Abstract
Background
Maize Iranian mosaic virus (MIMV, genus Nucleorhabdovirus, family Rhabdoviridae) causes an economically important disease in maize and other gramineous crops in Iran. MIMV negative-sense RNA genome sequence of 12,426 nucleotides has recently been completed. Maize Genetics and Genomics database shows that 39,498 coding genes and 4,976 non-coding genes of maize have been determined, but still some transcripts could not be annotated. The molecular host cell responses of maize to MIMV infection including differential gene expression have so far not been elucidated.
Methodology/Principal findings
Complementary DNA libraries were prepared from total RNA of MIMV-infected and mock-inoculated maize leaves and sequenced using Illumina HiSeq 2500. Cleaned raw transcript reads from MIMV-infected maize were mapped to reads from uninfected maize and to a maize reference genome. Differentially expressed transcripts were characterized by gene ontology and biochemical pathway analyses. Transcriptome data for selected genes were validated by real-time quantitative PCR.
Conclusion/Significance
Approximately 42 million clean reads for each treatment were obtained. In MIMV-infected maize compared to uninfected plants, 1689 transcripts were up-regulated and 213 transcripts were down-regulated. In response to MIMV infection, several pathways were activated in maize including immune receptor signaling, metabolic pathways, RNA silencing, hormone-mediated pathways, protein degradation, protein kinase and ATP binding activity, and fatty acid metabolism. Also, several transcripts including those encoding hydrophobic protein RCI2B, adenosylmethionine decarboxylase NAC transcription factor and nucleic acid binding, leucine-rich repeat, heat shock protein, 26S proteasome, oxidoreductases and endonuclease activity protein were up-regulated. These data will contribute to the identification of genes and pathways involved in plant-virus interactions that may serve as future targets for improved disease control.
Introduction
Rhabdoviruses infect plants, invertebrates and vertebrates and are taxonomically classified in the family Rhabdoviridae, order Mononegavirales [1]. Cyto- and nucleorhabdoviruses infect a wide range of plant species including many agriculturally important crops [2, 3]. Maize Iranian mosaic virus (MIMV) is an economically important virus that infects maize (Zea mays L.), wheat (Triticum aestivum L.), barley (Hordeum vulgare L.), rice (Oryza sativa L.) and several other poaceous species in Iran [4]. MIMV is transmitted by the small brown planthopper (Laodelphax striatellus) in a persistent-propagative manner [5, 6]. MIMV is classified in the genus Nucleorhabdovirus, members of which replicate in plant cell nuclei and accumulate in perinuclear spaces [3]. MIMV is closely related to maize mosaic virus (MMV) based on nucleotide sequence identity [5, 7]. In recent years, an increasing number of studies have focused on molecular host–virus interactions including the plant and vector transcriptome responses [8–10].
Genome-wide gene expression studies may elucidate the effects of viruses on their host and may identify changes in the expression of host genes in response to virus infection [11]. Next-generation high-throughput sequencing and study of transcriptomes can clarify virus infection responses in plants and increase understanding about host responses [12–14]. For example, changes in the maize transcriptome due to biotic and abiotic stresses have been reported including responses to fungi Bipolaris zeicola and Fusarium graminearum, insects Rhopalosiphum maidis, Graminella nigrifrons and Ostrinia furnacalis, and abiotic factors salinity and jasmonic acid [15–20].
Plant responses to infection have been studied for a range of RNA and DNA viruses including tobacco mosaic virus in tobacco, African cassava mosaic virus in cassava, tomato spotted wilt virus, cucumber mosaic virus and potato virus X in chrysanthemum and capsicum chlorosis virus in capsicum. These studies have provided novel information regarding the up- and down- regulation of host genes during plant-pathogen interactions and determined the pathways involved in plant responses to virus infection [8, 21–23]. The present study contributes to existing sequence resources for maize including National Center for Biotechnology Information (NCBI) and Plants Ensemble (http://plants.ensembl.org/Zea_mays/Info/Index). Besides its economic importance as a food and biofuel crop [24], Zea mays is important for studying the mechanisms of pathogen-host interactions as it is a facile model including a large collection of mutant germplasm, large heterochromatic chromosomes, presence of annotated genes, extensive nucleotide diversity, good gene network and pathways database and genic co-linearity within related grasses. These characteristics have positioned this species as a centerpiece for genetic, cytogenetic, and genomic research [24]. Current maize sequence resources show that 136,472 transcripts of maize have been identified that potentially encode 39,498 proteins and 4,976 non- coding genes, some of which of unknown function (www.plants.ensembl.org). Although the functions of many genes and pathways during virus infection in maize remains unknown, our study provides valuable new insights into the potential roles of differentially expressed genes in response to MIMV infection. This information will help us to better understand the distinctive virus defense mechanisms in plants, identify essential host gene products that may be recruited to assist virus replication and movement, and identify candidate genes that might be targeted for control of MIMV infection.
Materials and methods
Plant growth, virus inoculation and RNA extraction
Seeds of MIMV-susceptible maize cultivar 704 [25] were sources from the Seed and Plant Improvement Research Division, Fars Research Center for Agriculture and Natural Resources, Shiraz, Iran, germinated in soil, and plants were grown in a greenhouse on a cycle of 16 h light at 30°C and 8 h dark at 25°C. Three days after seed germination, at the two-leaf stage, ten plants were exposed for 3 days to 20 viruliferous planthopper nymphs infected with MIMV isolate ‘Fars’ and had been maintained on MIMV-infected barley plants in an insect-proof cage. Mock-inoculated plants were exposed to 20 planthoppers from a virus-free colony. Total RNA was extracted from 500 mg of leaf tissue from each of the three uninfected and three infected plants 15 days after inoculation when symptoms had appeared, using TRIzol Reagent (Thermo Fisher Scientific) following the manufacturer’s protocol. RNA was dissolved in diethyl pyrocarbonate (DEPC)-treated water, and its quality was assessed by measuring absorption ratio 260/280 nm using a Nanodrop-1000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA) and by 1% agarose gel electrophoresis in Tris/borate/EDTA buffer (TBE).
Virus detection
MIMV was detected in maize plants by DAS-ELISA [26] using antiserum developed in Plant Virology Research Center, Iran [7] and by RT-PCR using primers MIMV-F (5′-TGCAGGGAAATCTCTGGAGG-3′) and MIMV-R (5′-CCTCATACATTGGCTGGGGA-3′). Complementary DNA was synthesized using M-MLV reverse transcriptase (Thermo Fisher Scientific) and primer MIMV-R. PCR was carried out in 25 μL reactions containing 2 μL of cDNA, 1 μL of each 10μM primer, 0.5 μL of 10μM dNTPs, and 2.5 μL of 10 × PCR buffer; 0.75 μL of 50 μM MgCl2, 0.25 μL (1 U) of Taq DNA polymerase (Cinnagen, Iran) and 17 μL H2O. PCR conditions were 94 °C for 5 min, 35 cycles of 94°C for 1 min, 56 °C for 30 s, and 72 for 1 min, and a final extension at 72°C for 7 min. PCR products were electrophoresed in a 1.5% agarose gel in TBE buffer and visualized under UV light after staining with ethidium bromide.
Library construction, sequencing and RNA-Seq data analysis
Following quality control on an Agilent Technologies 2100 Bioanalyzer using a DNA 1000 chip and Roche’s Rapid library standard Quantification solution and calculator, passed samples were used for library construction (TruSeq RNA Sample Prep Kit v2) and sequenced with 100 bp paired end reads using Illumina HiSeq 2500 (Macrogen, Seoul, South Korea). Contaminating genomic DNA was removed during mRNA purification. Whole transcriptome RNA was enriched by depleting ribosomal RNA and six cDNA libraries were prepared using poly(A) enrichment from the 3 replicates of 2 treatments consisting of MIMV-infected and mock-inoculated maize. Raw sequencing reads were trimmed for quality and adaptors were removed. Clean reads were mapped to the maize reference genome (www.plants.ensembl.org). Analyses of differentially expressed (DE) transcripts were based on the genome-mapped data. Expression profiling and differential gene expression analyses were done using CLC Genomic Workbench version 9 (CLC Bio, Qiagen). DE transcripts were identified using the criteria of fold change ≥2 and false discovery rate (FDR) <0.05. To ensure true representation of fragment gene expression levels, read numbers and gene lengths were normalized using fragments per kilobase of transcript per million fragments mapped (FPKM). Blast2Go software was used for gene ontology analysis. Gene regulatory network and pathway analysis were done using STRINK database (www.string-db.org).
Validation of DE transcripts by real-time quantitative PCR
RNA-Seq gene expression profiles for five selected genes were validated by RT-qPCR. Ubiquitin-conjugating enzyme and cullin were selected as internal reference genes from the non-DE genes in the RNA-Seq dataset. PCR primers were designed using Primer 3 software in Geneious version R10 and synthesized by GeneWorks (Adelaide, South Australia) (Table 1). First-strand cDNA synthesis was done using oligo dT primers and Superscript III First-strand cDNA synthesis kit (Life Technologies) from DNase-treated (Ambion, TURBO DNA-free) independent total RNA extracts isolated from the same tissues as the three biological replicates used for RNA-Seq. SensiFAST SYBR No-ROX Kit (Bioline) was used in a Rotor-Gene Q real-time PCR cycler (Qiagen) following manufacturer’s protocol with 20 μL reactions containing 20 ng cDNA and 10 μM of each primer. QPCR cycling conditions were: 95°C for 2 min, 40 cycles of 94°C for 5 s, 55°C for 10s, and 72°C for 20 s. Three biological replicates and two technical replicates were used for each sample. Threshold cycle (Ct) number was calculated from log scale amplification curves by Rotor-Gene Q Series software. Relative expression levels of target genes were calculated using 2− (Ct of target−Ct of reference) [27]. For validation, qPCR result was compared with RNA-Seq data and Pearson correlation coefficient R and associated p values were calculated (www.socscistatistics.com).
Table 1. List of qPCR primers used in this study.
Primer | Sequence 5' to 3' | RefSeq ID | Predicted maize gene product |
---|---|---|---|
HSPFF | CGCCGTTCCTCAGCAAGACG | NP_001149902 | Heat shock protein factor 7 |
HSPFR | CGTAGGTGTTGAGCTGGCGC | ||
PPF | AACATCGAGGCCAGGCTCCA | NP_001150720 | Pathogenesis protein* |
PPR | GGCCTCTCCGAACGTTCACC | ||
TIFF | CAGAGGGAGCAGCAGGAGGA | NP_001152593 | Transcription initiation factor TFIID subunit 11 |
TIFR | AGCTTGTCAGGGTCGCCAGT | ||
TBIF | GCCTTCGTCGTCAAGGTGCC | NP-001149807 | Transmembrane BAX inhibitor motif-containing protein |
TBIR | GGCACAGCACGAGGAAAGGC | ||
PTF | AGGAGATGAAGCAGCCCAGG | NP_001148639 | Protein transporter* |
PTR | TCCACCTGACGTTGCTCTCG | ||
UBCPF | CAGGTGGGGTATTCTTGGTG | NP_001148222 | Ubiquitin-conjugating enzyme E2-17 |
UBCPR | ATGTTCGGGTGGAAAACCTT | ||
CULF | GAAGAGCCGCAAAGTTATGG | XP_008662971 | Cullin-1 isoform X1 |
CULR | ATGGTAGAAGTGGACGCACC |
* Function predicted using BLAST2GO software
Results and discussion
Virus infection of maize
Maize plants grown under greenhouse conditions displayed typical MIMV symptoms 15 days after planthopper-mediated infection. MIMV-infected leaves had yellow stripe, chlorosis and green mosaic symptoms (Fig 1) and plants were stunted. The presence of MIMV in infected plants and its absence in mock-inoculated plants was confirmed by DAS-ELISA and RT-PCR.
Fig 1. Symptoms on leaves of MIMV-inoculated maize (A) compared with leaves of mock-inoculated plants (B), 15 days after exposure viruliferous (A) or non-viruliferous plant hoppers (B).
Transcriptome sequencing, data processing, and differential gene expression analysis
In this study, we have used comparative transcriptome analysis of uninfected and virus-infected maize leaves to investigate maize-MIMV molecular interactions. To obtain a maize gene expression profile, and identify genes and processes responsive to MIMV infection, six cDNA libraries were constructed for deep sequencing using the Illumina High-Seq 2500 platform. After removing adaptors and reads of low-quality nucleotides, we obtained about 40 million clean reads for each library (Table 2) that were mapped to the maize reference genome. The Illumina sequence read data are accessible through the NCBI BioProject database with accessions numbers SAMN08237478 –SAMN08237483. Combination of the sequence data from the six libraries revealed 39,480 maize transcripts larger than 100 bp. Furthermore, comparative transcriptome analysis showed that 1902 transcripts were DE in MIMV-infected compared to uninfected leaves, 1689 transcripts (88.8%) were up-regulated (fold change > 2, p-value <0.05) (S2 Table) and 213 transcripts (11.2%) were down-regulated. This is illustrated in the volcano plot (Fig 2) that shows the distribution of DE reads.
Table 2. Raw data statistics of MIMV-infected maize and uninfected maize libraries.
Library | Total Bases1 | Read Count2 | GC (%)3 | AT (%)4 | Q20 (%)5 | Q30 (%)6 |
---|---|---|---|---|---|---|
MIMV-infected 1 | 4,147,751,244 | 41,066,844 | 52.22 | 47.78 | 97.06 | 94.99 |
MIMV-infected 2 | 4,502,940,772 | 44,583,572 | 54.46 | 45.54 | 97.90 | 96.27 |
MIMV-infected 3 | 4,501,519,500 | 44,569,500 | 52.01 | 47.99 | 98.0 | 96.45 |
Healthy 1 | 3,874,450,294 | 38,360,894 | 54.84 | 45.16 | 97.52 | 95.68 |
Healthy 2 | 4,103,898,054 | 40,632,654 | 46.210 | 53.79 | 97.243 | 95.278 |
Healthy 3 | 4,500,617,328 | 43,989,735 | 52.02 | 47.98 | 97.80 | 96.50 |
1 Total number of bases sequenced.
2 Total number of reads in Illumina paired-end sequencing.
3 GC content.
4 AT content.
5 Ratio of reads with phred quality score > 20.
6 Ratio of reads with phred quality score > 30.
Fig 2. Volcano plot (t-test) showing MIMV-maize RNA-Seq data.
X-axis shows fold-change of gene expression and y-axis shows statistical significance (–log10 of the p-value). Down-regulated transcripts are plotted on the left, up-regulated transcripts on the right.
RT-qPCR validation of RNA-Seq data
To test the reliability of RNA-Seq DE data, we compared the expression levels of five selected transcripts, heat shock protein factor 7, transcription initiation factor TFIID subunit 11, transmembrane BAX inhibitor motif-containing protein (TMBIM), and transcripts tentatively annotated using Blast2Go or Ensemble database as a ‘pathogenesis protein’ and a ‘protein transporter’ in MIMV-infected and non-infected maize using qPCR (Fig 3). RNA-Seq and qPCR data for all biological replicates correlated well (R = 0.85, p<0.01) suggesting that the DE data are reliable and reflect the actual maize transcriptome differences in response to MIMV infection. Heat shock protein transcript was up-regulated in this study (Fig 3) similar to the findings for other plant RNA and DNA viruses [28–30]. TFIID plays a key role in the regulation of gene expression by RNA polymerase II through transcriptional activation and promoter recognition [31] that may be involved in MIMV gene expression. TMBIM is an anti-apoptotic protein that controls cell death during stress such as virus infection [32] and that was up-regulated in MIMV-infected maize (Fig 3).
Fig 3. Validation of MIMV responsive up-regulated maize genes.
RT-qPCR (Black bars) vs RNA-Seq (Grey bars) fold-change expression of selected genes in three biological replicates (1–3). PT: Protein transporter, HSPF: Heat shock protein factor 7, PP: Pathogenesis protein, TIF: Transcription initiation factor TFIID subunit 11, TBI: Transmembrane BAX inhibitor motif containing protein.
Strongly down- or up-regulated transcripts in response to MIMV infection
Thirteen transcripts were most strongly up-regulated (fold change >80) in MIMV-infected maize leaves (Table 3). ‘Integral component of membrane’ transcripts were significantly affected, both down (28 transcripts) and up (500 transcripts) regulated following MIMV infection (Table 3, Figs 4 and 5). Enveloped viruses like MIMV have been shown to interact with cellular membranes [3] and may affect dynamics of cell and membrane proteins. Transcription factors play roles in gene regulation and are responsive to biotic and abiotic stress [21]. Immune system and plant response to viruses is controlled by transcription factors [23]. We identified fourteen transcription factors (TF) that were significantly up-regulated in this study (Table 3, S1 Table). For example, NAC domain TF transcripts were increased >300-fold in MIMV-infected maize (Table 3). This particular TF was previously reported to interact with the nucleocapsid protein of the nucleorhabdovirus sonchus yellow net virus in N. benthamiana [33] and was shown to be involved in the regulation of systemic host defenses by interaction with tobacco mosaic virus replicase [34]; it may have a similar role in modulating maize defense responses to MIMV infection. Hydrophobic protein RCI2B, which is induced in plants in response to biotic and abiotic stress [35, 36], was strongly up-regulated in infected maize. Adenosylmethionine decarboxylase, which plays an essential regulatory role in the polyamine biosynthetic pathway [37] was also up-regulated in MIMV-infected maize (Table 3). Constitutive expression of this enzyme was shown to increase tolerance of tomato to stress [36]. Oxidoreductases catalyze the transfer of electrons between molecules and are important in plant defense signaling [38]. Several transcripts that relate to oxido-reductase and -transferase activity were induced in MIMV-infected maize indicating their importance in maize-MIMV interaction.
Table 3. Top 13 up-regulated transcripts in MIMV-infected compared to uninfected maize.
Transcript No. | GenBank accession | Fold Change | FDR p-value | Predicted gene function |
---|---|---|---|---|
1 | NP_001140915 | 82 | 0.02862761 | Metal ion binding, oxidoreductase activity |
2 | NP_001130429 | 91.2 | 0.03610904 | Oxidoreductase, aldo/keto reductase family protein |
3 | NP_001149266 | 100.6 | 0.024657796 | S-adenosylmethionine decarboxylase |
4 | NP_001105511 | 103.5 | 0.034602873 | Glutathione transferase 35 |
5 | NP_001147075 | 124.1 | 0.02357992 | Nucleotide binding protein |
6 | XP_008657926 | 124.5 | 0.039400598 | Zinc finger protein ZAT8-like |
7 | NP_001141884 | 143 | 0.033178243 | Transcription factor DIVARICATA-like |
8 | NP_001153094 | 153.6 | 0.015501405 | Metal-binding and oxidoreductase |
9 | LOC100280292 | 168 | 0.037108401 | Flavin adenine dinucleotide binding |
10 | NP_001148452 | 234.8 | 0.046469706 | Nucleic acid binding and endonuclease activity |
11 | NP_001147618 | 310.4 | 0.026666236 | NAC domain transcription factor |
12 | EU955582 | 552 | 0.047195478 | Hydrophobic protein RCI2B |
13 | XP_008652274 | 828 | 0.041989032 | Unknown protein, integral component of membrane* |
* Function predicted using BLAST2GO software
Fig 4. Gene ontology categories of up-regulated transcripts in maize leaves in response to MIMV infection determined using Blast2GO.
Fig 5. Gene ontology categories of down-regulated transcripts in maize leaves in response to MIMV infection determined using Blast2GO.
Pattern-triggered immunity (PTI) and effector-triggered immunity (ETI) are a two-part plant immune response to pathogens [39]. ETI results from detection of pathogen effectors by resistance proteins and PTI occurs following recognition of microbe- or pathogen associated molecular patterns. Both PTI and ETI are involved in early signaling events, including changes in protein phosphorylation status [39]. Some protein kinase and ATP binding activity-related transcripts were highly down-regulated in MIMV-infected maize (Table 4) whereas some others were up-regulated as previously shown in tomato cultivars resistant to tomato chlorotic mottle virus [40]. Differential expression of those host genes appears to depend on the type of transcripts and their specific roles in cell signaling. The majority of down-regulated transcripts with fold change less than 15 encoded uncharacterized proteins (Table 4).
Table 4. Top 13 down-regulated transcripts in MIMV-infected compared to uninfected maize.
Transcript No. | GenBank accession | Fold Change | FDR p-value | Predicted gene function |
---|---|---|---|---|
1 | GRMZM2G113883* | -55 | 0.03463707 | Uncharacterized protein |
2 | XP_008659627 | -32 | 0.03957 | Uncharacterized protein |
3 | GRMZM2G314339* | -27 | 0.04646 | Uncharacterized protein |
4 | XP_020402672 | -21.6 | 0.024615 | Uncharacterized protein |
5 | NP_001152364 | -17.7 | 0.02069 | Protein kinase activity and ATP binding** |
6 | GRMZM2G064008* | -17.35 | 0.02772 | Uncharacterized protein |
7 | GRMZM2G064250* | -16.8 | 0.02145 | Integral component of membrane** |
8 | NP_001131699 | -16.2 | 0.045915 | Uncharacterized protein |
9 | XP_020407456 | -15.7 | 0.0483 | Uncharacterized protein |
10 | AC217841.3_FG001* | -15.5 | 0.03820 | Uncharacterized protein |
11 | AQK91281 | -15.2 | 0.03725 | Uncharacterized protein |
12 | XP_008660379 | -15.14 | 0.02004 | Calcium uniporter protein |
13 | AC193658.3_FG001* | -15.1 | 0.02037 | Uncharacterized protein |
* Ensembl Plants ID (without any information in NCBI)
** Gene Ontology feature
Functional annotation
MIMV-responsive maize transcripts were classified by gene ontology (GO) categories using Blast2Go. In the molecular function category, catalytic activity and various binding activities were both up- and down-regulated, but more transcripts in this category were up- than down-regulated (Figs 4 and 5). On the other hand, organic cyclic compound binding, transferase activity enzymes, kinases, hydrolase activity, and nucleotide binding related transcripts were significantly enriched in MIMV-infected maize tissue (Fig 4).
The important role of kinases in plant innate immunity is well known [41] and the response of maize to MIMV infection is no exception. GO classification of up-regulated transcripts in molecular function showed 158 transcripts that relate to nucleotide binding, 167 to hydrolase activity and 330 to heterocyclic compound binding that are well known responses in plant defense [40, 42]. Transcripts that relate to nucleotide binding were also up-regulated in maize infected with maize chlorotic dwarf virus (MCDV) and the nucleorhabdovirus maize fine streak virus (MFSV) [19]. Most of the up-regulated transcripts in MIMV-infected maize fell into the biological categories of cellular and metabolic processes (Fig 4). Transcripts related to stress response, like hormone signaling and synthesis of secondary metabolites were induced in MIMV-infected maize, similar to capsicum response to tospovirus infection [8]. Geminivirus infection in tomato led to up-regulated transcripts involved in cell wall reorganization, transcriptional regulation and secondary metabolite synthesis [43] that were similarly up-regulated in this study. Transcripts involved in metabolic and single-organism process categories were up- or down-regulated in this study, but the number of transcripts that were up-regulated were about 19 times and 8 times higher, respectively than that of down-regulated transcripts in those categories (Figs 4 and 5). Viruses rely on host cell transport systems and have been shown to affect expression of transport-related genes [29]; several responsive transcripts in this study were also involved in transport (Figs 4 and 5). GO analysis of cellular components showed up-regulated transcripts associated with all parts of the cell (Fig 4).
Transcripts for several transcription factors including MYB and NAC were up-regulated in MIMV-infected plants (S1 Table). On the other hand, transcripts for the transcription factors ASIL1-like, ICE1 and transcription repressor OFP13 were down-regulated. Leucine-rich repeat (LRR) receptor-like serine threonine-kinase that belongs to the nucleotide-binding (NB) LRR gene family (S1 Table), and represents the majority of known disease resistance genes in plants [44], was down-regulated in MIMV-infected maize possibly due to the susceptibility of this maize cultivar to MIMV. ‘Constitutive expressor of pathogenesis’ related transcripts were also up-regulated during MIMV infection (S1 Table); this gene is involved in cell wall biogenesis, cell signaling or transcription [45]. Our data show significant down- or up-regulation of transcripts related to defense response, plant-pathogen interaction and response to biotic and abiotic stress, as well as nucleic acid binding during MIMV infection in maize.
MIMV-responsive biochemical pathways
KEGG analysis showed that 58 different pathways were up-regulated in response to MIMV infection in maize. The top five pathways that contained the largest numbers of up-regulated genes in response to MIMV were metabolic pathways (100 transcripts), biosynthesis of secondary metabolites (51 transcripts), proteasome (30 transcripts), protein processing in endoplasmic reticulum (28 transcripts) and endocytosis (21 transcripts) indicating that MIMV replication leads to significant metabolic changes in infected tissues. Fatty acid metabolism (9 transcripts) and fatty acid degradation (9 transcripts) are two pathways induced by MIMV that were shown previously to play significant roles in pathogen defense [46].
Viruses have been shown to disrupt many processes in plant cells, resulting in temporal changes that affect hormone signaling and metabolite responses [47]. Plant hormones play important roles in complex plant response networks and tune plant responses to biotic and abiotic stress [48]. Four hormones primarily regulate plant defense to pathogens: salicylic acid, jasmonic acid, ethylene and abscisic acid [48]. Eighteen transcripts were up-regulated following MIMV infection that GO analysis showed are involved in plant hormone signal transduction, similar to maize infected by Bipolaris zeicola and Fusarium graminearum [16, 17]. Gibberellin 20 oxidase was up-regulated in this study (S1 Table) which may be related to the observed stunted growth of maize infected with MIMV. Plant-pathogen interaction pathways (13 transcripts) that are related to hormone signaling and plant immunity were up-regulated in MIMV-infected maize, similar to maize infected by B. zeicola [16]. Nine transcripts were up-regulated in MIMV-infected maize plants that are related to RNA transport pathways (S1 Table) linked to the well-known nucleo-cytoplasmic trafficking activities in maize plants [49]. In this study, five transcripts were up-regulated in MIMV-infected plant that are involved in RNA degradation with functions in messenger RNA biogenesis, mRNA-decapping and spliceosome activities (S1 Table). We identified 35 photosynthesis-related transcripts that were responsive to MIMV infection (S1 Table) and that may be related to yellow stripe and chlorosis symptoms on the leaves (Fig 1).
Metabolic pathways and biosynthesis of secondary metabolites
Plants produce chemically diverse secondary metabolites and every plant species has its own characteristic set [50]. In our study, most of the maize transcripts related to metabolic processes were up-regulated in response to MIMV infection similar to what has been reported following virus infection in rice, jatropha, capsicum and tobacco [8, 21, 51, 52] and also similar to maize infected by B. zeicola [16]. Several transcripts involved in the biosynthesis of secondary metabolites such as antibiotics were up-regulated in this and other studies upon virus infection (50). Mapping up-regulated transcripts for secondary metabolite enzymes into KEGG pathways revealed genes involved in the biosynthesis of antibiotics (34 transcripts), biosynthesis of tyrosine (6 transcripts), tryptophan biosynthesis (7 transcripts), phenylalanine metabolism (5 transcripts), and terpenoid backbone synthesis pathway (7 transcripts) (Fig 6), which lead to the synthesis of antimicrobial phytoalexins and phytoanticipins, and phenolic compounds that are known to be involved in plant defense against pathogens [53].
Fig 6. KEGG pathways for up-regulated enzymes determined using BLAST2GO.
Black color shows the number of transcripts involved in each process and gray color shows the number of enzymes involved.
Protein processing in the endoplasmic reticulum
Twenty-eight maize transcripts related to protein processing in the endoplasmic reticulum (ER) were up-regulated upon MIMV infection (S1 Table). These included transcripts for ubiquitin-conjugating enzymes, chaperone DNA, heat shock proteins, protein disulfide enzyme, N-Glycan biosynthesis, a transport protein, calnexin, B-cell receptor-associated proteins and Derlin proteins (transmembrane proteins that detect and target misfolded proteins in the ER). This responsiveness may be related to MIMV surface glycoprotein G or matrix protein M interacting with the ER during virus maturation [3]. Previous studies have shown that G protein of the animal rhabdovirus vesicular stomatitis virus is incorporated into ER membranes where chaperones like calnexin facilitate its proper folding and assembly into trimmers and its posttranslational glycosylation [54].
Ubiquitin-mediated proteolysis and proteasome
Ubiquitin-mediated proteasome pathway targets proteins for degradation by the 26S proteasome and has been implicated in a number of plant diseases, especially virus infections [48, 55, 56]. Polerovirus P0 proteins and beet necrotic yellow vein virus p25 and p31 proteins have been shown to induce ubiquitination in host cells [9, 55, 56]. MIMV infection of maize led to up-regulation of transcripts for proteins in the ubiquitin-proteasome pathways such as ubiquitin-conjugating enzymes, ubiquitin-protein ligase, proteasome maturation protein, 20S proteasome and 26S proteasome consistent with a previous study on maize infected with MCDV and MFSV [19]. Our data provide evidence that ubiquitin also has an important role in response to MIMV infection.
KEGG enzyme pathways
A total of 110 KEGG enzyme pathways were up-regulated in response to MIMV infection in maize (S3 Table). Largest number of up-regulated transcripts mapped to purine metabolism (53 transcripts, 16 enzymes), thiamine metabolism (37 transcripts, 1 enzyme), biosynthesis of antibiotics (34 transcripts, 32 enzymes), aminobenzoate degradation (21 transcripts, 4 enzymes) and Th1 (T-helper 1) and Th2 (T-helper 2) cell differentiation (15 transcripts, 1 enzyme). Th1 and Th2 are involved in immune regulation of animal cells against pathogens [57, 58]. This analysis also showed that transcripts involved in synthesis of amino acids were significantly induced in response to MIMV infection. Transcripts involved in proline metabolism were up-regulated in MIMV-infected maize in this study, in Arabidopsis thaliana after infection with tobacco etch virus and in cotton in response to sap sucking insects [59, 60]. Biosynthesis of vitamins was also induced in response to MIMV infection as evidenced by the up-regulation of 37 transcripts that are involved in the biosynthesis of thiamine, a plant defense signaling molecule [61].
MIMV replicates in the nucleus of infected maize cells and establishes a nuclear viroplasm [6]. KEGG pathway analysis of our RNA-Seq data showed that of 141 nucleus-associated transcripts, four were related to plant-pathogen interactions, two to vesicular transport and three to RNA transport (S3 Table). These nuclear transcripts were upregulated in response to MIMV infection and may be considered as transcripts encoding MIMV replication-associated host factors.
Conclusions
In response to MIMV infection, maize plants activated multiple pathways, including immune receptor signaling, metabolic pathways, RNA silencing, hormone-mediated pathways, protein degradation, protein kinase and ATP binding activity, and fatty acid metabolism. Many of these pathways are known to be involved in plant defense. Transcripts that were significantly up-regulated in this study are reportedly involved in plant response to pathogens in other pathosystems, pointing to common responses across plant species and pathogens. Several transcripts lacking annotations were up and down-expressed with high fold change in response to MIMV-infection. These unknown genes will be explored in future studies to better understand the infection mechanism of MIMV in maize.
Supporting information
(DOCX)
RNA-Seq dataset of responsive transcripts in MIMV-infected maize compared to uninfected maize. Column A is the Feature ID or Ensemble ID of transcripts, column B is the fold change >2 of transcripts, column C is the p-value, columns D-F are Fragments Per Kilobase Million (FPKM) of uninfected samples, column G is the mean of FPKM in uninfected samples, columns H-J are FPKM of infected samples and columns K is mean of FPKM in infected samples.
(XLSX)
Transcripts are shown with Ensemble ID. Columns A-BI show the name of KEGG pathways and the transcripts that are involved in those pathways.
(XLSX)
Acknowledgments
The authors wish to thank Drs. Shirani Manel Kumari Widana Gamage and Ahmad Tahmasebi for advice on RNA-Seq data analysis.
Data Availability
All relevant data are within the paper and its Supporting Information files.
Funding Statement
The research was jointly supported by the Queensland Department of Agriculture and Fisheries and the University of Queensland through the Queensland Alliance for Agriculture and Food Innovation. Plant Virology Research Center, Shiraz University provided funds for part of this research. AG was supported by a scholarship from Shiraz University, Iran.
References
- 1.Amarasinghe GK, Bào Y, Basler CF, Bavari S, Beer M, Bejerman N, et al. Taxonomy of the order Mononegavirales: Update 2017. Archives of Virology. 2017;162:2493–504. doi: 10.1007/s00705-017-3311-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Dietzgen RG, Kuzmin IV, editors. Rhabdoviruses: Molecular taxonomy, evolution, genomics, ecology, host-vector interactions, cytopathology and control: Caister Academic Press; 2012. [Google Scholar]
- 3.Jackson AO, Dietzgen RG, Goodin MM, Bragg JN, Deng M. Biology of plant rhabdoviruses. Annual Review of Phytopathology. 2005;43:623–60. doi: 10.1146/annurev.phyto.43.011205.141136 [DOI] [PubMed] [Google Scholar]
- 4.Izadpanah K, Ahmadi A, Parvin S, Jafari S. Transmission, particle size and additional hosts of the rhabdovirus causing maize mosaic in Shiraz, Iran. Journal of Phytopathology. 1983;107(3):283–8. [Google Scholar]
- 5.Massah A, Izadpanah K, Afsharifar A, Winter S. Analysis of nucleotide sequence of Iranian maize mosaic virus confirms its identity as a distinct nucleorhabdovirus. Archives of Virology. 2008;153(6):1041–7. doi: 10.1007/s00705-008-0085-y [DOI] [PubMed] [Google Scholar]
- 6.Massah A, Izadpanah K, Lesemann D. Relationship of Iranian maize mosaic virus with insect vector and plant cells. Iranian Journal of Plant Pathology. 2005; 41:151–9. [Google Scholar]
- 7.Izadpanah K. Purification and serology of the Iranian maize mosaic rhabdovirus. Journal of Phytopathology. 1989;126(1):43–50. [Google Scholar]
- 8.Widana Gamage SMK, McGrath DJ, Persley DM, Dietzgen RG. Transcriptome analysis of capsicum chlorosis virus-induced hypersensitive resistance response in Bell capsicum. PLoS One. 2016;11(7):e0159085 doi: 10.1371/journal.pone.0159085 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Fan H, Sun H, Wang Y, Zhang Y, Wang X, Li D, et al. Deep sequencing–based transcriptome profiling reveals comprehensive insights into the responses of Nicotiana benthamiana to Beet necrotic yellow vein virus infections containing or lacking RNA4. PloS One. 2014;9(1):e85284 doi: 10.1371/journal.pone.0085284 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Chen J, Zhang H, Feng M, Zuo D, Hu Y, Jiang T. Transcriptome analysis of woodland strawberry (Fragaria vesca) response to the infection by Strawberry vein banding virus (SVBV). Virology Journal. 2016;13(1):128–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Stobbe AH, Roossinck MJ. Plant virus metagenomics: what we know and why we need to know more. Frontiers in Plant Science. 2014;5:150–3. doi: 10.3389/fpls.2014.00150 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Fan H, Zhang Y, Sun H, Liu J, Wang Y, Wang X, et al. Transcriptome analysis of Beta macrocarpa and identification of differentially expressed transcripts in response to beet necrotic yellow vein virus infection. PloS One. 2015;10(7):e0132277 doi: 10.1371/journal.pone.0132277 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Wu W-Q, Fan H-Y, Jiang N, Wang Y, Zhang Z-Y, Zhang Y-L, et al. Infection of Beet necrotic yellow vein virus with RNA4-encoded P31 specifically up-regulates pathogenesis-related protein 10 in Nicotiana benthamiana. Virology Journal. 2014;11(1):118–30. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Zheng W, Ma L, Zhao J, Li Z, Sun F, Lu X. Comparative transcriptome analysis of two rice varieties in response to rice stripe virus and small brown planthoppers during early interaction. PLoS One. 2013;8(12):e82126 doi: 10.1371/journal.pone.0082126 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Tzin V, Fernandez-Pozo N, Richter A, Schmelz EA, Schoettner M, Schäfer M, et al. Dynamic maize responses to aphid feeding are revealed by a time series of transcriptomic and metabolomic assays. Plant Physiology. 2015;169(3):1727–43. doi: 10.1104/pp.15.01039 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Liu M, Gao J, Yin F, Gong G, Qin C, Ye K, et al. Transcriptome analysis of maize leaf systemic symptom infected by Bipolaris zeicola. PloS One. 2015;10(3):e0119858 doi: 10.1371/journal.pone.0119858 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Liu Y, Guo Y, Ma C, Zhang D, Wang C, Yang Q. Transcriptome analysis of maize resistance to Fusarium graminearum. BMC Genomics. 2016;17(1):477–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Wang H, Li S, Teng S, Liang H, Xin H, Gao H, et al. Transcriptome profiling revealed novel transcriptional regulators in maize responses to Ostrinia furnacalis and jasmonic acid. PloS One. 2017;12(5):e0177739 doi: 10.1371/journal.pone.0177739 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Cassone BJ, Wijeratne S, Michel AP, Stewart LR, Chen Y, Yan P, et al. Virus-independent and common transcriptome responses of leafhopper vectors feeding on maize infected with semi-persistently and persistent propagatively transmitted viruses. BMC Genomics. 2014;15(1):133–46. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Zhang M, Kong X, Xu X, Li C, Tian H, Ding Z. Comparative transcriptome profiling of the maize primary, crown and seminal root in response to salinity stress. PloS One. 2015;10(3):e0121222 doi: 10.1371/journal.pone.0121222 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Lu J, Du Z-X, Kong J, Chen L-N, Qiu Y-H, Li G-F, et al. Transcriptome analysis of Nicotiana tabacum infected by cucumber mosaic virus during systemic symptom development. PLoS One. 2012;7(8):e43447 doi: 10.1371/journal.pone.0043447 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Liu J, Yang J, Bi H, Zhang P. Why mosaic? Gene expression profiling of African cassava mosaic virus-infected cassava reveals the effect of chlorophyll degradation on symptom development. Journal of Integrative Plant Biology. 2014;56(2):122–32. doi: 10.1111/jipb.12133 [DOI] [PubMed] [Google Scholar]
- 23.Choi H, Jo Y, Lian S, Jo K-M, Chu H, Yoon J-Y, et al. Comparative analysis of chrysanthemum transcriptome in response to three RNA viruses: Cucumber mosaic virus, Tomato spotted wilt virus and Potato virus X. Plant molecular biology. 2015;88(3):233–48. doi: 10.1007/s11103-015-0317-y [DOI] [PubMed] [Google Scholar]
- 24.Strable J, Scanlon MJ. Maize (Zea mays): a model organism for basic and applied research in plant biology. Cold Spring Harbor Protocols. 2009;2009(10):pdb. emo132. [DOI] [PubMed] [Google Scholar]
- 25.Estakhr A, Heidari B, Dadkhodaie A, Izadpanah K. Evaluation of maize inbred lines for Iranian maize mosaic virus (IMMV) resistance. Annual Research and Review in Biology. 2015;8(2):1–12. [Google Scholar]
- 26.Converse R, Martin R. Enzyme-linked immunosorbent assay (ELISA). Serological methods for detection and identification of viral and bacterial plant pathogens A Laboratory Manual. APS Press; 1990:179–96. [Google Scholar]
- 27.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods. 2001;25(4):402–8. doi: 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
- 28.Escaler M, Aranda MA, Thomas CL, Maule AJ. Pea embryonic tissues show common responses to the replication of a wide range of viruses. Virology. 2000;267(2):318–25. doi: 10.1006/viro.1999.0119 [DOI] [PubMed] [Google Scholar]
- 29.Jeevalatha A, Siddappa S, Kumar A, Kaundal P, Guleria A, Sharma S, et al. An insight into differentially regulated genes in resistant and susceptible genotypes of potato in response to tomato leaf curl New Delhi virus-[potato] infection. Virus Research. 2017;232:22–33. doi: 10.1016/j.virusres.2017.01.015 [DOI] [PubMed] [Google Scholar]
- 30.Czosnek H, Eybishtz A, Sade D, Gorovits R, Sobol I, Bejarano E, et al. Discovering host genes involved in the infection by the Tomato yellow leaf curl virus complex and in the establishment of resistance to the virus using Tobacco rattle virus-based post transcriptional gene silencing. Viruses. 2013;5(3):998–1022. doi: 10.3390/v5030998 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Burley SK, Roeder RG. Biochemistry and structural biology of transcription factor IID (TFIID). Annual Review of Biochemistry. 1996; 65:769–99. doi: 10.1146/annurev.bi.65.070196.004005 [DOI] [PubMed] [Google Scholar]
- 32.Rojas-Rivera D, Armisen R, Colombo A, Martinez G, Eguiguren A, Díaz A, et al. TMBIM3/GRINA is a novel unfolded protein response (UPR) target gene that controls apoptosis through the modulation of ER calcium homeostasis. Cell Death and Differentiation. 2012;19(6):1013 doi: 10.1038/cdd.2011.189 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Min B-E, Martin K, Wang R, Tafelmeyer P, Bridges M, Goodin M. A host-factor interaction and localization map for a plant-adapted rhabdovirus implicates cytoplasm-tethered transcription activators in cell-to-cell movement. Molecular Plant-Microbe Interactions. 2010;23(11):1420–32. doi: 10.1094/MPMI-04-10-0097 [DOI] [PubMed] [Google Scholar]
- 34.Wang X, Goregaoker SP, Culver JN. Interaction of the tobacco mosaic virus replicase protein with a NAC domain transcription factor is associated with the suppression of systemic host defenses. Journal of Virology. 2009;83(19):9720–30. doi: 10.1128/JVI.00941-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Jensen PJ, Fazio G, Altman N, Praul C, McNellis TW. Mapping in an apple (Malus x domestica) F 1 segregating population based on physical clustering of differentially expressed genes. BMC Genomics. 2014;15(1):261–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Medina Jn, Catalá R, Salinas J. Developmental and stress regulation of RCI2A and RCI2B, two cold-inducible genes of Arabidopsis encoding highly conserved hydrophobic proteins. Plant Physiology. 2001;125(4):1655–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Hazarika P, Rajam MV. Biotic and abiotic stress tolerance in transgenic tomatoes by constitutive expression of S-adenosylmethionine decarboxylase gene. Physiology and Molecular Biology of Plants. 2011;17(2):115–28. doi: 10.1007/s12298-011-0053-y [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Bolwell GP. Role of active oxygen species and NO in plant defence responses. Current Opinion in Plant Biology. 1999;2(4):287–94. doi: 10.1016/S1369-5266(99)80051-X [DOI] [PubMed] [Google Scholar]
- 39.De la Torre F, Gutiérrez-Beltrán E, Pareja-Jaime Y, Chakravarthy S, Martin GB, del Pozo O. The tomato calcium sensor Cbl10 and its interacting protein kinase Cipk6 define a signaling pathway in plant immunity. The Plant Cell. 2013;25(7):2748–64. doi: 10.1105/tpc.113.113530 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Carmo LS, Murad AM, Resende RO, Boiteux LS, Ribeiro SG, Jorrín-Novo JV, et al. Plant responses to tomato chlorotic mottle virus: Proteomic view of the resistance mechanisms to a bipartite begomovirus in tomato. Journal of Proteomics. 2017;151:284–92. doi: 10.1016/j.jprot.2016.07.018 [DOI] [PubMed] [Google Scholar]
- 41.Pedley KF, Martin GB. Role of mitogen-activated protein kinases in plant immunity. Current Opinion in Plant Biology. 2005;8(5):541–7. doi: 10.1016/j.pbi.2005.07.006 [DOI] [PubMed] [Google Scholar]
- 42.Dixon RA, Achnine L, Kota P, Liu CJ, Reddy M, Wang L. The phenylpropanoid pathway and plant defence a genomics perspective. Molecular Plant Pathology. 2002;3(5):371–90. doi: 10.1046/j.1364-3703.2002.00131.x [DOI] [PubMed] [Google Scholar]
- 43.Chen T, Lv Y, Zhao T, Li N, Yang Y, Yu W, et al. Comparative transcriptome profiling of a resistant vs. susceptible tomato (Solanum lycopersicum) cultivar in response to infection by tomato yellow leaf curl virus. PLoS One. 2013;8(11):e80816 doi: 10.1371/journal.pone.0080816 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Van Der Biezen EA, Jones JD. Plant disease-resistance proteins and the gene-for-gene concept. Trends in Biochemical Sciences. 1998;23(12):454–6. [DOI] [PubMed] [Google Scholar]
- 45.Brininstool G, Kasili R, Simmons LA, Kirik V, Hülskamp M, Larkin JC. Constitutive expressor of pathogenesis-related Genes5 affects cell wall biogenesis and trichome development. BMC Plant Biology. 2008;8(1):58–69. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Kachroo A, Kachroo P. Fatty acid-derived signals in plant defense. Annual Review of Phytopathology. 2009;47:153–76. doi: 10.1146/annurev-phyto-080508-081820 [DOI] [PubMed] [Google Scholar]
- 47.Alazem M, Lin NS. Roles of plant hormones in the regulation of host–virus interactions. Molecular Plant Pathology. 2015;16(5):529–40. doi: 10.1111/mpp.12204 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Calil IP, Fontes EP. Plant immunity against viruses: antiviral immune receptors in focus. Annals of Botany. 2017;119(5):711–23. doi: 10.1093/aob/mcw200 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Asters M, Williams W, Perkins A, Mylroie J, Windham G, Shan X. Network analysis of maize RNA transport pathway genes associated with maize resistance to aflatoxin accumulation. Scientific Reports. 2014;4:4815–25. [DOI] [PMC free article] [PubMed]
- 50.Oksman-Caldentey K-M, Saito K. Integrating genomics and metabolomics for engineering plant metabolic pathways. Current Opinion in Biotechnology. 2005;16(2):174–9. doi: 10.1016/j.copbio.2005.02.007 [DOI] [PubMed] [Google Scholar]
- 51.Sood A, Chauhan RS. Comparative NGS transcriptomics unravels molecular components associated with mosaic virus infection in a bioenergy plant species, Jatropha curcas L. BioEnergy Research. 2017; 10(1):129–45. [Google Scholar]
- 52.Satoh K, Kondoh H, Sasaya T, Shimizu T, Choi I-R, Omura T, et al. Selective modification of rice (Oryza sativa) gene expression by rice stripe virus infection. Journal of General Virology. 2010;91(1):294–305. [DOI] [PubMed] [Google Scholar]
- 53.Maldonado AFS, Schieber A, Gänzle MG. Plant defence mechanisms and enzymatic transformation products and their potential applications in food preservation: Advantages and limitations. Trends in Food Science & Technology. 2015;46(1):49–59. [Google Scholar]
- 54.Doms RW, Ruusala A, Machamer C, Helenius J, Helenius A, Rose JK. Differential effects of mutations in three domains on folding, quaternary structure, and intracellular transport of vesicular stomatitis virus G protein. Journal of Cell Biology. 1988;107(1):89–99. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Pazhouhandeh M, Dieterle M, Marrocco K, Lechner E, Berry B, Brault V, et al. F-box-like domain in the polerovirus protein P0 is required for silencing suppressor function. Proceedings of the National Academy of Sciences of the United States of America. 2006;103(6):1994–9. doi: 10.1073/pnas.0510784103 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Thiel H, Hleibieh K, Gilmer D, Varrelmann M. The P25 pathogenicity factor of Beet necrotic yellow vein virus targets the sugar beet 26S proteasome involved in the induction of a hypersensitive resistance response via interaction with an F-box protein. Molecular Plant-Microbe Interactions. 2012;25(8):1058–72. doi: 10.1094/MPMI-03-12-0057-R [DOI] [PubMed] [Google Scholar]
- 57.Kidd P. Th1/Th2 balance: the hypothesis, its limitations, and implications for health and disease. Alternative Medicine Review. 2003;8(3):223–46. [PubMed] [Google Scholar]
- 58.Plat J, Baumgartner S, Mensink RP. Mechanisms underlying the health benefits of plant sterol and stanol ester consumption. Journal of AOAC International. 2015;98(3):697–700. doi: 10.5740/jaoacint.SGEPlat [DOI] [PubMed] [Google Scholar]
- 59.Agudelo-Romero P, Carbonell P, De La Iglesia F, Carrera J, Rodrigo G, Jaramillo A, et al. Changes in the gene expression profile of Arabidopsis thaliana after infection with tobacco etch virus. Virology Journal. 2008;5(1):92. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Dubey NK, Goel R, Ranjan A, Idris A, Singh SK, Bag SK, et al. Comparative transcriptome analysis of Gossypium hirsutum L. in response to sap sucking insects: aphid and whitefly. BMC Genomics. 2013;14(1):241–61. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Goyer A. Thiamine in plants: aspects of its metabolism and functions. Phytochemistry. 2010;71(14):1615–24. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
(DOCX)
RNA-Seq dataset of responsive transcripts in MIMV-infected maize compared to uninfected maize. Column A is the Feature ID or Ensemble ID of transcripts, column B is the fold change >2 of transcripts, column C is the p-value, columns D-F are Fragments Per Kilobase Million (FPKM) of uninfected samples, column G is the mean of FPKM in uninfected samples, columns H-J are FPKM of infected samples and columns K is mean of FPKM in infected samples.
(XLSX)
Transcripts are shown with Ensemble ID. Columns A-BI show the name of KEGG pathways and the transcripts that are involved in those pathways.
(XLSX)
Data Availability Statement
All relevant data are within the paper and its Supporting Information files.