Skip to main content
NCBI home page
Annali di Stomatologia logoLink to Annali di Stomatologia
. 2018 Mar 8;8(3):95–103. doi: 10.11138/ads/2017.8.3.095

Mandible protraction alters Type I collagen, osteocalcin and osteonectin gene expression in adult mice condyle

Patricia Valerio 1,✉, Filipi Perfeito 2, Livia P Moura 1, Deborah N Ribeiro 1, Simone O A Fernandes 2, Almir S Martins 1, Maria F Leite 1
PMCID: PMC5897095  PMID: 29682221

Summary

Mandible condyle remodeling is a great challenge on craniofacial growth studies. The great majority of the reports deals with growing period. However, there is a great necessity to clarify the importance of functional stimulation on adult mandible condyle remodeling. By using an adult mouse model, we investigated the influence of mandible forwarding on condyle remodeling and gene expression by bone forming cells. Tomographic and scintigraphic evaluations showed sagittal growth and cell activity enhancement. RT-PCR showed that Type I collagen, osteocalcin and osteonectin expression level can be altered. We showed that functional stimulation is necessary to maintain the regular gene expression by condyle bone forming cells in adult mice. It opens new frame for further investigations aiming new clinical approaches to temporomandibular joint problems treatment, as well as mandible retrusion treatment.

Keywords: bone biology, growth evaluation, molecular biology, CT, condyle growth, gene expression

Introduction

Head and face growth disorders are very common in all racial populations. The prevalence of craniofacial anomalies varies among different ethnicities based on genetic background, geography, socio-economic status and environmental factors (1). Mandible retrusion prevalence runs from 52 to 56% (2), and the most common treatment is condyle traction generated by the mandible forward repositioning. Mandible protrusion enhances functional stimulation on condyle and generates sagittal growth et al. (3). However, we have a huge controversy. Some reports indicate a positive growth response to condyle traction while others indicate a negative or no response to mandibular advancement (4). Therefore, there is a need to identify the markers for each stage of condylar growth and evaluate the effect of functional stimulation on growth pattern. Condyle grows by endochondral ossification, and some Authors have been studying the early stages of condyle formation, focusing on the importance of functional stimulation for chondrogenesis. However, the osteogenic phase of condyle formation has been missed. The possible gene expression alteration on this phase, generated by different pattern of stimulation, was not studied yet (5–10). Moreover, the majority of the reports deals with growing period and do not focus on adult phase (11–16). Considering not only mandible retrusion correction but also considering that remodeling alteration is the main cause for articular temporomandibular disorders affecting many adults (17), it is important to clarify the mechanisms involved on adult condyle response to functional stimulation. So, our aim was to evaluate the alteration on osteoblast gene expression pattern, on mouse adult condyle, under different functional stimulation.

Materials and methods

Mandible protrusion protocol

This study was approved by the Federal University of Minas Gerais Animal Use and Care Committee (Protocol 169/2014). 48 female C57 mice (including 24 as controls) were used in this work. We decided to investigate the effect of mandible protrusion on condyle osteoblasts gene expression. In order to generate mandible protrusion, 24 mice (experimental group) had the inferior incisors cut around 1 mm. We used a nail plyer, holding the animal in left hand and using the plyer on right hand to cut the inferior incisors. It generates an increase on the overjet. Because of this, they had the necessity of sending the mandible forward to be able to chew (Fig. 1).

Figure 1 a, b.

Figure 1 a, b

Open in a new tab

Mandibular advancement. (a) To generate a physiological mandibular advancement, that would lead to stimulation on condyle region, every 3 days during 21 days, the lower incisors were cut by 1 mm to induce protrusion when the animal was feeding. In left panel we can see the control animal with regular distance between inferior and superior incisor, and on right panel we can see the experimental animal immediately after cutting, showing an increase on the overjet; (b) the weight gaining of the animals indicated that on the first days the experimental group was not used to the increase of overjet and had weight loss, but after 9 days they started to eat normally and recover the weight gaining (first point of the graphic is 3 and last point of the graphic is 18, because we checked the weight on the cutting day).

The weight of each animal was checked. Control mice only underwent weight checking to evaluate the regular food intake and consequent weight gain. The animals were provided with free access to food pellets and tap water and were housed at the animal experimentation laboratory. Every 3 days the cutting procedure was repeated, due to continuous eruption of the teeth, as well as the weight checking.

Tomography

To evaluate the condyle sagittal shape changing, we used a tomographic study. The animals were anesthetized with a combination of ketamine (30 mg/kg) and xylazine HCl (2.5mg/kg) intramuscularly. Then, they were positioned on a table adapted to the equipment as showed on the Figure 2a. The condyle was localized on frontal and coronal plane and measurements were done on sagittal plane (Fig. 2b). We used a Gendex CB500 with voxel 0.125 and 4 cm high.

Figure 2 a–c.

Figure 2 a–c

Open in a new tab

Tomography. (a) After anesthesia, the animals were positioned on the equipment table as showed on the picture; (b) The software used allows the user to measure linear distances in 3 dimensions. After anesthesia, the animals were analyzed in coronal (right panel) and transversal (left upper panel) plane to localize the condyle. The measurement was done on sagittal plane (left lower panel). Measurements were done separately in left and right condyle; (c) After 21 days, the experimental group showed an increase on sagittal dimension of the condyle. Results reflects means ± SD of 3 different experiments (p< 0.05).

Scintigraphy

The 99mTechnetium-methylene diphosphonate (99mTc-MDP), a specific marker of the anabolic phase of remodeling, has been used in the diagnosis of a broad spectrum of conditions affecting the skeleton. The radiopharmaceutical99mTc-MDP was obtained from UFMG Pharmacy school laboratory. To observe bone metabolic activity in the region of the condyle, bone scintigraphic images were taken 7 and 21 days after starting cutting, using a gamma camera (NuclideTM TH 22, Mediso, Hungary). This analysis does not require the animal to be killed, and can be repeated. The animals were anesthetized with a combination of ketamine (30 mg/kg) and xylazine HCl (2.5 mg/kg) intramuscularly. Aliquots (0.1 mL) containing 10,3 MBq of (99mTc-MDP) were injected intravenously into the tail vein of the animals. Static-planar acquisition was initiated 1 h after the injection. The animals were placed in a supine position under a gamma camera employing a low-energy high-resolution collimator. Images were acquired using a 256 × 256 × 16 matrix size with a 20% energy window set at 140 keV for a period of 10 min. The images were analyzed quantitatively, and the radioactivity was determined in the demarcation areas of the ROI (region of interest) involving the right and left condyle on experimental and control group. The uptake of 99mTc-MDP in the regions was measured. Results were analyzed using T student test unpaired. Differences were considered significant when p<0.05 (Fig. 3a).

Figure 3 a, b.

Figure 3 a, b

Open in a new tab

Bone Scintigraphy. (a) Representative scintigraphic image for the definition of the region of interest (ROI). Red arrow is reference point to show one ROI at the condyle region. The ROI (circle) was established and the radio isotope count [accumulation count of 99mtechnetium-methylene-diphosphonate (99mTc-MDP)] was measured. As inferred by the color bar scale, red shows a high accumulation of 99mTc-MDP and blue shows a low accumulation of 99mTc-MDP; (b) Uptake ratio of 99mTc-MDP at the condyle region after protrusion of the mandible. The vertical axis shows the uptake ratio. The count rates of 99mTc-MDP in the protruded mandible condyle were significantly higher than control after 21 days. Results express mean ± SD of 2 different experiments for each period (p< 0,05).

Condyle cell isolation and Immunofluorescence

Since our objective would be to evaluate the alteration on gene expression by osteoblasts obtained by the macerate of condyles, it was important to first check the cell population of this macerate. In order to evaluate it, we first used a sequential digestion protocol. Briefly, we dissected the condyles and freed from soft tissue, cut into small pieces and rinsed in sterile phosphate-buffered saline without calcium and magnesium (Sigma Aldrich). The condyle pieces were incubated with 1% trypsin-EDTA (Gibco) for 5 min, followed by four sequential incubations with 0.2% collagenase (Sigma Aldrich) at 37°C for 45 min each. The digestions produced a suspension of cells. After centrifugation at 1000 g for 5 min, the pellet was resuspended in 5 ml of RPMI medium (Gibco) supplemented with 10% FBS (Gibco), 1% antibiotic-antimycotic (Gibco). The cells were seeded into 25 ml tissue culture flasks (Sarstedt), and led to grow in a controlled 5% CO2 95% humidified incubator at 37°C. After confluence the cells were used for immunofluorescence using a marker for bone forming cells (osteopontine OPN). OPN is produced by cells involved in bone morphogenesis such as preosteoblasts, osteoblasts, osteoclasts, osteocytes, odontoblasts, and also hypertrophic chondrocytes. So we decided to use it to be sure that we were dealing with osteogenic cells. For immunofluorescence, we used 6 well culture flask (Sarstedt) and platted the cells over glass cover slips (Fisherbrand). 24 hours later, the cells were fixed with 4% paraformaldehyde (Merk, Brazil) in phosphate buffered saline (PBS) for 10 min, and washed three times in PBS. The cells were incubated in blocking solution [PBS, 1% bovine serum albumin (Sigma), 5% normal goat serum (Sigma), 0.5% triton-X (Sigma Aldrich)] and then incubated with the following primary antibody: mouse antiosteopontin (R&D systems) and secondary: Alexa Fluor (Invitrogen). To evidentiate the nucleus, cells were also incubated with propidium iodide (Sigma Aldrich) (Fig. 4).

Figure 4.

Figure 4

Open in a new tab

Immunofluorescence for osteopontin. Confocal images obtained from the condyle macerate. A great number of cells was positive for osteopontin, indicating that they were bone forming cells. Green indicates osteopontin staining and red are nucleus stained by propidium iodide. Transmission image included in merged image.

Extracting RNA from condyle in a single step

In order to evaluate differential gene expression from cells derived from experimental and control animals, condyle bones were harvested from the animals, exposing them after removing muscles. Any attached tissue was quickly removed using a scalpel before the condyle was immersed in liquid nitrogen. The samples were homogenized separately with Trizol® in porcelain mortar and pestle with liquid nitrogen. RNA was then separated and processed according to the manufacturer’s protocol (Trizol® Reagent, Life Tecnologie, Carlsbad, California). Total RNA was quantified and then treated with DNase I® (TURBO DNA-free Kit, Ambion® Inc., Foster, California, USA).

Reverse Transcriptase Reaction

The RT for sscDNA synthesis was performed from 1 μg of total RNA in a final reaction volume of 20.4 μl per sample. Briefly, RNA was pre-incubated at 70°C for 10 minutes with 10 pmol of each reverse primer specific for the target genes, together with 10 pmol of oligo dT18 primer, followed by storage on ice at the bench top. Then, was added to samples mix containing RT buffer [250 mM Tris-HCl (pH 8.3), 375 mM KCl, 15 mM MgCl2] and dNTP (10mM each), samples with this mix were incubated at 45°C for 2 min and then placed on ice. Finally added 1 μl of reverse transcriptase enzyme mix (40 U) into RT buffer [250 mM Tris-HCl (pH 8.3), 375 mM KCl, 15 mM MgCl2] and incubated at 45°C for 1 hour along with previously described RNA and primers. The reaction was terminated at −20°C until used in the real time PCR. All reagents were from Invitrogen™ (Life Technologies, Carlsbad, CA, USA).

Real time PCR

The real time PCR was developed in 7500/ABI PRISM® Sequence Detection System equipment, using the protocol described by the reaction SYBR Green PCR Master Mix Kit (Invitrogen™ Life Technologies, Carlsbad, CA, USA). Samples in triplicate were applied to 96-well plates (ABI PRISM® Optical 96-Well Reaction Plate with bar code Invitrogen Life Technologies, Carlsbad, CA, USA) in a final reaction volume of 20 μl each. Aliquots of 1.6 μl of sscDNA sample were pipetted into each well of the plate, subsequently adding 18.4 μl of sybrMix [10 μl of SYBR Green PCR Master Mix Kit, 1.2 μl of each primer (sense and antisense; 10 pmol / μl) and 6 μl sterile filtered water]. The plate was sealed with optical adhesive (ABI PRISM® optical adhesive Covers, Invitrogen® Life Technologies, Carlsbad, CA, USA). Real time PCR reactions occurred in the following thermal cycle: [stage 1] a cycle of 50°C/2 min; [stage 2] cycle at 95°C/10 min; [stage 3] 40 cycles of 95°C/0.15 min, followed the dissociation curve from 60°C to analyze the specificity of the amplicons. The mRNA value for each gene was normalized relative to the housekeeping mouse S26 mRNA levels in RNA samples. Primer sequences (forward and reverse) were as follows:

  • S26, 5′- CGTGCTTCCCAAGCTCTATGT -3′ and 5′ -CGATTCCTGACAACCTTGCTATG -3′;

  • Bglap3, 5′-CTTGGTGCACACCTAGCAGA -3′ and 5′-ACCTTATTGCCCTCCTGCT -3′;

  • Col1a1, 5′- GCTCCTCTTAGGGGCCACT -3′ and 5′-ATTGGGGACCCTTAGGCCAT -3′;

  • Sparc, 5′- AAACATGGCAAGGTGTGTGA -3′ and 5′-AAGTGGCAGGAAGAGTCGAA-3′.

For relative quantification was performed a comparative analysis of the expression of target transcripts genes versus endogenous control using the comparative CT method, which the endogenous control was used to normalize the expression of the target gene (target gene CT mean - mean CT endogenous control) generating ΔCT. Using the ΔCT was calculated ΔΔCT [ΔCT sample - ΔCT calibrator (reference sample)]. Then it was applied the formula 2 −ΔΔCT for determining the relative levels of expression of each target gene. The results of expression levels were launched in GraphPad Prism 5 software, for statistical analysis, using t student tests unpaired. Differences were considered significant when p<0.05.

Results

Sequential cut of inferior incisor generates condyle sagittal remodeling

The model used to generate protrusion was adapted from Tagliaro et al. (17). In our protocol we did not use anesthesia and the cutting using a nail plyer was quick, effective and more secure than trimming using a dental motor, recommended by the Author. On Figure 1a we can see the generated increase on overjet. The weight gain of both groups was checked to evaluate the experimental group adaptation to the increased overjet. When compared to control, experimental group showed, on the first days, a decrease on weight gain, indicating that the animals were not used to the new occlusal situation leading to difficulties on chewing. We can state that the functional stimulation during this period decreased. After they get used to new occlusal scheme they regularized the food intake and achieved the same weight of the control group at 21 days as showed on Figure 1b. The tomographic images were taken in order to evaluate sagittal dimension alteration of the condyles from the animals submitted to mandible protrusion, since it is known that the condyle remodeling follows the direction of pulling (18). It was adapted a positioner for anesthetized animals as showed on Figure 2a. Images were taken after localizing the condyle on transversal and coronal plane. The measurements were made with 0,5 mm of accuracy (Fig. 2b). The results showed that mandible protrusion was able to generate sagittal condyle posterior remodeling on adult animals, when compared to no protruded controls (p<0.05) (Fig. 2c).

Mandible protrusion leads to increase on condyle cellular activity and enhanced expression of Type I collagen, osteocalcin and osteonectin

On the scintigraphy, the selected regions of interest (ROI) on condyle were evaluated in both sides of experimental and control animals (Fig. 3a). The plotted results indicated that on 7 days it was not possible to register a statistical difference of 99mTc-MDP capitation comparing experimental and control groups. But after 21 days it was possible to see a statistical relevant increase on the capitation by the condyles submitted to traction by protrusion (p<0.05) (Fig. 3b), corroborating the results obtained by the tomography. After isolation and expansion of the cell population obtained from sequential digestion of condyle macerate, it was possible to show that a great number of bone forming cells were present on the population. Osteopontin antibody stained the majority of the cells as shown in Figure 4, indicating that the condyle macerate could be used for total RNA extraction to evaluate differential gene expression of bone forming markers. The expression of Type I collagen, osteocalcin and osteonectin by the bone forming cells isolated from the condyle were affected by the mechanical stimulation. During the first days, when the animals from experimental group were not able to chew properly we observed a decrease on the expression of the three genes compared to control animals. After they start to chew normally and had to protrude in order to compensate the increased overjet, there was a recovering on the expression of these genes allowing at 21 days no statistical difference on their level (p<0.05) (Fig. 5a–d). As soon as the animals started to increase the condyle traction, due to mandible protrusion, gene expression pattern of Type I collagen, osteocalcin and osteonectin increased.

Figure 5.

Figure 5

Open in a new tab

Real-time PCR. Diferential expression of: (a) Collagen (Col1), (b) Osteocalcin (Bglap) and (c) Osteonectin (Sparc) evaluated at 7 days and 21 days. All of them showed lower expression on experimental group at 7 days, compared to control (p<0.05). On 21 days no statistical difference on gene expression was observed (p<0.05), indicating that the experimental group showed an enhance on gene expression during the period from 7 to 21 days; (d) Differential expression of Type I Collagen, Osteocalcin and Osteonectin by experimental group analyzed in terms of control % (p<0.05).

Discussion

Little is known about the mechanisms involved on mandible remodeling under functional stimulation. In a recent integrative review conducted by our group (19) we found only 15 relevant works dealing with this subject in the last 20 years. It is well known that functional stimulation interferes with condyle remodeling during growing periods (17, 20–22). However, it remains unclear the role of functional stimulus on adult condyle remodeling. Our adapted protrusion model allowed the investigation of condyle remodeling in adult mice. On the beginning the animals diminished the food intake. The difficulty on chewing demonstrated by the animals immediately after the initial cutting is in accord to orofacial proprioception neurophysiology. It is known that body needs an adaptation period when changes in occlusal scheme occurs. It generates a delay on regular food intake (23). So, our experimental group delayed to get used to increased overjet and due to that diminished the food intake. But the curve of weight gain (Fig. 1b) indicated that the experimental group after recovering the capacity of regular chewing, even having to protrude, was able to equalize the weight gain with the control group. It indicates that the animals learned how to forward the mandible in order to chew, making our model adequate for the study. The tomographic study demonstrated that adult mice showed change on condyle shape when submitted to mandible forwarding. It was also observed by scintigraphic study a higher cellular activity when compared to control (Fig. 2, 3). It is in accord with a previous study, conducted in rats, where the changing of occlusal scheme, by removing some teeth, lead to alteration on condyle shape (24). Our results reinforced the effect of functional stimulus on condyle shape and cell activity even being an adult.

Since condyle remodeling occurs due to endochondral ossification, the majority of the works have been trying to investigate the chondrogenesis (8, 25, 26). We focused, instead, on the next step of bone formation, trying to investigate if the functional stimulation of mandible would lead to different expression of bone forming markers by condyle osteoblasts. We choose 3 specific bone markers to be evaluated. Since collagen Type I gene expression occurs during all process of bone formation (27), it was our first choice. osteocalcin and osteonectin are also well known specific markers for osteogenesis (28, 29). Using primers for these 3 genes, we performed a Real-time PCR and found that all of them had the expression level diminished when the experimental animals were not able to chew, indicating that even in adults, the maintenance of adequate functional stimulation is necessary to keep the regular level of gene expression. On the other hand, the functional stimulation enhancing, generated by condyle traction, after the animals get used to big overjet, lead to an increase on osteogenic markers gene expression level.

Type I collagen synthesis is of particular interest. The synthesis of this collagen is closely regulated, since deficiencies or excess of the protein can cause serious disorders (30). Osteonectin, recently, appears as a promising target for preventing or treating bone diseases (31). Osteocalcin, since last decade, is recognized as an important regulator of bone mechanotransduction (32–34). So, knowing that functional stimulus interferes so much on Type 1 collagen, osteonectin and osteocalcin expression opens new frame for therapeutic approaches, not only related to mandible retrusion but also to temporomandibular joint disorders.

Together, our results corroborated previous findings and expanded them, now showing that the synthesis of Type I collagen, osteocalcin and osteonectin can have the expression pattern altered by changes on functional stimulation, in adults. These current observations highlight the needing for further investigations.

Conclusion

Functional stimulation is necessary to maintain the regular gene expression of collagen, osteocalcin and osteonectin by condyle bone forming cells, in adult mice. Protraction of mandible generates alteration on these genes expression by condyle cells.

Acknowledgments

Aknowledgements

We would like to thank the ARCATA clinic staff for the kind help with the tomography. This work was supported by CAPES, CNPq and FAPEMIG grants.

References

  • 1.Joshi N, Handam A, Fakhouri WD. Skeletal malocclusion: a developmental disorder with a life long morbidity. J Clin Med Res. 2014;6(6):399–308. doi: 10.14740/jocmr1905w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Baume RM, Buschang PH, Weistein S. Stature, head height and growth of the vertical face. Am J Orthod. 1983;83:477–483. [PubMed] [Google Scholar]
  • 3.Arvystas MG. The rationale for early orthodontic treatment. Am J Orthod Dentofacial Orthop. 1998;113:15–18. doi: 10.1016/S0889-5406(98)70271-9. [DOI] [PubMed] [Google Scholar]
  • 4.Rabie AB, Al-Kalaly A. Does the degree of advancing during functional appliance therapy matter? Eu J Orthod. 2008 Jun;30(3):274–282. doi: 10.1093/ejo/cjm129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Shibata S, Fukuoka H, Sato R, Abe T, Suzuki Y. 2012. An in situ hybridization study of the insulin-like growth factor system in developing condylar cartilage of the fetal mouse mandible. Eur J Histochem. 2008 May;2356(2):e23. doi: 10.4081/ejh.2012.e23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Liu Q, Gibson MP, Sun H, Qin C. Dentin sialophosphoprotein (DSPP) plays an essential role in the postnatal development and maintenance of mouse mandibular condylar cartilage. J Histochem Cytochem. 2013 Oct;61(10):749–758. doi: 10.1369/0022155413502056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Morimoto H, Baba R, Haneji T, Doi Y. Double-stranded RNA-dependent protein kinase regulates insulin-stimulated chondrogenesis in mouse clonal chondrogenic cells, ATDC-5. Cell Tissue Res. 2013 Jan;351(1):41–47. doi: 10.1007/s00441-012-1521-6. [DOI] [PubMed] [Google Scholar]
  • 8.Enomoto A, Watahiki J, Nampo T, Irie T, Ichikawa Y, Tachikawa T, Maki K. 2014. Mastication markedly affects mandibular condylar cartilage growth, geneexpression, and morphology. Am J Orthod Dentofacial Orthop. 2013 Sep;146(3):355–363. doi: 10.1016/j.ajodo.2014.05.028. [DOI] [PubMed] [Google Scholar]
  • 9.Serrano MJ, So S, Hinton RJ. Roles of notch signalling in mandibular condylar cartilage. Arch Oral Biol. 2014 Jul;59(7):735–740. doi: 10.1016/j.archoralbio.2014.04.003. [DOI] [PubMed] [Google Scholar]
  • 10.Umeda M, Terao F, Miyazaki K, Yoshizaki K, Takahashi I. 2015. MicroRNA-200a Regulates the Development of Mandibular Condylar Cartilage. J Dent Res. 2014 Jun;94(6):795–802. doi: 10.1177/0022034515577411. [DOI] [PubMed] [Google Scholar]
  • 11.Bollen AM, Makinen KK, Makinen PL, Carlson DS. Collagenolytic and phosphatase activity in the rat mandible after functional protrusion. Arch Oral Biol. 1989;34(4):267–273. doi: 10.1016/0003-9969(89)90067-8. [DOI] [PubMed] [Google Scholar]
  • 12.Chen D, Wang X, Luo S. Histologic and histochemical studies on the temporomandibular articular disc in young growing rats after functional mandibular advancements. Hua Xi Kou Qiang Yi XueZaZhi. 1997;15(4):343–345. [PubMed] [Google Scholar]
  • 13.Lou X, Chen Y, Luo S, Chen G. Circadian rhythm changes of the levels of endogenous insulin in growing rat condylar cartilage after functional mandibular protrusion. Hua Xi Kou Qiang Yi XueZaZhi. 2000;18(4):252–254. [PubMed] [Google Scholar]
  • 14.Shen G, Rabie AB, Hägg U, Zhao Z. Expression of type X collagen in condylar cartilage during mandibular protrusion. Hua Xi KouQiang Yi XueZaZhi. 2000;18(2):78–84. [PubMed] [Google Scholar]
  • 15.Xiong G, Chen Y, Ye L, Lou S. Circadian rhythm changes of the levels ofendogenous insulin in growing rat’s blood after functional mandibular protrution. Hua Xi Kou Qiang Yi XueZaZhi. 2000;18(5):349–351. [PubMed] [Google Scholar]
  • 16.Ye L, Chen Y, Luo S. Expression of mRNA of osteocalcin in ondylar cartilage of young SD rats after functional protrusion. Zhonghua Kou Qiang Yi XueZaZhi. 2001;36(6):404–407. [PubMed] [Google Scholar]
  • 17.Chen J, Sobue T, Utreja A, Kalajzic Z, Xu M, Kilts K, Young M. Sex Differences in Chondrocyte Maturation in the Mandibular Condyle from a Decreased Occlusal Loading Model. Calcif Tissue Int. 2011 Aug;89(2):123–129. doi: 10.1007/s00223-011-9498-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Simoes WA, Petrovic A, Stutzmann J. Modus operandi of Planas’ appliance. J Clin Pediatr Dent Winter. 1992;16(2):79–83. [PubMed] [Google Scholar]
  • 19.Valerio P, Macedo FJM, Simoes WA. Remodelative alterations of TMJ with the use of protraction appliances: an integrative review. Ortodontia SPO. 2014;47(3):218–223. [Google Scholar]
  • 20.Watahiki J, Yamaguchi T, Irie T, Nakano H, Maki K, Tachikawa T. Gene expression profiling of mouse condylar cartilage during mastication by means of laser microdissection and cDNA array. J Dent Res. 2004 Mar;83(3):245–249. doi: 10.1177/154405910408300312. [DOI] [PubMed] [Google Scholar]
  • 21.Shibukawa Y, Young B, Wu C, Yamada S, Long F, Pacifici M, Koyama E. Temporomandibular joint formation and condyle growth require Indian hedgehogsignaling. Dev Dyn. 2007 Feb;236(2):426–434. doi: 10.1002/dvdy.21036. [DOI] [PubMed] [Google Scholar]
  • 22.Liu YD, Liao LF, Zhang HY, Lu L, Jiao K, Zhang M, Zhang J, He JJ, Wu YP, Chen D, Wang MQ. Reducing dietary loading decreases mouse temporomandibular joint degradation induced by anterior crossbite prosthesis. Osteoarthritis Cartilage. 2014 Feb;22(2):302–312. doi: 10.1016/j.joca.2013.11.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kumar A, Grigoriadis J, Trulsson M, Svensson P, Svensson KG. Effects ofshort-term training on behavioral learning and skill acquisition during intraoralfine motor task. Neuroscience. 2015 Jul 7;306:10–17. doi: 10.1016/j.neuroscience.2015.06.065. [DOI] [PubMed] [Google Scholar]
  • 24.Yokoyama M, Atsumi T, Tsuchiya M, Koyama S, Sasaki K. Dynamic changes in bone metabolism in the rat temporomandibular joint after molar extraction using bone scintigraphy. Eur J Oral Sci. 2009 Aug;117(4):374–379. doi: 10.1111/j.1600-0722.2009.00635.x. [DOI] [PubMed] [Google Scholar]
  • 25.Cohen WA, Servais JM, Polur I, Li Y, Xu L. Articular cartilage degeneration in the contralateral non-surgical temporomandibular joint in mice with a unilateral partial discectomy. J Oral Pathol Med. 2014 Feb;43(2):162–165. doi: 10.1111/jop.12113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Jahan E, Matsumoto A, Rafiq AM, Hashimoto R, Inoue T, Udagawa J, Sekine J, Otani H. Fetal jaw movement affects Ihh signaling in mandibular condylarcartilage development: the possible role of Ihh as mechanotransduction mediator. Arch Oral Biol. 2014 Oct;59(10):1108–1118. doi: 10.1016/j.archoralbio.2014.06.009. [DOI] [PubMed] [Google Scholar]
  • 27.Harris SE, Bonewald LF, Harris MA, Sabatini M, Dallas S, Feng JQ, Ghosh-Choudhury N, Wozney J, Mundy GR. Effects of transforming growth factor betaon bone nodule formation and expression of bone morphogenetic protein 2, osteocalcin, osteopontin, alkaline phosphatase, and type I collagen mRNA in long-term cultures of fetal rat calvarial osteoblasts. J Bone Miner Res. 1994 Jun;9(6):855–863. doi: 10.1002/jbmr.5650090611. [DOI] [PubMed] [Google Scholar]
  • 28.Brown JP, Delmas PD, Malaval L, Edouard C, Chapuy MC, Meunier PJ. Serum boneGla-protein: a specific marker for bone formation in postmenopausal osteoporosis. Lancet. 1984 May;191(8386):1091–1093. doi: 10.1016/s0140-6736(84)92506-6. [DOI] [PubMed] [Google Scholar]
  • 29.Shimokawa H. Osteonectin, a new protein. Nihon Shika Ishikai Zasshi. 1984;37(5):487–491. [PubMed] [Google Scholar]
  • 30.Marini J, Smith SM. De Groot LJ, Beck-Peccoz P, Chrousos G, Dungan K, Grossman A, Hershman JM, Koch C, McLachlan R, New M, Rebar R, Singer F, Vinik A, Weickert MO. Endotext [Internet] South Dartmouth (MA): MDText.com, Inc; 2015. Apr 22, Osteogenesis Imperfecta. [Google Scholar]
  • 31.Ribeiro N, Sousa SR, Brekken RA, Monteiro FJ. Role of SPARC in bone remodeling and cancer-related bone metastasis. J Cell Biochem. 2014 Jan;115(1):17–26. doi: 10.1002/jcb.24649. [DOI] [PubMed] [Google Scholar]
  • 32.Kreke MR, Goldstein AS. Hydrodynamic shear stimulates osteocalcin expression but not proliferation of bone marrow stromal cells. Tissue Eng. 2004 May-Jun;10(5–6):780–788. doi: 10.1089/1076327041348455. [DOI] [PubMed] [Google Scholar]
  • 33.Iqbal J, Zaidi M. Molecular regulation of mechanotransduction. Biochem BiophysRes Commun. 2005 Mar 18;328(3):751–755. doi: 10.1016/j.bbrc.2004.12.087. [DOI] [PubMed] [Google Scholar]
  • 34.Wang B, Liu YY, Zheng JB, Yuan SX, Chen GX. Changes of osteocalcin and IGF-I during bone lengthening. Chin J Traumatol. 2005 Jun;8(3):151–515896271. [PubMed] [Google Scholar]

Articles from Annali di Stomatologia are provided here courtesy of CIC Edizioni Internazionali

RESOURCES