3.145%, 10.328% ± 2.759%, 10.577% ± 2.665%, and 11.176% ± 3.600% in the 0.01, 0.1, 1, 10, and 100 ng/ml NGF groups and 10.710% ± 3.781% in control) (P = 0.838, 0.735, 0.854, 0.949, and 0.823, respectively, compared with control group).

Finally, there was no significant difference in the percentage of cells in the G(2)/M phase when compared to the control group (7.385% ± 1.446%, 7.697% ± 2.044%, 8.002% ± 1.261%, 8.795% ± 1.806%, and 8.172% ± 1.278% in the 0.01, 0.1, 1, 10, and 100 ng/ml NGF groups and 7.087% ± 1.941% in control) (P = 0.779, 0.567, 0.392, 0.117, and 0.312, respectively, compared with control group).

Effect of nerve growth factor on cardiac fibroblasts cell migration

In some conditions, cardiac fibrosis was associated with increased migration of CFs. A scratch assay was used to evaluate the potential modulation of the migratory ability of CFs by NGF. A denuded area was introduced in the center of confluent cultured fibroblasts, and the ability of fibroblasts to migrate into the denuded area was measured following the treatment of the cells with different doses of NGF. Over a 24 h period, rat CFs demonstrated no significant distance in migratory ability following treatment with the different doses of NGF used in the present study [Figure 3] (P = 0.523, 0.658, 0.568, 0.299, and 0.650, respectively, compared with control group).

Figure 3.

Figure 3

Scratch assay of migration distances of cardiac fibroblasts in different doses of NGF group (0.01, 0.1, 1, 10, and 100 ng/ml) compared with control group (0 ng/ml NGF), all P > 0.05. NGF: Nerve growth factor.

The Boyden chamber assay was used to examine the effect of NGF on CFs migration. After 24 h incubation, CFs were observed on the bottom side of the polyethylene terephthalate membranes in NGF-treated groups (0.01, 0.1, 1, 10, and 100 ng/ml), and there was no significant difference compared with the control group (P = 0.737, 0.436, 0.269, 0.504, and 0.780, respectively, compared with control group). This indicated that NGF did not affect the ability of CFs to invade across the layer [Figures 4 and 5].

Figure 4.

Figure 4

Cell numbers of cardiac fibroblasts migration in different groups by transwell (0, 0.01, 0.1, 1, 10, and 100 ng/ml nerve growth factor) (original magnification ×200).

Figure 5.

Figure 5

Cell numbers of cardiac fibroblasts migration in different groups by transwell (0.01, 0.1, 1, 10, and 100 ng/ml NGF) compared with control group (0 ng/ml NGF), all P > 0.05. NGF: Nerve growth factor.

DISCUSSION

Cardiac fibrosis is a common pathological process shared by multiple major heart diseases. Because CFs/myofibroblasts are the primary cells responsible for ECM deposition and turnover, it is important to understand the regulation of the function and gene expression of these cells. Myofibroblasts are not usually found in healthy cardiac tissue; however, on injury, myofibroblasts appear in the myocardium and participate in the cardiac wound healing response. Several recent reports indicated that NGF exerted a variety of effects on peripheral tissues, including fibrosis,[14,15,16] suggesting that NGF may be a target for cardiac fibrosis.

In our study, we found that NGF induces the expression of a-SMA in the 1 and 10 ng/ml groups, indicating their phenotype changes into myofibroblasts. These data show a direct pro-fibrogenic effect of NGF on CFs. Previous studies also indicated that NGF induced lung and skin fibroblast a-SMA expression through trkA.[14] Interestingly, the expression of a-SMA was lower in the 100 ng/ml concentration compared to that of the 10 ng/ml concentration. We speculate that (1) NGF increases a-SMA expression through the specific and unique binding to trkANGFR (specific receptor of NGF) but not p75NTR (the pan-neurotrophin receptor); and (2) high concentrations of NGF binding with the low-affinity glycoprotein receptor p75NTR decrease a-SMA expression.[17] The expression of p75NTR by myofibroblasts seems to play a switch-off effect in the further differentiating action of NGF. NGF plays a modulatory, rather than an exclusive, stimulatory effect on the fibrotic process[18,19] so that the 100 ng/ml group of NGF decreased a-SMA expression.

We found that NGF did not influence proliferation, cell cycle, or migration of CFs in vitro. Micera et al.[14] reported that NGF did not influence either skin or lung fibroblast proliferation, collagen production, and metalloproteinase production or activation. In contrast, NGF induced lung and skin fibroblast migration and a-SMA expression and collagen contraction. Gan et al.[16] found that NGF did not influence proliferation, mitotic cycle, and collagen synthesis of human dermal fibroblasts but significantly enhanced migration in vitro model of wounded fibroblasts. We believe that the differences may be caused by different species and tissue cell origin.

NGF concentration is higher in heart tissue than that in serum in physiological conditions or a pathological state. We chose the dose of NGF (0, 0.01, 0.1, 1, 10, and 100 ng/ml) to carry out our study according to previous studies.[14,16] The NGF content in the sera from normal subjects is about 200 pg/ml[20] and 50 pg/ml in rats; after MI, it increased to 350 pg/ml.[21] In a dog model of MI, it was found that both NGF protein and mRNA levels increased at the infarcted site and at the noninfarcted left ventricle free wall. NGF concentration in the coronary sinus is higher than in the aorta immediately after MI. This suggests that the heart can synthesize NGF and release it into serum.[9]

In conclusion, these data show a direct pro-fibrogenic effect of NGF on CFs and therefore NGF may be a target for cardiac fibrosis. The limitation of our study is that the detailed mechanisms underlying these effects and the chronic exposure of NGF on CFs were not explored.

Financial support and sponsorship

This study was supported by grants from Guangdong Province Talents Project in Colleges and Universities (No. 2050205), National Natural Science Foundation of China (No. 81503378), and Foundation of Guangdong Science and Technology Department (No. 2014A020221065).

Conflicts of interest

There are no conflicts of interest.

Acknowledgment

We thank Prof. Thomas H. Everett, IV (Krannert Institue of Cardiology, Indiana University School of Medicine, USA) and Prof. Duy T. Nguyen (Division of Cardiology, University of Colorado. USA) for proofreading the manuscript.

Footnotes

Edited by: Yuan-Yuan Ji

REFERENCES

  • 1.Souders CA, Bowers SL, Baudino TA. Cardiac fibroblast: The renaissance cell. Circ Res. 2009;105:1164–76. doi: 10.1161/CIRCRESAHA.109.209809. doi:10.1161/CIRCRESAHA.109.209809. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.van den Borne SW, Diez J, Blankesteijn WM, Verjans J, Hofstra L, Narula J. Myocardial remodeling after infarction: The role of myofibroblasts. Nat Rev Cardiol. 2010;7:30–7. doi: 10.1038/nrcardio.2009.199. doi:10.1038/nrcardio.2009.199. [DOI] [PubMed] [Google Scholar]
  • 3.Kakkar R, Lee RT. Intramyocardial fibroblast myocyte communication. Circ Res. 2010;106:47–57. doi: 10.1161/CIRCRESAHA.109.207456. doi:10.1161/CIRCRESAHA.109.207456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Takeda N, Manabe I. Cellular interplay between cardiomyocytes and nonmyocytes in cardiac remodeling. Int J Inflam. 2011;2011:535241. doi: 10.4061/2011/535241. doi:10.4061/2011/ [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Porter KE, Turner NA. Cardiac fibroblasts: At the heart of myocardial remodeling. Pharmacol Ther. 2009;123:255–78. doi: 10.1016/j.pharmthera.2009.05.002. doi:10.1016/j.pharmthera.2009.05.002. [DOI] [PubMed] [Google Scholar]
  • 6.Levi-Montalcini R. The nerve growth factor 35 years later. Science. 1987;237:1154–62. doi: 10.1126/science.3306916. doi:10.1126/science.3306916. [DOI] [PubMed] [Google Scholar]
  • 7.Aloe L, Bracci-Laudiero L, Bonini S, Manni L. The expanding role of nerve growth factor: From neurotrophic activity to immunologic diseases. Allergy. 1997;52:883–94. doi: 10.1111/j.1398-9995.1997.tb01247.x. doi:10.1111/j.1398-9995.1997.tb01247.x. [DOI] [PubMed] [Google Scholar]
  • 8.Chao MV, Hempstead BL. P75 and Trk: A two-receptor system. Trends Neurosci. 1995;18:321–6. doi:10.1016/0166-2236(95)93922-K. [PubMed] [Google Scholar]
  • 9.Zhou S, Chen LS, Miyauchi Y, Miyauchi M, Kar S, Kangavari S, et al. Mechanisms of cardiac nerve sprouting after myocardial infarction in dogs. Circ Res. 2004;95:76–83. doi: 10.1161/01.RES.0000133678.22968.e3. doi:10.1161/01.RES.0000133678.22968.e3. [DOI] [PubMed] [Google Scholar]
  • 10.Cao JM, Chen LS, KenKnight BH, Ohara T, Lee MH, Tsai J, et al. Nerve sprouting and sudden cardiac death. Circ Res. 2000;86:816–21. doi: 10.1161/01.res.86.7.816. doi:10.1161/01.RES.86.7.816. [DOI] [PubMed] [Google Scholar]
  • 11.Meloni M, Caporali A, Graiani G, Lagrasta C, Katare R, Van Linthout S, et al. Nerve growth factor promotes cardiac repair following myocardial infarction. Circ Res. 2010;106:1275–84. doi: 10.1161/CIRCRESAHA.109.210088. doi:10.1161/CIRCRESAHA.109.210088. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Lu B, Mahmud H, Maass AH, Yu B, van Gilst WH, de Boer RA, et al. The Plk1 inhibitor BI 2536 temporarily arrests primary cardiac fibroblasts in mitosis and generates aneuploidy in vitro. PLoS One. 2010;5:e12963. doi: 10.1371/journal.pone.0012963. doi:10.1371/journal.pone.0012963. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Porter KE, Naik J, Turner NA, Dickinson T, Thompson MM, London NJ. Simvastatin inhibits human saphenous vein neointima formation via inhibition of smooth muscle cell proliferation and migration. J Vasc Surg. 2002;36:150–7. doi: 10.1067/mva.2002.122029. doi:10.1067/mva.2002.122029. [DOI] [PubMed] [Google Scholar]
  • 14.Micera A, Vigneti E, Pickholtz D, Reich R, Pappo O, Bonini S, et al. Nerve growth factor displays stimulatory effects on human skin and lung fibroblasts, demonstrating a direct role for this factor in tissue repair. Proc Natl Acad Sci U S A. 2001;98:6162–7. doi: 10.1073/pnas.101130898. doi:10.1073/pnas.101130898. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kılıç A, Sonar SS, Yildirim AO, Fehrenbach H, Nockher WA, Renz H. Nerve growth factor induces type III collagen production in chronic allergic airway inflammation. J Allergy Clin Immunol. 2011;128:1058–660. doi: 10.1016/j.jaci.2011.06.017. doi:10.1016/j.jaci.2011.06.017. [DOI] [PubMed] [Google Scholar]
  • 16.Gan H, Xie H, Chen X, Luo J. Effects of NGF on proliferation, mitotic cycle, collagen synthesis and migration of human dermal fibroblasts in vitro (in Chinese) Chin J Repar Reconst Surg. 2009;23:1350–4. [PubMed] [Google Scholar]
  • 17.Micera A, Puxeddu I, Balzamino BO, Bonini S, Levi-Schaffer F. Chronic nerve growth factor exposure increases apoptosis in a model of in vitro induced conjunctival myofibroblasts. PLoS One. 2012;7:e47316. doi: 10.1371/journal.pone.0047316. doi:10.1371/journal.pone.0047316. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Micera A, Lambiase A, Stampachiacchiere B, Sgrulletta R, Normando EM, Bonini S, et al. Nerve growth factor has a modulatory role on human primary fibroblast cultures derived from vernal keratoconjunctivitis-affected conjunctiva. Mol Vis. 2007;13:981–7. [PMC free article] [PubMed] [Google Scholar]
  • 19.Micera A, Stampachiacchiere B, Di Zazzo A, Sgrulletta R, Cortes M, Normando EM, et al. NGF modulates trkANGFR/p75NTR in αSMA-expressing conjunctival fibroblasts from human ocular cicatricial pemphigoid (OCP) PLoS One. 2015;10:e0142737. doi: 10.1371/journal.pone.0142737. doi:10.1371/journal.pone.0142737. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Serrano T, Lorigados LC, Armenteros S. Nerve growth factor levels in normal human sera. Neuroreport. 1996;8:179–81. doi: 10.1097/00001756-199612200-00036. doi:10.1097/00001756-199612200-00036. [DOI] [PubMed] [Google Scholar]
  • 21.Xin P, Pan Y, Zhu W, Huang S, Wei M, Chen C. Favorable effects of resveratrol on sympathetic neural remodeling in rats following myocardial infarction. Eur J Pharmacol. 2010;649:293–300. doi: 10.1016/j.ejphar.2010.09.036. doi:10.1016/j.ejphar.2010.09.036. [DOI] [PubMed] [Google Scholar]

Articles from Chinese Medical Journal are provided here courtesy of Wolters Kluwer Health

RESOURCES