Skip to main content
Biotechnology for Biofuels logoLink to Biotechnology for Biofuels
. 2018 Apr 7;11:103. doi: 10.1186/s13068-018-1104-1

Engineering and application of synthetic nar promoter for fine-tuning the expression of metabolic pathway genes in Escherichia coli

Hee Jin Hwang 1, Sang Yup Lee 2, Pyung Cheon Lee 1,
PMCID: PMC5889552  PMID: 29636821

Abstract

Background

Promoters regulate the expression of metabolic pathway genes to control the flux of metabolism. Therefore, fine-tuning of metabolic pathway gene expression requires an applicable promoter system. In this study, a dissolved oxygen-dependent nar promoter was engineered for fine-tuning the expression levels of biosynthetic pathway enzymes in Escherichia coli. To demonstrate the feasibility of using the synthetic nar promoters in production of biochemicals in E. coli, the d-lactate pathway consisting of one enzyme and the 2,3-butanediol (BDO) pathway consisting of three enzymes were investigated.

Results

The spacer sequence of 15 bp between the − 35 and − 10 elements of the upstream region of the wild-type nar promoter was randomized, fused to the GFP gene, transduced into E. coli, and screened by flow cytometry. The sorted synthetic nar promoters were divided into three groups according to fluorescence intensity levels: strong, intermediate, and weak. The selected three representative nar promoters of strong, intermediate, and weak intensities were used to control the expression level of the d-lactate and 2,3-BDO biosynthetic pathway enzymes in E. coli. When the ldhD gene encoding d-lactate dehydrogenase was expressed under the control of the strong synthetic nar promoter in fed-batch cultures of E. coli, the d-lactate titers were 105.6 g/L, 34% higher than those using the wild-type promoter (79.0 g/L). When the three 2,3-BDO pathway genes (ilvBN, aldB, and bdh1) were expressed under the control of combinational synthetic nar promoters (strong–weak–strong) in fed-batch cultures of E. coli, the titers of 2,3-BDO were 88.0 g/L, 72% higher than those using the wild-type promoter (51.1 g/L).

Conclusions

The synthetic nar promoters, which were engineered to have strong, intermediate, and weak intensities, were successfully applied to metabolic engineering of d-lactate and 2,3-BDO pathways in E. coli. By controlling expression levels of d-lactate and 2,3-BDO pathway enzymes using the synthetic nar promoters, the production of d-lactate and 2,3-BDO was increased over that using the wild-type promoter by 34 and 72%, respectively. Thus, this synthetic promoter module system will support the improved production of biochemicals and biofuels through fine-tuning of gene expression levels.

Keywords: nar promoter; Oxygen-dependent promoter; Lactate; 2,3-Butanediol; Promoter engineering

Background

Synthetic biology aims to develop desired biological system through the rational design of synthetic parts/modules, including promoters, RNAs, and scaffolds [14]. Gene expression can be controlled utilizing several factors, such as promoters, transcription factors, and plasmid copy numbers [5, 6]. Among them, promoter engineering has been proposed as one of the most efficient ways of fine-tuning transcriptional control in Escherichia coli, Corynebacterium glutamicum, Bacillus subtilis, and yeasts [310]. For example, the E. coli strain with engineered l-phenylalanine-responsive promoter could produce fourfold higher titer of phenylalanine than wild-type promoter [11], and the engineered tac promoter library could decrease leakage of antibody fragment expression in E. coli [12].

Recently, a dissolved oxygen (DO)-dependent nar promoter was successfully applied to express the d-lactate, 2,3-butanediol (BDO), and 1,3-propanediol (PDO) pathway enzymes in E. coli [13]. However, when a multienzyme biosynthetic pathway was reconstructed in heterologous host cells, individual expression of each pathway enzyme needed to be finely controlled; assembly or organization of multienzyme systems could significantly influence metabolic channeling, and thus suboptimal assembly or organization would cause accumulation of unwanted metabolic intermediates in multi-step enzyme reactions [14, 15]. Even single-enzyme metabolic pathways also should be considered for fine-tuning of expression, because expression level frequently affects end-product formation due to inclusion body formation [16].

Compared to other commonly used strong promoters such as lac or araBAD, the intensity of the wild-type nar promoter is relatively weak [13]; therefore, engineering of the wild-type nar promoter was required for fine control of target pathway gene expression. In this study, in order to generate synthetic nar promoters of diverse strengths, a synthetic nar promoter library was constructed by randomization of the spacer region sequence (15 bp) located between the consensus sequence − 35 and − 10 elements of the wild-type nar promoter (Fig. 1a). Characterization of the selected three synthetic promoters showing weak, intermediate, and strong intensities was performed through transcriptional expression level and GFP fluorescence intensity assays. Then, the selected three synthetic promoters were applied to the expression of the d-lactate pathway consisting of one gene and the 2,3-BDO biosynthesis pathway consisting of three genes (Fig. 1b). We demonstrated that the production of d-lactate and 2,3-BDO was improved by tuning the expression of their pathway genes under three different strengths of the synthetic nar promoters in E. coli.

Fig. 1.

Fig. 1

a Schematic diagram for construction of the synthetic nar promoter library. The 15-bp spacer sequence (indicated by consecutive 15 Ns) between the − 35 and − 10 elements of the wild-type nar promoter was randomized. An FNR binding site is shown in italics; the − 35 and − 10 elements are indicated by underlines; a red arrow indicates a transcription start site (+ 1); SD, Shine–Dalgarno sequence, GFPm; modified green fluorescence protein with His6 tag. b Reconstructed d-lactate and 2,3-butanediol (2,3-BDO) biosynthesis pathways in E. coli. The d-lactate pathway (red) consists of ldhD gene encoding d-lactate dehydrogenase (LDHD); the 2,3-BDO pathway (blue) consists of ilvBN gene encoding acetohydroxybutanoate synthase/acetolactate synthase (IlvBN), aldB gene encoding acetolactate decarboxylase (AldB), and bdh1 encoding butanediol dehydrogenase (BDH1)

Results

Construction, screening, and strength analysis of a synthetic nar promoter library of diverse strengths

The 15-bp spacer region sequence between the − 35 and − 10 elements of the wild-type nar promoter was randomized using degenerated primers to construct a synthetic nar promoter library of diverse strengths. The randomized synthetic promoters were fused by PCR to a DNA fragment consisting of a Shine–Dalgarno sequence, spacer, and His6-tagged GFPm as a reporter protein for screening based on the fluorescence intensity of the expressed GFPm (Fig. 1a). The randomized promoter fragments were then ligated with a pSTVM plasmid (Table 1) and then transduced into E. coli TOP10 cells.

Table 1.

Bacterial strains and plasmids used in this study

Strains and plasmids Relevant properties Source or reference
Strains
 E. coli TOP10 F-mcrAΔ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 nupG recA1 araD139 Δ(ara-leu)7697 galE15 galK16 rpsL(StrR) endA1 Invitrogen
 W023 W ΔldhA ΔpflB ΔadhE ΔlpdA::K.p. lpdE354 K Δmdh ΔarcA gltAR164L [13, 21]
 Lactobacillus citreum Source for ldhD KCTC3721
 Lactococcus lactis subsp. lactis Source for aldB KCTC3899
 Saccharomyces cerevisiae S288c Source for bdh1 ATCC 204508
Plasmids
 pUCM Cloning vector modified from pUC19; constitutive lac promoter, ApR [23]
 pUCM-gfpm Constitutive expressed gfpm gene with lac promoter This study
 pUCN Cloning/expression vector having inducible wild-type nar promoter, AmpR [13]
 pUCN-gfpm Inducible expressed gfpm gene with nar promoter This study
 pQE-gfpm Inducible expressed gfpm gene with T5 promoter [22]
 pUCNr Cloning/expression vector having rop gene and wild-type nar promoter, AmpR This study
 pUCNrS Cloning/expression vector having rop gene and strong nar promoter (S3-2-64), AmpR This study
 pUCNrI Cloning/expression vector having rop gene and intermediate nar promoter (W2U-30), AmpR This study
 pUCNrW Cloning/expression vector having rop gene and weak nar promoter (W2L-29), AmpR This study
 NrSL Inducible expressed ldhD gene from L. citreum on pUCNrS This study
 NrIL Inducible expressed ldhD gene from L. citreum on pUCNrI This study
 NrWL Inducible expressed ldhD gene from L. citreum on pUCNrW This study
 NrSi Inducible expressed ilvBN gene from E. coli on pUCNrS This study
 NrIi Inducible expressed ilvBN gene from E. coli on pUCNrI This study
 NrWi Inducible expressed ilvBN gene from E. coli on pUCNrW This study
 NrSa Inducible expressed aldB gene from L. lactis with strong nar promoter This study
 NrIa Inducible expressed aldB gene from L. lactis with intermediate nar promoter This study
 NrWa Inducible expressed aldB gene from L. lactis with weak nar promoter This study
 NrSb Inducible expressed bdh1 gene from S. cerevisiae with strong nar promoter This study
 NrIb Inducible expressed bdh1 gene from S. cerevisiae with intermediate nar promoter This study
 NrWb Inducible expressed bdh1 gene from S. cerevisiae with weak nar promoter This study
 pSTVM2 Cloning/expression vector removing lac promoter, CmR [13]
 pSTVM2- SNPL-gfpm gfpm expression vector with synthetic nar promoter library This study
 pSTVM-gfpm Constitutive expressed gfpm gene with constitutive lac promoter on pSTVM2 This study
 Ni Inducible expressed ilvBN gene with wild-type nar promoter on pSTVM2 [13]
 Si Inducible expressed ilvBN gene with strong nar promoter on pSTVM2 This study
 Ii Inducible expressed ilvBN gene with intermediate nar promoter on pSTVM2 This study
 Wi Inducible expressed ilvBN gene with weak nar promoter on pSTVM2 This study
 NiNa Individually inducible expressed ilvBN and aldB genes with wild-type nar promoter on pSTVM2 [13]
 SiSa Individually inducible expressed ilvBN and aldB genes with strong nar promoter on pSTVM2 This study
 IiIa Individually inducible expressed ilvBN and aldB genes with intermediate nar promoter on pSTVM2 This study
 SiWa Individually inducible expressed ilvBN with strong promoter and aldB with weak nar promoter on pSTVM2 This study
 NNN Inducible expressed ilvBN, aldB, and bdh1 genes under each nar promoter on pSTVM2 [13]
 SWS Individually inducible expressed ilvBN with strong promoter, aldB with weak promoter, and bdh1 with strong promoter This study

The library (4.59 × 1010 cell size), showing diverse fluorescence intensities, was sorted into three groups (low, intermediate, and high strength) by FACS in three rounds of sorting. The 1st round sorting was carried out with two collections of the upper and lower 1% of fluorescence intensity signals. The collected cells were grown on LB+cm agar plates and submitted to 2nd round sorting. After repeating this for 3rd round sorting, clones showing high (a red line in Fig. 2a), immediate (a blue line), and low (a yellow line) fluorescence intensities were collected and further analyzed.

Fig. 2.

Fig. 2

a FACS analysis of E. coli cells containing the synthetic nar promoter library. Histograms of sorted cell libraries and control cells are represented by colored lines. Black: negative control (empty vector), yellow: sorted cells showing weak intensities, green: positive control (a wild-type nar promoter), blue: sorted cells showing intermediate intensities, and red: sorted cells showing strong intensities. b Promoter strength analysis of the synthetic nar promoters. GFP fluorescence intensities of the collected 68 clones having synthetic nar promoters were measured by spectrofluorometer and normalized as relative fluorescence unit (RFU)/OD600. Representative strong (S3-2-64), intermediate (W2U-30), and weak (W2L-29) nar promoters are represented by green, yellow, and red bars, respectively

After reconfirmation of the GFP fluorescence intensities of 300 randomly selected clones from the 3 groups (100 clones from each group), fluorescences of 68 distinguishable clones were measured and compared based on relative fluorescence units (RFU)/OD600 (Fig. 2b). Based on the normalized values of RFU/OD600, synthetic nar promoters were grouped into strong (> 5000 RFU/OD600), intermediate (1000–2000 RFU/OD600), and weak (< 1000 RFU/OD600) groups. From each group, a representative synthetic nar promoter of strong (S3-2-64), intermediate (W2U-30), and weak (W2L-29) fluorescence was chosen for further analysis. The strength of the strong synthetic nar promoter (S3-2-64) and the intermediate nar promoter (W2U-30) were 19.8 and 6.2 times higher than that of the wild-type nar promoter, respectively, while the strength of the weak nar promoter (W2L-29) was 1.8 times weaker than that of the wild-type nar promoter based on values of RFU/OD600.

Characterization of the three representative synthetic nar promoters

The three representative nar synthetic promoters were then characterized in detail by analyzing levels of transcription, protein expression, and fluorescence of GFPm (Fig. 3a). In transcriptional analysis, qRT-PCR was carried out with a cysG gene encoding siroheme synthase [17] as a reference in order to evaluate ΔΔCt values of GFPm expression under the control of the wild-type, strong, intermediate, and weak nar promoters. The ΔΔCt values of the strong, intermediate, and weak nar promoters were 29.4 ± 5.6, 8.4 ± 1.0, and 2.3 ± 0.4, respectively. Unexpectedly, the ΔΔCt value of the weak nar promoter was positive, indicating a higher transcription level than that of the wild-type nar promoter. Next, protein expression levels were examined by western blotting with endogenous GAPDH as a reference. The protein expression levels of GFPm under the control of the strong, intermediate, and weak nar promoters were approximately 19.7, 7.11, and 0.37 times higher than that of the wild-type nar promoter. Notably, the protein expression levels of the strong and intermediate nar promoters were 4.6 and 1.7 times higher, respectively, than that of the constitutive lac promoter. Finally, the fluorescence intensities of GFPm under the control of the strong, intermediate, and weak nar promoters were 10,017 ± 915, 2305 ± 360, and 218 ± 18 RFU/OD600, respectively.

Fig. 3.

Fig. 3

a Evaluation of synthetic promoter strength. Correlation among relative mRNA expression levels (x-axis), relative protein expression levels (y-axis), and GFP fluorescence intensities (z-axis). Green circle, a strong nar promoter; yellow circle, an intermediate nar promoter; red circle, a weak nar promoter, white circle; a constitutive lac promoter, black circle; a wild-type nar promoter. b Sequence analysis of the representative synthetic nar promoters. The yellow box indicates the randomly mutated spacer sequence between the − 35 box and − 10 box. The blue boxes indicate consensus bases in the spacer region of nar promoters

The randomly mutated spacer regions of the nine nar promoters including three representatives were sequenced and compared. One distinguishable difference between the synthetic and wild-type nar promoters was a GC content in the space sequences: lower GC contents were observed in all synthetic promoters (strong: 33.3%; intermediate: 40%; weak: 33.3%) than in the wild-type nar promoter (60%) (Fig. 3b). A conserved sequence (GTN[A/G]N) located between the − 24 and − 20 positions was observed in seven clones representing intermediate and weak promoters, but not in that of the strong promoter. It has been shown that strong promoters tend to have AT-rich spacers, which help flexibility and bendability of DNA structures [18]. This is true for the strong nar promoter because it has AT-rich spacers and lacks the conserved sequence present in the weaker promoters.

Comparison of d-lactate production with synthetic nar promoters of different strengths

In order to investigate the effect of nar promoter strength on metabolic pathway flux in E. coli, a d-lactate pathway consisting of one d-lactate dehydrogenase was first chosen. The ldhD gene encoding d-lactate dehydrogenase from L. citreum was cloned into pUCNrS, pUCNrI, pUCNrW, and pUCN (Table 1), to be expressed under the control of the four nar promoters: strong, intermediate, weak, and wild-type. The four ldhD gene-expression plasmids (NrSL, strong; NrIL, intermediate; NrWL, weak; NrL, wild-type) were transduced into E. coli, and then the four recombinant E. coli strains were microaerobically grown in flasks containing 20 g/L glucose as a carbon source [13]. After a 20-h cultivation, d-lactate titers were measured to be 18.6 ± 0.6 in E. coli having NrL, 18.7 ± 0.4 in NrSL, 18.5 ± 0.4 in NrIL, and 18.3 ± 0.1 in NrWL (Fig. 4a). Because d-lactate titers were similar in all four E. coli strains, two E. coli strains having NrL and NrSL were chosen and fed-batch fermentation with glucose as a carbon source was carried out to investigate the effect of the strength of nar promoters (strong vs. wild-type) on d-lactate production. When the DO-controlled fed-batch fermentation of E. coli strain having NrSL was carried out as described in our previous study [13], 105.6 g/L of d-lactate was obtained after a 23-h cultivation. The d-lactate yield and productivity were 0.71 g/g-glucose and 4.59 g/L/h, respectively (Fig. 4b). In comparison, the E. coli strain with NrL produced 79.0 g/L of d-lactate with d-lactate yield of 0.67 g/g-glucose and productivity of 3.47 g/L/h (Fig. 4c). This result supports that higher expression of d-lactate dehydrogenase under the control of the synthetic strong nar promoter directed more metabolic flux into d-lactate biosynthesis in E. coli. Consequently, controlling d-lactate dehydrogenase with the strong nar promoter enhanced d-lactate titers by 34% compared to those of the wild-type nar promoter (105.6 g/L vs. 79.0 g/L).

Fig. 4.

Fig. 4

a Comparison of d-lactate production by each promoter in flask-scale fermentations. The black, light gray, and dark gray indicate production of d-lactate after 4, 8, and 20 h, respectively. The error bars show the standard deviations from triplicate experiments. Production of d-lactate under control of strong synthetic nar promoter (b) and the wild-type nar promoter (c) in fed-batch fermentations. Black square, d-lactate; hollow circle, cell growth; hollow triangle, glucose; solid gray circle, DO level; red arrows, the time of DO downshift (induction)

Comparison of acetoin and 2,3-BDO production with the synthetic nar promoters of different strengths

As a second demonstration of the feasibility of using the synthetic nar promoters in production of biochemicals in E. coli, acetoin, consisting of two enzymes, and the 2,3-butanediol (2,3-BDO) pathway, consisting of three enzymes, were investigated using the three representative nar promoters. First, the production of acetoin, a 2,3-BDO pathway intermediate (Fig. 1b), was investigated. In order to reconstruct the heterologous acetoin pathway in E. coli, two acetoin pathway genes, ilvBN from E. coli and aldB from L. lactis, were modified to be expressed under the control of the three synthetic nar promoters by cloning each gene into pUCNrS, pUCNrI, and pUCNrW. Next, the resulting 6 expression modules (Si, Ii, Wi, Sa, Ia, and Wa, where S stands for strong promoter, I for intermediate promoter, W for weak promoter, i for ilvBN, and a for aldB) were combined to produce 9 expression vectors (Fig. 5a).

Fig. 5.

Fig. 5

Comparison of acetoin production with the expression of ilvBN and aldB under control of the 3 synthetic nar promoters in flask cultures. a Combination of expression modules of ilvBN and aldB genes. Modules are Si, Ii, Wi, Sa, Ia, and Wa; S stands for strong promoter, I for intermediate promoter, W for weak promoter, i for ilvBN, and a for aldB. b Titer of acetoin obtained by expressing 10 modules in flask cultures. The positive control Ni–Na is a module expressing the ilvBN and aldB genes with a wild-type nar promoter. Black and white bars indicate acetoin and 2,3-BDO, respectively

When 10 expression modules including a positive control module Ni–Na (ilvBN and aldB expressed with a wild-type nar promoter) were expressed in flask cultures of E. coli, the expression of the ilvBN gene with strong and intermediate synthetic nar promoters (Si and Ii) produced an average of 6.30 g/L of acetoin regardless of promoter strength for expressing the aldB gene. However, the expression of ilvBN with the weak nar promoter (Wi) produced the lowest acetoin production (3.4 ± 0.3 g/L) when the aldB gene was coexpressed with the weak nar promoter (Wa) (Fig. 5b). Unexpectedly, when a heterologous acetoin pathway was reconstructed in E. coli, the end-product acetoin was to a limited degree transformed into 2,3-BDO by unknown factors [19]. Therefore, when the total summed amount of acetoin and 2,3-BDO produced by combination of the 10 modules was taken into consideration, Si–Wa and Ii–Ia combinations exhibited better production than the others (8.4 ± 0.5 and 8.1 ± 0.6 g/L, respectively).

Next, the two selected acetoin-producing combination modules, Si–Wa and Ii–Ia, were assembled as independent expression modules into one plasmid pSTVM2, resulting in SiWa and IiIa (Table 1). In order to reconstruct a 2,3-BDO pathway on the two-plasmid system, SiWa and IiIa were coexpressed with bdh1 from S. cerevisiae under the control of the 3 synthetic nar promoters (6 expression combinations: Si, Ii, Wi, Sa, Ia, Wa, Sb, Ib, and Wb, where S stands for strong, I for intermediate, W for weak, i for ilvBN, a for aldB, and b for bdh1; Fig. 6a) in flask cultures. Among seven complementations including a wild-type nar promoter module (NiNa–Nb), the SiWa–Sb combination module produced the highest titer of 2,3-BDO (9.7 ± 0.2 g/L), followed by the SiWa–Wb module (Fig. 6b). This best combination modules along with the wild-type nar promoter module as a positive control were then assembled as an independent expression module into one plasmid pSTVM2, resulting in SWS and NNN. After fed-batch cultivation of E. coli expressing NNN and SWS, the SWS module produced 88.0 g/L of 2,3-BDO (Fig. 6c), while the NNN module produced 51.1 g/L of 2,3-BDO (Fig. 6d). This fine-tuning of each 2,3-BDO pathway enzyme expression enhanced the 2,3-BDO titer by 72%. Even though conversion yields (g/g-glucose) were similar [0.33 (NNN) vs. 0.35 (SWS)], volumetric productivity of 2,3-BDO obtained by expressing SWS was 1.87 g/L/h, which was 75% higher than the 1.07 g/L/h obtained by expressing NNN.

Fig. 6.

Fig. 6

Comparison of 2,3-BDO production with the expression of ilvBN, aldB, and bdh1 under control of the 3 synthetic nar promoters. a Combination of expression modules of ilvBN, aldB, and bdh1 genes. Modules are Si, Ii, Wi, Sa, Ia, Wa, Sb, Ib, and Wb; S stands for strong promoter, I for intermediate promoter, W for weak promoter, i for ilvBN, a for aldB, and b for bdh1. b Titer of 2,3-BDO obtained by expressing 7 modules in flask cultures. The positive control NiNa-Nb is a module expressing ilvBN, aldB, and bdh1 genes with a wild-type nar promoter. Fed-batch cultivation of E. coli expressing SWS (c) and NNN (d) modules. The SWS module expressed ilvBN with a strong, aldB with a weak, and bdh1 with a strong nar promoter. The positive control NNN module expressed ilvBN, aldB, and bdh1 genes with a wild-type nar promoter. Black square, 2,3-BDO; hollow circle, cell growth; hollow triangle, glucose; solid gray circle, DO level; red arrows, the time of DO downshift (induction)

Discussion

A promoter is one cellular strategy for controlling the flux of metabolism by regulating the expression of metabolic pathway genes. Therefore, fine-tuning of metabolic pathway gene expression requires an applicable promoter system. In our previous study, a DO-dependent nar promoter was successfully applied to control expressions of biochemical biosynthetic pathway enzymes in E. coli [13]. However, more fine-tuning of expressions of biochemical biosynthetic pathway enzymes is necessary to enhance yield and titer of a target biochemical or biofuel by metabolic flux channeling. Therefore, in this study, 3 synthetic nar promoters showing weak (W2L-29), intermediate (W2U-30), and strong (S3-2-64) intensities were constructed by randomization of the spacer region sequence (15 bp) located between the consensus sequence − 35 and − 10 elements of the wild-type nar promoter (Fig. 1a). Analyses of transcription by qRT-PCR, protein expression by western blotting, and fluorescence by a GFPm reporter protein assay were in a good correlation with the apparent strengths of the 3 synthetic nar promoters (Fig. 3a). Sequence analysis showed that these synthetic nar promoters have relatively higher AT contents than the wild-type nar promoter and higher variations at the − 24, − 20, and − 14 sequence sites (Fig. 3b). The observed features of the synthetic nar promoters are well supported by other research reporting that the AT-rich sequences of the spacer region affected the strength of the promoter through structural changes [18, 20].

To evaluate the general use of synthetic promoters in biochemical production, the 3 synthetic nar promoters were used to express d-lactate and 2,3-BDO pathway enzymes. Among the 3 synthetic nar promoters, the expression of the ldhD gene under the control of the strong synthetic nar promoter on a low-copy plasmid produced the highest amount (105.6 g/L) of d-lactate by fed-batch fermentation. This titer is slight lower than the 113.1 g/L of d-lactate which was obtained by fed-batch fermentation [13] by expression of the ldhD gene with the wild-type nar promoter on a high-copy plasmid. This suggests that the ldhD expression level may be highly correlated with titer of d-lactate. The correlation of expression level and production titer was also high in the production of 2,3-BDO. In a similar manner to d-lactate pathway gene expression, each of the three 2,3-BDO biosynthesis pathway genes (ilvBN, aldB, and bdh1) were modified to be under the control of the synthetic nar promoters of different strengths and combinatorially expressed. In the case of the acetoin pathway, which is a precursor of 2,3-BDO, controlling ilvBN gene expression was critical in biosynthesis flux because the expression of ilvBN with a weak nar promoter resulted in lower titers of acetoin than expression with strong or intermediate promoters regardless of the promoter strength for expressing the aldB gene. The acetoin pathway was further extended to 2,3-BDO by controlling expression of the bdh1 gene with the 3 synthetic nar promoters. The best combinatorial expression module for 2,3-BDO was a strong promoter for ilvBN (Si), weak promoter for aldB (Wa), and strong promoter for bdh1 (Sb). The expression module (Si + Wa + Sb) produced 88.0 g/L of 2,3-BDO in fed-batch fermentation, which was 72% higher than the 51.1 g/L obtained by expressing the 3 enzymes with a wild-type nar promoter.

Conclusions

In this study, the synthetic nar promoters, which were engineered to have strong, intermediate, and weak intensities, were successfully applied to metabolic engineering of the d-lactate and 2,3-BDO pathways in E. coli. By controlling expression levels of one d-lactate enzyme and three 2,3-BDO pathway enzymes using the synthetic nar promoters, the production of d-lactate and 2,3-BDO was increased by 34 and 72%, respectively, compared with production using a wild-type nar promoter. This synthetic nar promoter module system will support the improved production of biochemicals and biofuels through the fine-tuning of gene expression levels in E. coli.

Methods

Strains

The E. coli TOP10 (Invitrogen, USA) strain was used for cloning and maintenance of plasmids. The E. coli W023 [13, 21] strain was used to produce d-lactate, acetoin, and 2,3-BDO in flask and fed-batch fermentation. The bacterial strains used in this study are listed in Table 1.

Construction of the randomized nar promoter library

A gfpm gene encoding GFPm was amplified by PCR from pQE-gfpm [22] with gene-specific primers including ribosome binding site (RBS) and restriction enzyme sites, and then the PCR product was inserted between XmaI and NotI sites downstream of a wild-type nar promoter on pUCN [13] and pUCM plasmids [23]. In order to randomize the spacer sequence (15 bp) between the − 10 and − 35 elements of the nar promoter, two primers, XmaI-SNPL-gfpm-F and SphI-gfpm-R (Table 2) were designed. The XmaI-SNPL-gfpm-F primer contains a restriction enzyme site (XmaI), the − 35 element, randomized 15-bp sequences (N15), the − 10 element, and the gfpm-specific sequence in order. The SphI-gfpm-R primer contains a restriction enzyme site (SphI) and the gfpm-specific sequence. The randomized nar promoter region and gfpm gene amplified by PCR were cloned into the XmaI and SphI sites of the pSTVM2 plasmid [13], generating pSTVM2-SNPL-gfpm. The pSTVM2-SNPL-gfpm plasmids were transduced into E. coli TOP10 cells by electroporation and the transformants were incubated in 40 mL Luria–Bertani (LB) medium supplemented with 30 μg/L chloramphenicol [24] at 30 °C with shaking at 100 rpm.

Table 2.

Primers used in this study

Primer name Sequence (5′–3′)
For cloning
 XmaI-SNPL-gfpm-F TCCCCCCGGGCTCTTGATCGTTATCAAATCCCANNNNNNNNNNNNNNNGTATAATGCCCTTAAAAGGAGGATTACAAAATGAGTAAAGGAGAAGAACT
 SphI-gfpm-R ACATGCATGCTTAGTGGTGGTGGTGGTGGTGTTTGTAGAGCTCATCGATGC
 XmaI-gfpm-F TCCCCCCGGGAGGAGGATTACAAAATGAGTAAAGGAGAAGAACTTTT
 NotI-gfpm-R TAAGAATGCGGCCGCTTAGTGGTGGTGGTGGTGGTGTTTGTAGAGCTCATCGATGC
 ldhD-citreum-F-XbaI CTAGTCTAGAAGGAGGATTACAAAATGAAGATTTTTGCTTATGGT
 ldhD-citreum-R-NotI TTCCCTTGCGGCCGCTTAATACTTTACAGCAATACTT
 ilvB-EC-F-XbaI CTAGTCTAGAAGGAGGATTACAAAATGGCAAGTTCGGGCA
 ilvN-EC-R-NotI TTCCCTTGCGGCCGCTTACTGAAAAAACACCGCGAT
 aldB-LL-F-XbaI CTAGTCTAGAAGGAGGATTACAAAATGACAGAAATCACACAACTT
 aldB-LL-R-NotI TTCCCTTGCGGCCGCTCATTCAGCTACATCGATATC
 bdh1-SC-F-XmaI TCCCCCCGGGAGGAGGATTACAAAATGAGAGCTTTGGCATATTTC
 bdh1-SC-R-NotI TTCCCTTGCGGCCGCTTACTTCATTTCACCGTGATT
 SphI-pUC-F ACATGCATGCCCGACTGGAAAGCG
 SphI-pUC-R ACATGCATGCCGGTGTGAAATACCG
 PstI-pUC-F AAAACTGCAGCCGACTGGAAAGCG
 BamHI-pUC-R CGGGATCCCGGTGTGAAATACCG
 PnarS-R TCTCTAACACAGTATTGGGATTTGATAACGATCAAG
 PnarI-R AATCTAGTAACCCGATGGGATTTGATAACGATCAAG
 PnarW-R GGAGATGTTACAATATGGGATTTGATAACGATCAAG
 -10Pnar-F GTATAATGCCCTTAAATCTAGA
 pUCN-ori-fr AGGAAGCGGAAGAGCG
 pUCN-ori-r GAAGATCCTTTGATCTTTTCTA
 pET-ori-R TTGAGATCCTTTTTTTCTGC
 pET-rop-F GGTGCGCATGATCGTG
 pSTVM2-pUC-sub-USER-3-F AGACAGUCATAAGTGCGG
 pSTVM2-pUC-sub-USER-1-R ATGCAACUCGTAGGACAG
 pUC-sub-USER-1-F AGTTGCAUCCCGACTGGAAAGCG
 pUC-sub-USER-2-F ATCCATGUCCCGACTGGAAAGCG
 pUC-sub-USER-5-F ATATGCGAUCCCGACTGGAAAGCG
 pUC-sub-USER-2-R ACATGGAUATGCGGTGTGAAATACC
 pUC-sub-USER-5-R ATCGCATAUATGCGGTGTGAAATACCG
 pUC-sub-USER-3-R ACTGTCUATGCGGTGTGAAATACCG
For qRT-PCR
 q-cysG-F TTGTCGGCGGTGGTGATGTC
 q-cysG-R ATGCGGTGAACTGTGGAATAAACG
 q-gfpm-F AGAGGGTGAAGGTGATGCCA
 q-gfpm-R AGATGATCCGGATAACGCGC

Italic and underline letters represent a restriction enzyme site

Screening of the randomized nar promoter library

Escherichia coli cells harboring pSTVM2-SNPL-gfpm were cultivated in 40 mL LB medium supplemented with 50 μg/mL Cm in a 100-mL flask at 30 °C with shaking at 100 rpm for 12 h. Cells were harvested by centrifugation at 7000 rpm for 10 min at 4 °C and washed twice with phosphate buffered saline (PBS, 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 2 mM KH2PO4, pH 7.4). After washed cells were resuspended with PBS buffer, cells were subjected to a fluorescent activated cell sorter (FACS; MoFlo XDP, Beckman Coulter, FL). FACS-sorted cells were directly poured into fresh LB agar plates containing Cm (50 μg/mL) and incubated at 30 °C for 12 h. Cells scraped from the plates were then cultivated in 40 mL LB medium containing Cm (50 μg/mL) in a 100-mL flask and then subjected to the next round of FACS sorting following the same procedure mentioned above. After the third round of FACS sorting, colonies on LB agar plates were randomly selected to cultivate in 200 µL of LB+Cm medium in a 96-deep-well plate at 30 °C with shaking at 100 rpm overnight.

Construction of plasmids

The nucleotide sequences of the primers used in construction of plasmids are listed in Table 2. Plasmid pUCN [13] was modified by adding the rop gene, which resulted in a low-copy number plasmid pUCNr with a wild-type nar promoter. Next, the wild-type nar promoter in pUCNr was replaced by one of the three representative synthetic nar promoters [S3-2-64 (strong), W2U-30 (moderate), W2L-29 (weak)] and amplified by PCR with each synthetic promoter-specific reverse primer and phosphorylated -10Pnar-F primer. The constructed plasmids were named pUCNrS (for S3-2-64), pUCNrI (for W2U-30), and pUCNrW (for W2L-29, weak promoter). The reporter gfpm gene was amplified by PCR from pQE-gfpm [22] with primers (XmaI-gfpm-F and NotI-gfpm-R) and cloned downstream of the lac promoter of pUCM, generating pUCM-gfpm. To obtain pSTVM-gfpm, the PCR-amplified gfpm gene containing the lac promoter was inserted between the BamHI and EcoRI sites of the pSTVM2 plasmid [12]. The ldhD-encoding d-lactate dehydrogenase of Leuconostoc citreum, ilvBN-encoding acetohydroxy acid synthase of E. coli, aldB-encoding acetolactate decarboxylase of Lactococcus lactis, and bdh1-encoding butanediol dehydrogenase from Saccharomyces cerevisiae were amplified by PCR from the genomic DNAs of each strain, and then cloned downstream of the synthetic nar promoters of pUCNrS, pUCNrI, and pUCNrW (Table 2). For complementation experiments, the ilvBN gene was amplified by PCR with the synthetic nar promoter and a terminator, and then inserted between the PstI and BamHI sites of the pSTVM2 plasmid. To assemble two genes (ilvBN and aldB) encoding acetoin pathway enzymes and three genes (ilvBN, aldB, and bdh1) encoding 2,3-BDO pathway enzymes in pSTVM2, each gene was amplified by PCR with the synthetic nar promoter and a terminator, and then subcloned into pSTVM2 using the USER™ cloning method [25, 26].

Flask and bioreactor fermentations

The recombinant E. coli strains harboring a plasmid or plasmids for production of d-lactate, acetoin, and 2,3-BDO were inoculated in 4 mL LB medium supplemented with 50 μg/mL Cm or/and 100 μg/mL ampicillin (Ap) at 37 °C overnight with shaking at 250 rpm. For flask cultivation, 100-mL flasks were filled with 40 mL LB medium containing 20 g/L glucose and appropriate antibiotics, and then were inoculated with 2% (v/v) seed culture. For d-lactate production, pH of the culture media was controlled by adding 10 g/L CaCO3. A nar promoter was induced by reducing shaking speed from 250 to 100 rpm when recombinant E. coli cells grew to an OD600 of 1.0 at 30 °C at 250 rpm. For bioreactor fermentation, fed-batch culturing was carried out with an initial culture volume of 1.0 L of modified R [27] medium containing 20 g/L glucose, 5 g/L yeast extract, and the required antibiotics in a 3.0-L jar bioreactor BIOSTAT B (Sartorius, Germany) [28]. The temperature was maintained at 30 °C and pH was automatically controlled at 7.0 by adding 5 N NH4OH. The DO level was controlled by supplying air or a mixture of air and pure oxygen gas. In order to induce nar promoters, cells were grown at DO level > 80% (aerobic phase) until an OD600 of 10.0 and then immediately DO level was decreased to < 1–2% (microaerobic). The feeding solution consisting of 800 g/L glucose, 50 g/L yeast extract, 15 g/L tryptone, 15 g/L MgSO4·7H2O, and 5 g/L KH2PO4 [29] was periodically added when the residual glucose concentration was below 5–10 g/L. Cell growth was monitored at a wavelength of 600 nm with a SPECTRAmax PLUS384 (Molecular Devices, USA).

Transcriptional analysis

Cells were grown in LB medium containing 2% (w/v) glucose until mid-exponential growth phase, and total RNA was extracted using Hybrid-R RNA purification kit (GeneAll biotechnology, Korea) according to the manufacturer’s instructions. Quantitative reverse transcription PCR (qRT-PCR) was performed using a Rotor-Gene Q (Qiagen, Germany) and SensiFAST™ SYBR No-ROX One-Step Kit (Bioline, USA). Solutions of 5.0 μL of 2× SensiFAST™ SYBR No-ROX One-Step mix, 0.1 μL of reverse transcriptase, 0.2 μL of RNase inhibitor, 0.4 mM forward and reverse primers (gfpm-qPCR-F and gfpm-qPCR-R), 2.0 μL of isolated total RNA (10 ng/μL), and 1.9 μL of diethylpyrocarbonate (DEPC)-treated water were mixed for each qRT-PCR reaction and qRT-PCR was performed as follow: 45 °C for 10 min, 95 °C for 2 min, and then 40 cycles of 95 °C for 5 s, 60 °C for 10 s, and 72 °C for 5 s. The value of ΔΔCt was averaged from triplicate measurements. The cysG gene encoding siroheme synthase was used as a reference gene and the genes expressed by the wild-type nar promoter were used as calibrators.

Western blotting analysis

GFPm expression under the control of nar promoters was analyzed by western blotting. The harvest cells were washed and resuspended in 20 mM Tris–HCl (pH 8.0), and then disrupted by sonication. After centrifugation, supernatants were collected, quantified using the Bradford method, and then analyzed by 15% (w/v) SDS-PAGE. For immunodetection of His-tagged GFPm, a monoclonal anti-polyhistidine antibody (Sigma-Aldrich, USA) and horseradish peroxidase-conjugated anti-mouse IgG (Pierce, USA) were used according to the manufacturer’s instructions. GAPDH was used as a reference gene for quantification of proteins.

Fluorescence analysis

After cells were grown under aerobic conditions, GFPm protein expression under the control of nar promoters was induced by lowering DO levels through changing culture rpm of 250–100. Harvested cells were washed and resuspended in 1 mL phosphate buffered saline (PBS, 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 2 mM KH2PO4, pH 7.4) and the fluorescence intensity of the reporter GFPm protein was measured using a SPECTRAmax Gemini plate reader (Molecular Devices, USA) with excitation at 470 nm and emission at 510 nm. Cytometric analysis was performed using a BD FACS Calibur flow cytometer (BD Biosciences, USA). GFPm was excited using a 15-mW argon ion laser (488 nm) and fluorescence emission was detected using the FL1 channel (530/30 bandpass filter).

Metabolite analysis

The concentrations of glucose, d-lactate, 2,3-BDO, and other metabolites were determined using an Agilent Technologies 1200 high-performance liquid chromatography equipped with a refractive index detector (Agilent, USA) and an Aminex HPX-87H column (Bio-Rad, USA) at a flow rate of 0.7 mL/min and column temperature of 50 °C using 4 mM H2SO4 as the mobile phase.

Authors’ contributions

HJH participated in the experimental design and work, data analysis, and writing of the manuscript. SYL assisted in the experimental design. PCL assisted in the experimental design, the experimental work, data analysis, and writing of the manuscript. All authors read and approved the final manuscript.

Acknowledgements

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

Not applicable.

Consent for publication

Not applicable.

Ethics approval and consent to participate

Not applicable.

Funding

This work was supported by a National Research Foundation of Korea Grant funded by the South Korean Government (2012M1A2A2671691, 2009-0093826).

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Abbreviations

GFP

green fluorescent protein

2,3-BDO

2,3-butanediol

FACS

fluorescent activated cell sorter

RFU

relative fluorescence unit

Contributor Information

Hee Jin Hwang, Email: jinilucifer@ajou.ac.kr.

Sang Yup Lee, Email: leesy@kaist.ac.kr.

Pyung Cheon Lee, Phone: 82-31-219-2461, Email: pclee@ajou.ac.kr.

References

  • 1.Boyle PM, Silver PA. Parts plus pipes: synthetic biology approaches to metabolic engineering. Metab Eng. 2012;14(3):223–232. doi: 10.1016/j.ymben.2011.10.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Connor MR, Atsumi S. Synthetic biology guides biofuel production. J Biomed Biotechnol. 2010;2010. 10.1155/2010/541698. [DOI] [PMC free article] [PubMed]
  • 3.Guiziou S, Sauveplane V, Chang HJ, Clerte C, Declerck N, Jules M, Bonnet J. A part toolbox to tune genetic expression in Bacillus subtilis. Nucleic Acids Res. 2016;44(15):7495–7508. doi: 10.1093/nar/gkw624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Shiue E, Prather KLJ. Synthetic biology devices as tools for metabolic engineering. Biochem Eng J. 2012;65:82–89. doi: 10.1016/j.bej.2012.04.006. [DOI] [Google Scholar]
  • 5.Alper H, Fischer C, Nevoigt E, Stephanopoulos G. Tuning genetic control through promoter engineering. Proc Natl Acad Sci USA. 2006;103:12678–12683. doi: 10.1073/pnas.0602672103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Nevoigt E, Kohnke J, Fischer CR, Alper H, Stahl U, Stephanopoulos G. Engineering of promoter replacement cassettes for fine-tuning of gene expression in Saccharomyces cerevisiae. Appl Environ Microbiol. 2006;72(8):5266–5273. doi: 10.1128/AEM.00530-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Blazeck J, Alper HS. Promoter engineering: recent advances in controlling transcription at the most fundamental level. Biotechnol J. 2013;8(1):46–58. doi: 10.1002/biot.201200120. [DOI] [PubMed] [Google Scholar]
  • 8.Hammer K, Mijakovic I, Jensen PR. Synthetic promoter libraries—tuning of gene expression. Trends Biotechnol. 2006;24(2):53–55. doi: 10.1016/j.tibtech.2005.12.003. [DOI] [PubMed] [Google Scholar]
  • 9.Watanabe D, Kaneko A, Sugimoto Y, Ohnuki S, Takagi H, Ohya Y. Promoter engineering of the Saccharomyces cerevisiae RIM15 gene for improvement of alcoholic fermentation rates under stress conditions. J Biosci Bioeng. 2017;123(2):183–189. doi: 10.1016/j.jbiosc.2016.08.004. [DOI] [PubMed] [Google Scholar]
  • 10.Gilman J, Love J. Synthetic promoter design for new microbial chassis. Biochem Soc Trans. 2016;44(3):731–737. doi: 10.1042/BST20160042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Mahr R, von Boeselager RF, Wiechert J, Frunzke J. Screening of an Escherichia coli promoter library for a phenylalanine biosensor. Appl Microbiol Biotechnol. 2016;100(15):6739–6753. doi: 10.1007/s00253-016-7575-8. [DOI] [PubMed] [Google Scholar]
  • 12.Schofield DM, Templar A, Newton J, Nesbeth DN. Promoter engineering to optimize recombinant periplasmic Fab′ fragment production in Escherichia coli. Biotechnol Prog. 2016;32(4):840–847. doi: 10.1002/btpr.2273. [DOI] [PubMed] [Google Scholar]
  • 13.Hwang HJ, Kim JW, Ju SY, Park JH, Lee PC. Application of an oxygen-inducible nar promoter system in metabolic engineering for production of biochemicals in Escherichia coli. Biotechnol Bioeng. 2017;114(2):468–473. doi: 10.1002/bit.26082. [DOI] [PubMed] [Google Scholar]
  • 14.Pröschel M, Detsch R, Boccaccini AR, Sonnewald U. Engineering of metabolic pathways by artificial enzyme channels. Front Bioeng Biotechnol. 2015;3:168. doi: 10.3389/fbioe.2015.00168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Castellana M, Wilson MZ, Xu Y, Joshi P, Cristea IM, Rabinowitz JD, Gitai Z, Wingreen NS. Enzyme clustering accelerates processing of intermediates through metabolic channeling. Nat Biotechnol. 2014;32(10):1011–1018. doi: 10.1038/nbt.3018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Chubukov V, Mukhopadhyay A, Petzold CJ, Keasling JD, Martín HG. Synthetic and systems biology for microbial production of commodity chemicals. NPJ Syst Biol Appl. 2016;2:16009. doi: 10.1038/npjsba.2016.9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Zhou L, Zuo ZR, Chen XZ, Niu DD, Tian KM, Prior BA, Shen W, Shi GY, Singh S, Wang ZX. Evaluation of genetic manipulation strategies on d-lactate production by Escherichia coli. Curr Microbiol. 2011;62(3):981–989. doi: 10.1007/s00284-010-9817-9. [DOI] [PubMed] [Google Scholar]
  • 18.Liu M, Tolstorukov M, Zhurkin V, Garges S, Adhya S. A mutant spacer sequence between − 35 and − 10 elements makes the Plac promoter hyperactive and cAMP receptor protein-independent. Proc Natl Acad Sci USA. 2004;101(18):6911–6916. doi: 10.1073/pnas.0401929101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Nielsen DR, Yoon SH, Yuan CJ, Prather KL. Metabolic engineering of acetoin and meso-2,3-butanediol biosynthesis in E. coli. Biotechnol J. 2010;5(3):274–284. doi: 10.1002/biot.200900279. [DOI] [PubMed] [Google Scholar]
  • 20.Hook-Barnard IG, Hinton DM. The promoter spacer influences transcription initiation via σ70 region 1.1 of Escherichia coli RNA polymerase. Proc Natl Acad Sci USA. 2009;106(3):737–742. doi: 10.1073/pnas.0808133106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Hwang HJ, Park JH, Kim JH, Kong MK, Kim JW, Park JW, Cho KM, Lee PC. Engineering of a butyraldehyde dehydrogenase of Clostridium saccharoperbutylacetonicum to fit an engineered 1,4-butanediol pathway in Escherichia coli. Biotechnol Bioeng. 2014;111(7):1374–1384. doi: 10.1002/bit.25196. [DOI] [PubMed] [Google Scholar]
  • 22.Yoo TH, Link AJ, Tirrell DA. Evolution of a fluorinated green fluorescent protein. Proc Natl Acad Sci USA. 2007;104(35):13887–13890. doi: 10.1073/pnas.0701904104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kim SH, Park YH, Schmidt-Dannert C, Lee PC. Redesign, reconstruction, and directed extension of the Brevibacterium linens C40 carotenoid pathway in Escherichia coli. Appl Environ Microbiol. 2010;76(15):5199–5206. doi: 10.1128/AEM.00263-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Brown JL, Ross T, McMeekin TA, Nichols PD. Acid habituation of Escherichia coli and the potential role of cyclopropane fatty acids in low pH tolerance. Int J Food Microbiol. 1997;37(2–3):163–173. doi: 10.1016/S0168-1605(97)00068-8. [DOI] [PubMed] [Google Scholar]
  • 25.Cavaleiro AM, Kim SH, Seppala S, Nielsen MT, Norholm MH. Accurate DNA assembly and genome engineering with optimized uracil excision cloning. ACS Synth Biol. 2015;4(9):1042–1046. doi: 10.1021/acssynbio.5b00113. [DOI] [PubMed] [Google Scholar]
  • 26.Nørholm MH. A mutant Pfu DNA polymerase designed for advanced uracil-excision DNA engineering. BMC Biotechnol. 2010;10(1):1–7. doi: 10.1186/1472-6750-10-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Gonzalez MD, Lichtensteiger CA, Caughlan R, Vimr ER. Conserved filamentous prophage in Escherichia coli O18:K1:H7 and Yersinia pestis biovar orientalis. J Bacteriol. 2002;184:6050–6055. doi: 10.1128/JB.184.21.6050-6055.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Jung YK, Kim TY, Park SJ, Lee SY. Metabolic engineering of Escherichia coli for the production of polylactic acid and its copolymers. Biotechnol Bioeng. 2010;105(1):161–171. doi: 10.1002/bit.22548. [DOI] [PubMed] [Google Scholar]
  • 29.Han SJ, Chang HN, Lee J. Characterization of an oxygen-dependent inducible promoter, the nar promoter of Escherichia coli, to utilize in metabolic engineering. Biotechnol Bioeng. 2001;72(5):573–576. doi: 10.1002/1097-0290(20010305)72:5<573::AID-BIT1022>3.0.CO;2-I. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Not applicable.


Articles from Biotechnology for Biofuels are provided here courtesy of BMC

RESOURCES