Skip to main content
Biology Open logoLink to Biology Open
. 2018 Mar 12;7(3):bio031229. doi: 10.1242/bio.031229

Separate roles for Med12 and Wnt signaling in regulation of oxytocin expression

Emma D Spikol 1, Eric Glasgow 1,*
PMCID: PMC5898263  PMID: 29530929

ABSTRACT

Transcriptional control of oxytocinergic cell development influences social, sexual, and appetite related behaviors and is implicated in disorders such as autism and Prader-Willi syndrome. Mediator 12 (Med12) is a transcriptional coactivator required for multiple facets of brain development including subsets of serotonergic and dopaminergic neurons. We surveyed hormone gene expression within the hypothalamo-pituitary axis of med12 mutant zebrafish embryos with a focus on oxytocin (oxt) expression. Some transcripts, such as oxt, vasopressin (avp) and corticotrophin releasing hormone (crh) are undetectable in the med12 mutant, while others are upregulated or downregulated to varying degrees. In med12 mutants, the expression patterns of upstream transcriptional regulators of oxytocinergic cell development remain largely intact in the pre-optic area, suggesting a more direct influence of Med12 on oxt expression. We show that Med12 is required for Wnt signaling in zebrafish. However, oxt expression is unaffected in Wnt-inhibited embryos indicating independence of Wnt signaling. In fact, overactive Wnt signaling inhibits oxt expression, and we identify a Wnt-sensitive period starting at 24 h post fertilization (hpf). Thus, Med12 and repression of Wnt signaling display critical but unrelated roles in regulating oxt expression.

KEY WORDS: Zebrafish, Brain development, Hypothalamus, Neuroendocrine, Transcriptional regulation


Summary: Mediator 12, a transcriptional coactivator, greatly enhances Wnt signaling in the developing embryo. Separate from its role in Wnt signaling, Mediator 12 is required for oxytocin expression.

INTRODUCTION

The neuroendocrine system connects the brain and body to control homeostasis, mood, metabolism and sexual behaviors. These functions are mainly regulated by the hypothalamus, which is composed of distinct cell populations that integrate sensory signals and release neuropeptides that act on other neuron populations and circulate in the bloodstream. Neurons from the hypothalamus project throughout the brain and to the anterior and posterior pituitary, forming the hypothalamo-pituitary axis. Disruptions in the development of the hypothalamus have been linked to depression, chronic stress, autism and obesity. Thus, efforts are being made to understand how transcription factors and secreted growth factors coordinate the development of this brain region (Biran et al., 2015; Pearson and Placzek, 2013). Here, we report previously unrecognized roles for the transcriptional co-activator Mediator 12 (Med12) and the Wnt signaling pathway in regulating expression of the hypothalamic neuropeptide oxytocin.

The oxytocin system has generated increasing interest in recent decades due to the role this neuropeptide might play in regulating social behavior and mental health. Oxytocin is traditionally known for facilitating birth and milk let-down in mammals, and is thought to control reproductive behavior, social bonding and attachment (Kumsta and Heinrichs, 2013). In fact, several studies report associations between SNPs in the oxytocin receptor (OXTR) gene, and autism spectrum disorder (ASD) (Ebstein et al., 2012; Wu et al., 2005). Other reports have proposed roles for the oxytocin system in regulating stress, mood and appetite (McQuaid et al., 2014; Sabatier et al., 2013). In zebrafish oxt is expressed in the pre-optic area (PO), which is likely the evolutionary precursor to the mammalian oxytocinergic neuron clusters, the paraventricular nucleus (PVN) and the supraoptic nucleus (SON) (Biran et al., 2015; Herget et al., 2014). The anatomical features of the hypothalamo-pituitary axis are remarkably conserved between zebrafish and mammals. In both cases, magnocellular neurons produce oxytocin, which travels to the neurohypophysis by axonal projections, where it is released into systemic circulation (Löhr and Hammerschmidt, 2011; Eaton et al., 2008). Importantly, oxytocinergic neurons also project throughout the central nervous system where oxytocin acts as a neuromodulator. Complex projections of oxytocinergic neurons to the tectum, midbrain and hypothalamus have been visualized in larval zebrafish (Herget et al., 2017; Coffey et al., 2013).

Reduction of oxytocin expression can have detrimental effects on human health, as evidenced by the neurobehavioral disorder Prader-Willi Syndrome (PWS), which is characterized by dysregulated social behavior and insatiable appetite. The basis for this disorder is the loss of paternally expressed genes in the 15q11-q13 region, which are imprinted and therefore not expressed from the maternal chromosome. Affected genes include ubiquitin ligases, RNA processing regulators and SnoRNAs. Although oxytocin expression is reduced in PWS, how the genetic deletions that cause the disorder relate to this gene expression change is an open question (Spikol et al., 2016). Of interest are the POU homeobox gene POU3F2, the bHLH-PAS gene SIM1, and the paired class homeobox gene OTP, of which the orthologous genes are required for oxytocin expression in zebrafish and mouse (Eaton and Glasgow, 2006, 2007; Kasher et al., 2016; Acampora et al., 1999; Blechman et al., 2007; Fernandes et al., 2013; Löhr et al., 2009; Michaud et al., 1998; Nakai et al., 1995; Schonemann et al., 1995; Wang and Lufkin, 2000). In fact, monogenic syndromes with similar characteristics to PWS resulting from loss of SIM1 or POU3F2 have been characterized (Izumi et al., 2013; Kasher et al., 2016). However, considering the complex roles of genes that are lost in PWS, it is likely that other transcriptional modulators and signaling pathways that regulate hypothalamic development are perturbed in the disorder, hinting at as-yet-unknown mechanisms that control oxytocin expression.

In the developing brain, spatially localized signals control differentiation of progenitor populations into specific cell types. The transcriptional co-activator Mediator 12 (Med12) was proposed to act as a molecular switch in this process, regulating cell fate decisions for serotonergic, noradrenergic and dopaminergic neuronal subtypes without affecting global neuron number (Wang et al., 2006). Med12 is a subunit of the CDK8 regulatory module of the Mediator complex, which facilitates the interaction between gene-specific transcription factors and general transcription machinery to activate transcription (Malik and Roeder, 2010). In humans, mutations in MED12 cause two, rare, intellectual disability syndromes called FG syndrome and Lujan-Fryns (LF) syndrome, while in-frame insertions and deletions in MED12 are associated with a 1.8-fold increased risk of schizophrenia (Wu et al., 2014; Risheg et al., 2007; Schwartz et al., 2007; DeLisi et al., 2000). The mechanisms by which Med12 controls cell fate determination are not well understood. One possibility is that Med12 is required for transcriptional response to signaling pathways at work during development. Reports from cell culture and mouse studies indicate that Med12 is largely required for β-catenin to activate Wnt-dependent transcription (Kim et al., 2006; Rocha et al., 2010). Interestingly, Wnt signaling is thought to be involved in specifying hypothalamic versus floorplate identity, as well as stimulation of neurogenesis in the hypothalamus (Machluf et al., 2011; Xie and Dorsky, 2017; Kapsimali et al., 2004; Lee et al., 2006).

Here, we asked whether Med12 plays a role in the development of oxytocinergic neuron clusters, since it is partly required for serotonergic and catecholaminergic populations. We found that oxytocin expression is undetectable in the med12y82/y82 mutant and characterized the effect of the med12 mutation on neurosecretory and hormone-producing cells of the hypothalamus and pituitary. Next, we asked whether Med12 is required for Wnt-dependent transcription in zebrafish. We found that while Med12 is required for Wnt signaling in zebrafish, inhibition of Wnt signaling does not lead to a reduction in oxytocin expression. To assess the effect of overactive Wnt signaling, we used the apc hu745/hu745 mutant, which leads to accumulation of β-catenin and constitutive activation of the Wnt pathway (Hurlstone et al., 2003). Our results indicate that Wnt signaling must be repressed, starting around 24 h post fertilization (hpf), when oxytocin cells are likely beginning to express oxytocin, which is the defining step in the differentiation of oxytocin cells (Unger and Glasgow, 2003). The data presented here enhance current understanding of how the transcriptional activator Med12 and the Wnt signaling pathway control the fate decisions of specific neuronal subtypes, and suggest that dysregulated Wnt signaling and MED12 polymorphism could have profound effects on mental health and social behavior.

RESULTS

Med12 is required for oxt expression

Loss-of-function med12 mutations result in a wide range of brain defects in zebrafish embryos including deficits in hindbrain serotonergic neurons, locus coerulus (Lc) noradrenergic neurons, and dopaminergic neurons in the posterior tuberculum (PT) and PO (Wang et al., 2006; Guo et al., 1999). Moreover, deficits in PT dopaminergic neurons are due to med12-dependent elimination of otp expression in this brain region (Del Giacco et al., 2006). Because Otp is an upstream regulator of oxt expression, we examined whether med12 mutations would disrupt oxt expression in the PO (Fig. 1A). We utilized the med12y82/y82 mutant, which harbors a nucleotide change in a splice donor site that leads to splicing from a downstream site, which causes a frameshift and chain termination, presumably leading to production of a non-functional protein (Hong et al., 2005). In contrast to previous studies, which demonstrated reductions in the cell types examined, whole-mount in-situ hybridization (WISH) shows a loss of oxt expression in med12 mutant embryos at 48 hpf (Fig. 1D,D′), 72 hpf (Fig. 1B,B′), and 96 hpf (Fig. 1C,C′). med12 mutant embryos die around 4 to 5 dpf.

Fig. 1.

Fig. 1.

Expression of oxt in the pre-optic area is undetectable in the med12 mutant while expression of transcription factors required for oxt remain intact. (A) A simplified diagram of the transcriptional network regulating oxytocin expression. Otpb, Sim1a, Pou3f2b, Fezl, and Lhx5 are all required for oxytocin expression. B-C′ are all dorsal views of oxt expression in the PO of WISH embryos magnified ×100. (B,B′) 72 hpf. (C,C′) 96 hpf. B,C are wild-type siblings. B′,C′ are med12 mutants. D-K′ are all lateral views of 48 hpf WISH embryos magnified ×100. D,E,F,G,H,I,J,K are wild-type siblings. D′,E′,F′,G′,H′,I′,J′ are med12 mutants. (D,D′) oxt expression in the PO. (E,E′) pou3f2b expression in the PO (F,F′) pou3f2a expression in the PO. (G,G′) sim1a expression in the vTha, PT, and PO. (H,H′) otpb expression in the H, PT, and PO. (I,I′) fezl expression in the PO and Tel. (J,J′) lhx5 expression in the PO, Tel and H. (K,K′) mytl1a expression in the POA. PO, pre-optic area; TeO, optic tectum; vTha, ventral thalamus; PT, posterior tuberculum; H, hypothalamus; Ce, cerebellum; MO, medulla oblongata; Tel, telencephalon.

Med12 is required for oxt expression independently of upstream transcriptional regulators

We and others have shown that the transcriptional regulators Pou3f2b, Sim1a and Otpb are required for oxt expression (Fig. 1A) (Eaton and Glasgow, 2006, 2007; Kasher et al., 2016; Blechman et al., 2007; Fernandes et al., 2013; Löhr et al., 2009). Thus, we asked whether loss of oxt expression in the med12 mutant could be explained by loss of expression of pou3f2b, sim1a or otpb. WISH shows the presence of all three transcriptional regulators in the PO of med12 mutant embryos. Expression of pou3f2b and pou3f2a is intact in the PO of the med12 mutant (Fig. 1E,E′,F,F′). In addition, sim1a is expressed in a wild-type pattern in med12 mutant embryos with staining seen in the ventral thalamus (vTha), PT, and PO, consistent with Borodovsky et al. (Fig. 1G,G′) (Borodovsky et al., 2009). Furthermore, otpb is expressed in the PO of med12 mutants, even though expression is eliminated in the PT (Fig. 1H,H′). These results suggest that, in contrast to dopaminergic cell development in the PT, the effect of loss-of-function med12 mutations on oxt expression is otp-independent.

Since oxt expression is undetectable in the med12 mutant, alterations in pro-neuronal and brain patterning genes in the absence of Med12 are of interest. Wang et al. surveyed several brain patterning genes and expression of the pan-neuronal marker HuC, and no major deficits in brain patterning or global neuron number were found (Wang et al., 2006). In addition, we examined expression of forebrain markers fezf2 and lhx5. Fezf2 is a forebrain-specific transcription factor involved in patterning and neurogenesis (Berberoglu et al., 2009). Additionally, Fezf2 is required for oxt expression in zebrafish (Blechman et al., 2007). Importantly, fezf2 is expressed in the PO of the med12 mutant, indicating that loss of fezf2 is not responsible for loss of oxt expression in embryos lacking functional Med12 (Fig. 1I,I′). Lhx5 regulates forebrain development and is a transcriptional activator of Wnt antagonists (Peng and Westerfield, 2006). Lhx5 is also required for oxt expression (Machluf et al., 2011). WISH results suggest that expression of lhx5 is intact in the PO of the med12 mutant, indicating that alterations in lhx5 are not responsible for loss of oxt in the med12 mutant (Fig. 1J,J′).

Myt1la is a pro-neuronal transcription factor, the disruption of which has been associated with intellectual disability and obesity in human patients. Knock-down of myt1la in zebrafish results in loss of oxt expression (Blanchet et al., 2017). We find that myt1la is expressed in the PO of med12 mutants, indicating that altered mytl1a expression is not responsible for the loss of oxt expression in the med12 mutant (Fig. 1K,K′).

The observed lack of expression changes of transcription factors required for oxt expression in the PO of the med12 mutants indicates that loss of oxt in the med12 mutant is independent of known transcription factors controlling oxt expression. Although it is possible that post-48 hpf alterations in expression of the markers examined might contribute to loss of oxt expression in the med12 mutant at later time points, it seems unlikely that any are solely responsible for the loss of oxt considering that oxt expression is already undetectable at 48 hpf in the med12 mutant.

Med12 affects multiple hypothalamic and pituitary cell types

Because the med12 mutation eliminated oxt expression completely while only causing reductions of serotonergic, noradrenergic and dopaminergic neurons at specific loci, we decided to survey additional cellular subtypes within the hypothalamic-pituitary axis. WISH shows that arginine vasopressin (avp) is undetectable in the med12 mutant in both the PO and ventral hypothalamus (vH) (Fig. 2A,A′). Additionally, corticotrophin-releasing hormone (crh) expression is undetectable, with no expression in the PO, PT, or Lc of the med12 mutant (Fig. 2B,B′), and thyrotrophin-releasing hormone (trh) expression is undetectable, with no expression in the PO, vH, or Lc (Fig. 2C,C′). However, not all cellular subtypes in the hypothalamic-pituitary axis are eliminated in the med12 mutant; in the pituitary, prolactin (prl) expression is increased while thyroid-stimulating hormone (tsh) expression is reduced compared to wild type (Fig. 2D,D′,E,E′). Alterations in tsh and prl expression detected by WISH were confirmed using RT-qPCR (Fig. 2F,G). These data suggest that Med12 controls gene expression in multiple hypothalamic and pituitary cell types, presenting qualitatively different effects on several categories of cells. Serotonergic, noradrenergic and dopaminergic neurons are reduced, but only in specific brain nuclei, while oxt, avp, crh and trh expressing neurons are dependent on Med12 function in all areas of the brain. In the pituitary, the function of Med12 appears to be more complex and has both positive and negative effects on hormone gene expression. The mechanism for this effect is unknown, but one possibility is that Med12 affects key developmental signaling mechanisms such as the Wnt/β-catenin pathway.

Fig. 2.

Fig. 2.

Med12 is required for expression of avp, crh and trh and modulates expression of prl and tsh. A-E′ are all dorsal views of WISH in 48 hpf embryos magnified ×100. (A,B,C,D,E) wild-type siblings. (A′,B′,C′,D′,E′) med12 mutants. (A,A′) avp expression in the PO and vH. (B,B′) crh expression in the PO, PT and Lc. (C,C′) trh expression in the PO, vH and Lc. (D,D′) prl expression in the pituitary. (E,E′) tsh expression in the pituitary. (F,G) Expression of prl (F) and tsh (G) were measured in 48 hpf embryos using RT-qPCR. Gene expression values were normalized to an endogenous control, beta actin 2 (actb2), and are expressed as fold changes relative to wild-type sibling controls. **P<0.01, *P<0.05, two-tailed paired Student's t-test. Dot plots show three biological replicates (black) and the mean (red). PO, pre-optic area; PT, posterior tuberculum; Lc, locus coerulus; vH, ventral hypothalamus; Pit, pituitary.

In mice, expression of Pit1 and markers of somatotropes (Gh), lactotropes (Prl) and thyrotropes (Tshβ) are dependent on Wnt signaling in the developing pituitary (Olsen et al., 2006). However, although the roles of Shh, Fgf, and Notch/Delta signaling in pituitary development have been well characterized in zebrafish, the role of Wnt signaling has not been well studied (Pogoda and Hammerschmidt, 2009). We find that in Wnt-inhibited embryos, the lactotrope marker prl becomes highly variable while the thyrotrope marker tsh is increased (Fig. S1A,A′,D,D′,F,H,J). Meanwhile, in the apc mutant, which has overactive Wnt signaling, expression of prl is increased while expression of tsh is decreased (Fig. S1B,B′,E,E′,G,I J). We conclude that Wnt signaling plays a critical role in cell type specification in the developing zebrafish pituitary, establishing a role for Wnt signaling in pituitary development across vertebrate species (Fig. S1J).

Med12 is required for Wnt signaling during zebrafish development

Cell culture experiments indicate that MED12 physically interacts with β-catenin to activate transcription of Wnt-responsive genes (Kim et al., 2006). Additionally, Med12 hypomorphic mouse embryos exhibit reduced expression of target genes of Wnt/β-catenin signaling (Rocha et al., 2010). Similarly, findings in fly and worm suggest that Med12 orthologs in these species are activators of Wnt signaling (Carrera et al., 2008; Yoda et al., 2005). In contrast, Lin et al. note that injection of a med12 morpholino increases the proportion of embryos exhibiting a multiple tail bud phenotype induced by Wnt8 mRNA injection (Lin et al., 2007). This suggests an inhibitory role for Med12 in Wnt signaling and raises the question of whether Med12 inhibits, or activates Wnt signaling in zebrafish as it does in other model systems. However, although multiple studies have analyzed med12 mutant zebrafish, none have specifically assessed the role of Med12 in Wnt signaling (Wang et al., 2006; Wu et al., 2014; Hong et al., 2005; Guo et al., 1999; Hong and Dawid, 2011). Here, we ascertain whether Med12 is required for Wnt signaling and transcription of Wnt target genes in zebrafish.

We in-crossed apchu745/+; med12y82/+ embryos and found that embryo phenotypes did not conform to expectations for a dihybrid cross. The apchu745/hu745 and med12y82/y82 embryos have easily identifiable phenotypes at 48 hpf; while the apchu745/hu745 mutant exhibits a dorsal tail curve, the med12y82/y82 mutant can be identified by a pronounced lateral tail curve (Fig. 3A,B,C). The proportion of med12 phenotypes from the dihybrid cross was higher than expected (χ2=54.770, P<0.0001). We reasoned that if Med12 is downstream of and epistatic to Apc, the apchu745/hu745; med12y82/y82 embryos would resemble the med12y82/y82 mutants phenotypically, thus explaining the observed phenotype ratios. We characterized the morphology of wild-type, med12y82/y82 and apchu745/hu745; med12y82/y82 embryos at 48 hpf by measuring their tail curvature as calculated by dividing the total length of the tail from the bottom of the yolk to the tail tip, by the distance from the bottom of the yolk to the tail tip (Fig. 3A′,C′,D′,E). The apchu745/hu745; med12y82/y82 embryos exhibited a lateral tail curve and not a dorsal tail curve (Fig. 3D). The tail curve measurements of apchu745/hu745; med12y82/y82 embryos overwhelmingly resembled med12y82/y82 embryos as compared with apchu745/hu745 mutants and wild-type embryos (Fig. 3E). It has been previously reported that med12y82/y82 mutants exhibit a reduction in melanophores at 48 hpf, likely due to a failure in migration of neural crest cells, which are melanocyte precursors (Hong et al., 2005). We counted the number of melanophores on the lateral side of wild-type, med12y82/y82 mutant and apchu745/hu745; med12y82/y82 double mutants. We observed a statistically significant reduction in melanophore number in both med12y82/y82 mutants and apchu745/hu745; med12y82/y82 double mutants as compared with wild type (Fig. 3F). These data suggest that Med12 is epistatic to Apc, as apchu745/hu745; med12y82/y82 mutants resemble med12y82/y82 mutants phenotypically.

Fig. 3.

Fig. 3.

Med12 is epistatic to Apc and is required for Wnt-dependent gene expression. A-D are all lateral views of 48 hpf embryos. (A,A′) wild-type embryos. (B) apchu745/hu745 mutant. (C,C′) med12y82/y82 mutants. (D,D′) apc hu745/hu745; med12y82/y82 double mutant. In A′,C′ and D′, the black dotted line represents the distance from the yolk to the tail tip and the red dotted line represents the tail length. (E) Tail curvature of apc hu745/hu745; med12y82/y82 double mutants was compared to that of wild-type and med12y82/y82 mutant embryos. Tail curvature is the tail length divided by the distance from yolk to tail tip. wild type: n=20, med12y82/y82: n=24, apc hu745/hu745; med12y82/y82: n=8. A, P<0.001; B, P<0.05, two-tailed unpaired Student's t-test. Error bars show s.e.m. (F) The number of melanophores on the lateral surface of the yolk of apc hu745/hu745; med12y82/y82 double mutants was compared to that of wild-type and med12y82/y82 mutant embryos. wild type: n=15, med12y82/y82: n=27, apc hu745/hu745; med12y82/y82: n=9. A,B P<0.001, two-tailed unpaired Student's t-test. Error bars show s.e.m. (G,G′) Representative images of GFP expression visualized at ×100 magnification in 24 hpf wild-type siblings and med12 mutants that are heterozygous for the TOP:GFP transgene. Arrows indicate area of reduced GFP expression. (H) Corrected head fluorescence was compared between wild-type and med12y82/y82 mutant embryos. Corrected head fluorescence is head fluorescence (Integrated Density) divided by the area of the head. wild type: n=8, med12y82/y82: n=9. P<0.001, two-tailed unpaired Student's t-test. Error bars show s.e.m. (I,I′) Representative full embryo views of GFP expression magnified ×50 in 24 hpf wild-type siblings and med12 mutants that are heterozygous for the TOP:GFP transgene. Dashed line indicates an example of the area (the head) that was circled for fluorescence and area measurements in H. J,J′ are dorsal views of WISH for lef1 in 48 hpf embryos magnified ×100. (J) wild-type sibling. (J′) med12 mutant.

To provide further evidence that Med12 is required for Wnt signaling in zebrafish, we utilized the Tg(TOP:GFP) transgenic reporter line, in which GFP expression is driven by a Wnt-responsive promoter (Dorsky et al., 2002). At 24 hpf, when the TOP:GFP transgene is normally highly expressed, GFP expression was reduced in med12 mutants heterozygous for the TOP:GFP transgene as compared with wild type, indicating that Med12 is required for Wnt signaling (Fig. 3G,G′,H,I,I′). Additionally, expression of the Wnt-responsive gene lef1 is reduced in the med12 mutant as compared with wild type (Fig. 3J,J′) (Kawakami et al., 2006).

Med12 is required for oxytocin expression independently of Wnt signaling

Although Med12 is required for proper expression of numerous cell-type specific markers, we focused on oxt expression in particular because altered oxytocinergic systems are linked to behavioral and appetite-related disorders. Because Med12 plays a role in Wnt signaling during zebrafish development, we investigated potential roles of Wnt signaling in oxytocin expression. To inhibit Wnt signaling, we used IWR, which inhibits Tankyrase enzymes that regulate turnover of Axin proteins. In the absence of Tankyrase activity, Axin accumulates and promotes destruction of β-catenin, thereby reducing transcription of Wnt-responsive genes. IWR was previously shown to inhibit tailfin regeneration and reduce expression of a Wnt-responsive 7x TCF-siam:EGFP transgene in zebrafish embryos (Dodge et al., 2012). We achieved similar results when treating Tg (TOP:GFP) transgenic reporter fish with IWR (Fig. 4E,E′,F,F′). Treatment with IWR also caused lateral tail curvature, a phenotype characteristic of med12 mutant embryos (data not shown). Although oxt expression is undetectable in the PO of the med12 mutant at 48 hpf, oxt expression is unaffected in embryos treated with IWR, suggesting that Med12 is required for oxytocin expression independently of Wnt signaling (Fig. 4A-C). RT-qPCR was used to confirm that oxt expression is reduced in med12 mutants, but not in IWR treated embryos (Fig. 4D).

Fig. 4.

Fig. 4.

Expression of oxt is undetectable in the med12 mutant but is unaffected by treatment with Wnt inhibitors. A-C are all dorsal views of WISH for oxt in 48 hpf embryos magnified ×100 in which arrowheads indicate oxt expression. Embryos treated with IWR and med12 mutants were compared to sibling controls. (A) wild-type embryo. (B) med12 mutant embryo. (C) IWR-treated embryo. (D) oxt expression was measured using RT-qPCR in 48 hpf embryos. Gene expression values were normalized to an endogenous control, beta actin 2 (actb2), and are expressed as fold changes relative to wild-type sibling, or vehicle-treated wild-type sibling controls. A: P<0.01, two-tailed paired Student's t-test. Dot plot shows three biological replicates (black) and the mean (red). (E,E′,F,F′) Representative images of GFP expression was visualized in 24 hpf vehicle and IWR-treated embryos that are heterozygous for the TOP:GFP transgene. (E,E′) Magnified ×100. Arrows indicate area of reduced GFP expression. (F,F′) Representative full embryo views magnified ×50.

Overactive Wnt Signaling suppresses oxytocin expression

Surprisingly, although Wnt inhibition had no effect on oxt expression, oxt expression is reduced in apc mutants, which have overactive Wnt signaling. Reduced oxt expression in the apc mutants as detected by WISH was evident at 48 hpf (Fig. 5A,A′). This reduction appeared more pronounced at 72 hpf (Fig. 5B,B′). Reductions in oxt expression in the apc mutant at 48 hpf and 72 hpf were confirmed by RT-qPCR (Fig. 5C,C′). Despite expression pattern changes in other nuclei, sim1a and otpb are expressed in the PO of the apc mutant at 48 hpf, indicating that reduction of oxt expression is independent of these transcription factors (Fig. S2B,B′,C,C′). Although pou3f2b is expressed in the PO of the apc mutant, expression is reduced in the PO and more diffuse throughout the embryo as compared with wild type, suggesting that a reduction in pou3f2b might underlie the reduction in oxt observed in the apc mutant (Fig. S2A,A′).

Fig. 5.

Fig. 5.

Expression of oxt is reduced in the apc mutant and LiCl-treated embryos starting at 24 hpf. A-B′ are all dorsal views of WISH for oxt magnified ×100. (A,A′) 48 hpf embryos. (B,B′) 72 hpf embryos. (A,B) wild-type siblings. (A′,B′) apc mutants in which arrows indicate areas of reduced oxt expression. (C,C′) oxt expression was measured at 48 and 72 hpf in wild-type and apc mutant embryos using RT-qPCR. Gene expression values were normalized to an endogenous control, beta actin 2 (actb2), and are expressed as fold changes relative to wild-type sibling controls. **P<0.01, two-tailed paired Student's t-test. Dot plots show three biological replicates (black) and the mean (red). (D) Timeline schematic showing LiCl treatment time and duration. Lettering in the schematic corresponds to labeling in the figure. Triangle represents fixation point for treatments E,F,G,H,I,K and L. Circle represents fixation point for treatment J. Red, no effect on oxt expression. Green, leads to reduced oxt expression. E,E′,E″,E′″ are all dorsal views of WISH for oxt magnified ×100. E-K′ are all dorsal views of WISH for oxt in wild-type embryos magnified ×100. E,F,G,H,I,J,K underwent sham treatment in fish water. E′,E″,E″′,F′,G′,H′,I′,J′,K′ were treated with LiCl. Arrows in F′,G′,H′,I′,J′,K′ indicate areas of reduced oxt expression. (E-K′) 48 hpf. (J,J′) 57 hpf. (E-E′″) treated at 5 hpf for 20 min. (F,F′) treated at 8 hpf for 30 min. (G,G′) treated at 20 hpf for 1 h. (H,H′) treated at 24 hpf for 1 h. (I,I′) treated at 30 hpf for 1 h. (J,J′) treated at 31 hpf for 4.5 h. (K,K′) treated at 41 hpf for 5 h (L) oxt expression was measured in LiCl and sham treated embryos at 48 hpf using RT-qPCR. 1: treated at 10 hpf for 1 h; 2: treated at 18 hpf for 3 h; 3: treated at 28 hpf for 3.75 h. 4: treated at 36 hpf for 12 h. Gene expression values were normalized to an endogenous control, beta actin 2 (actb2), and are expressed as fold changes relative to sham-treated wild-type sibling controls. **P<0.01, two-tailed paired Student's t-test. Dot plot shows three biological replicates (black) and the mean (red).

Although it is not known when oxytocin cells become specified, it might be around 14 hpf when nearby dopaminergic cells in the PO are specified (Russek-Blum et al., 2008). The start of oxt expression, which is the defining step in the differentiation of oxytocin cells, likely occurs just prior to 36 hpf, when a low level of oxt is detectable by WISH (Unger and Glasgow, 2003). We asked which stage of oxytocin cell development is disrupted by overactive Wnt signaling.

Embryos were treated at various time points throughout development with LiCl, a chemical activator of Wnt signaling that works by inhibiting GSK3β and stabilizing β-catenin, which activates transcription of Wnt target genes (Robertson et al., 2014) (Fig. 5A). LiCl treatment differs in lethality depending on developmental stage, suggesting different sensitivities to LiCl (Table S1). Thus, treatment duration was adjusted depending on the stage of the embryo. We sought to treat embryos prior to 14 hpf to assess whether overactive Wnt signaling disrupts oxt expression early in oxt cell development. Only 55% of embryos survived LiCl treatment at 5 hpf for 20 min, while 0% survived treatment at 6 hpf for 12 h and 9 hpf for 2 h. However, 83.3% of embryos survived LiCl treatment at 8 hpf for 30 min and 100% of embryos survived treatment at 10 hpf for 1 h (Table S1). Therefore, we performed WISH for oxt on embryos treated with LiCl at 5 hpf for 20 min or 8 hpf for 30 min, and RT-qPCR on embryos treated at 10 hpf for 1 h. LiCl treatment at 5 hpf for 20 min causes a variable posteriorization phenotype; that is, some embryos are posteriorized while others are not (Fig. 5E,E′,E″,E′″). In this experiment, non-posteriorized embryos always had unaffected oxt expression as detected by WISH (Fig. 5E′). Even among LiCl-treated embryos that lost their eyes, oxt expression was often still present (Fig. 5E″). This was not the case in extreme examples, presumably because the PO is no longer present in these embryos (Fig. 5E′″). Additionally, WISH shows that 30 min LiCl treatment at 8 hpf has no effect on oxt expression (Fig. 5F,F′). RT-qPCR reveals no significant differences in oxt expression for embryos treated with LiCl at 10 hpf for 1 h and controls (Fig. 5L).

Since early treatment with LiCl did not result in a reduction in oxt expression, we sought to identify the stage at which LiCl treatment would begin to affect oxt. To that end, embryos were treated with LiCl for 1 h at 20 hpf, 24 hpf and 30 hpf. Since embryos appear to be more sensitive to LiCl at earlier developmental stages, we reasoned that the 20 hpf treatment would either be stronger or the same as the 24 hpf treatment and the 30 hpf treatment. However, oxt appeared to be reduced after 1 h LiCl treatment at 24 hpf and 30 hpf, but not after 1 h LiCl treatment at 20 hpf, suggesting that LiCl begins to affect oxt around 24 hpf (Fig. 5G,G′,H,H′,I,I′). To test whether a stronger pre-24 hpf LiCl treatment would affect oxt expression, we treated embryos at 18 hpf for 3 h, then performed RT-qPCR. No significant difference in oxt expression was found between embryos treated with LiCl at 18 hpf for 3 h and controls (Fig. 5L). To test whether post-24 h LiCl treatment reduces oxt expression at other treatment stages and durations, we treated 28 hpf embryos for 3.75 h, 31 hpf embryos for 4.5 h, 36 hpf embryos for 12 h, and 41 hpf embryos for 5 h. Using WISH, reductions in oxt expression were detected after LiCl treatment at 31 hpf for 4.5 h and 41 hpf for 5 h (Fig. 5J,J′,K,K′). RT-qPCR revealed decreases in oxt expression for embryos treated with LiCl at 28 hpf for 3.75 h and at 36 hpf for 12 h (Fig. 5L). Together, these results suggest that overactive Wnt signaling suppresses oxt expression starting around 24 hpf. Since oxt is detectable by WISH starting around 36 hpf, overactive Wnt signaling might interfere with the final steps of oxt cell differentiation. Thus, Wnt signaling must be suppressed at the 24 hpf stage to allow for proper oxt cell development, of which expression of oxt is the defining step.

DISCUSSION

Differing mechanisms for Med12 across cellular subtypes

Previous work by Wang et al. demonstrates that forebrain patterning in the med12 mutant is grossly normal, with expression of the pan-neuronal marker HuC largely unperturbed (Wang et al., 2006). Similarly, we find that expression of hypothalamic markers pou3f2, sim1, otp, fezf2, and lhx5 are expressed normally in the preoptic area of med12 mutant embryos. However, cell-type specific gene expression is severely impacted. Our finding that expression of oxt, avp, crh, and trh are undetectable in the med12 mutant contrasts with data showing that pituitary markers are only upregulated or downregulated, and with studies of med12 mutants which indicate that dopaminergic and serotonergic cells are reduced, but not eliminated (Wang et al., 2006; Guo et al., 1999). These differing results across cell types may indicate divergent mechanisms for Med12.

Wang et al. suggest that reductions in forebrain and hindbrain dopaminergic, and hindbrain serotonergic neuron subsets in the med12 mutant are due to loss of expression of the neural determination genes ascl1a and lhx1. Expression of ascl1a and lhx1 are decreased in the med12 mutant and injection of med12 RNA led to increased expression of both transcription factors (Wang et al., 2006). It seems unlikely, however, that loss of ascl1a or lhx1 is responsible for the loss of oxt, avp, crh, and trh that we observed in the med12 mutant, because the ascl1a and lhx1 expression patterns do not appear to overlap with all of the relevant expression domains in the PO, vH, PT and Lc (Thisse and Thisse, 2005). While reductions in dopaminergic and serotonergic neurons may be due to subtle defects in brain patterning or cell fate determination in the med12 mutant, complete loss of oxt, avp, crh and trh expression suggests a more direct role for Med12 and leaves open the possibility that Med12 is required for transcription of these genes. Future work could determine whether loss of Med12 in oxt cells alone is enough to eliminate oxt gene expression, thus elucidating whether the role of Med12 in oxt expression is cell autonomous.

Previous work suggests that the reduction in tyrosine hydroxylase (th) expression in the PT of the med12 mutant is caused by loss of otp expression in the PT (Del Giacco et al., 2006). However, considering that otp is expressed in the PO of the med12 mutant, it does not appear that loss of otp is responsible for its loss of oxt expression. Although crh is expressed in the PT, it is unlikely that loss of otp underlies loss of crh in the med12 mutant because in the med12 mutant, crh expression is lost not only in the PT but in all nuclei (Fig. 2B′). Altogether, loss of otp does not appear to be responsible for the gene expression alterations that we observe in the med12 mutant. Combined, our data highlight the complexity of the role of Med12 in vertebrate development and cell type-specific gene expression.

An in-vivo role for Med12 as an activator of Wnt signaling

The role of Med12 in transcriptional regulation is an active area of investigation in several contexts. Work in yeast suggests that the CDK8 complex, of which MED12 is a part, sterically blocks Mediator interaction with Pol II, thereby acting as a transcriptional repressor (Elmlund et al., 2006). However, a study of acute myeloid leukemia cells found that silencing of MED12 is associated with transcriptional repression (Bhagwat et al., 2016). In zebrafish the only published study on the role of Med12 in Wnt signaling suggests that Med12 is a repressor of Wnt signaling (Lin et al., 2007), although wnt1 and wnt8b genes have been shown to be variously down-regulated in the hindbrain of Med12 mutants (Hong and Dawid, 2011). Here we show that in zebrafish Med12 is epistatic to Apc, a component of the Wnt pathway, and that expression of a Wnt reporter is reduced in the med12 mutant, supporting a role for Med12 as an activator of Wnt signaling in zebrafish. Although our data suggest that reductions in Wnt signaling are not responsible for the loss of oxt expression observed in the med12 mutant, dysregulated Wnt signaling likely contributes to other facets of the med12 mutant phenotype.

Although pituitary marker expression changes in Wnt-inhibited embryos are not consistent with those in the med12 mutant, which is Wnt-inhibited (Fig. S1J), this might be because IWR treatment is expected to affect all Wnt signaling, while Med12 may only be involved in Wnt signaling though Tcf/Lef1. In mouse, β-catenin was found to also interact with the homeodomain factor Prop1, rather than only Tcf/Lefs, to activate transcription of the pituitary lineage-determining factor Pit1 (Olson et al., 2006). Pit1, in turn, is required for lactotropes, thyrotropes, and somatotropes in zebrafish (Herzog et al., 2004). Our results suggest that altered Wnt signaling may reduce specification of some pituitary cell types, thus allowing other cell types to inappropriately expand. Moreover, these data indicate that the role of Wnt signaling in pituitary development is an area ripe for study in the zebrafish model.

Identification of a Wnt-repressive center necessary for oxt expression

We found that oxt expression is not reduced in Wnt-inhibited embryos. In fact, oxt expression appears to be reduced in apc mutants, which have overactive Wnt signaling. Interestingly, in histone deacetylase 1 (hdac1) zebrafish mutants, which also have overactive Wnt signaling, oxt expression is eliminated (Nambiar and Henion, 2004; E.G., unpublished data). Together, these data suggest that Wnt signaling needs to be suppressed for oxt cells to develop properly. Our chemical Wnt activation experiments suggest that Wnt repression is not required until around 24 hpf, suggesting a role in oxt cell differentiation, rather than specification.

Wnt signaling is known to play a role in early induction and patterning of the hypothalamus. Wnt ligands secreted from the posterior neuroectoderm promote hindbrain fate, and are opposed by Wnt antagonists secreted from the anterior neuroectoderm, creating an anterior-posterior gradient of Wnt signaling (Kudoh et al., 2002; Heisenberg et al., 2001; Pearson and Placzek, 2013). Kapsimali et al. identify a role for Wnt inhibition by showing that it is required to promote hypothalamic identity at the expense of floorplate identity as early as the 1-2 somite stage (Kapsimali et al., 2004). However, our data showing that overactive Wnt signaling suppresses oxt expression starting at 24 hpf suggests an effect on the differentiation of progenitor cells into specific neural subtypes, rather than an early effect on acquisition of hypothalamic identity. Our data suggest that overactive Wnt signaling promotes a progenitor-like state, and prevents oxt cells from fully differentiating. One way that overactive Wnt signaling might affect oxt cell development is by altering expression of transcription factors that promote oxt expression. In fact, we found that expression of pou3f2b, which is required for oxt expression, is reduced in the PO of the apc mutant, suggesting that overactive Wnt signaling suppresses pou3f2b expression (Fig. S2A,A′). Moreover, pou3f2b, although expressed regionally in the diencephalon starting around the 7-somite stage, becomes concentrated in the PO between 24 and 36 hpf, which is the same developmental stage in which oxt cells become sensitive to overactive Wnt signaling (Spaniol et al., 1996; Kasher et al., 2016). This suggests that reduced pou3f2b in the apc mutant could underlie its reduced oxt expression phenotype.

Since our data suggest that overactive Wnt signaling interferes with oxt expression, further investigation should explore whether activation of Wnt antagonists in the PO are also required for oxt. Interestingly, lhx5, which was shown to inhibit Wnt signaling up to the 16 somite stage and to rescue forebrain deficiencies caused by ectopic Wnt signaling, is expressed in the PO at 48 hpf (Peng and Westerfield, 2006; Manoli and Driever, 2014). Moreover, Lhx5 is required for oxt signaling in zebrafish (Machluf et al., 2011). However, ascertaining whether the role of lhx5 in oxt cell development is dependent on Wnt inhibition awaits further study.

This study highlights the diverse roles of the Wnt signaling pathway and the transcriptional co-activator Med12 in regulating oxt expression in a vertebrate organism. Together our findings help to elucidate the role of signaling pathways and transcriptional regulators in controlling expression of oxt, the dysregulation of which can contribute to behavioral and appetite-related disorders.

MATERIALS AND METHODS

Animals

Zebrafish (Danio rerio, mixed background) were raised, maintained and crossed as previously described (Westerfield, 1995). Embryos developed at 28°C and were staged according to both hpf and morphological characteristics (Kimmel et al., 1995). All procedures were performed in accordance with NIH guidelines on the care and use of animals and were approved by the Georgetown University Institutional Animal Care and Use Committee, Protocol #100517.

Genotyping

The apchu745 and med12y82 mutations were genotyped either by heterozygote in-crosses or by using a custom-designed TaqMan SNP genotyping assay (Applied Biosystems, Foster, USA). The following sequences were submitted for primer design:

apchu745:GCCAGTAACTACCCAACTTTACCTATATCAGAAAAACAATCCACTAATAATGTTGCAGCTGAC[C/T]AACGCACATCTGAGAGCCAATCATCAGTCCATTATGTTCGCGCCAAGCCTCCACGACATCATTTAG

ktoy82: TCAGGATACTGGTATGTCCGAGTCGATGGAGATAGATCACAACTCAAGCGCTAACTTTGATGAG[G/A]TTGGTAAGAGGGTATTTTGTGTTAGTGATGTTTAACATAAGGCTGTATATAATCG

Genotyping reactions containing TaqMan Genotyping Master Mix (Applied Biosystems) were prepared according to the manufacturer's protocol and analyzed using the Applied Biosystems 7900HT Fast Real-Time PCR System.

Drug treatments

For all drug treatments, embryos were collected from pair-wise or group mating, debris and unfertilized eggs were removed, and embryos were incubated in a 96-well plate containing 100 µl of drug solution. IWR solutions were prepared by dissolving 5 mg of IWR (Sigma-Aldrich) in 1.22 ml DMSO (Sigma-Aldrich) and then diluting this solution in fish water (0.3 g/l Instant Ocean Sea Salt, Pentair, Apopka, USA) with or without 30 mg/l phenylthiourea (Sigma-Aldrich). Embryos were incubated at a final concentration of 10 µM of IWR or vehicle solution starting at 4 hpf until fixation or RNA isolation. LiCl solutions were prepared by diluting LiCl (Sigma-Aldrich) in fish water with or without 30 mg/l phenylthiourea (Sigma-Aldrich). Embryos were incubated in a 0.3 M solution of LiCl or fish water at various time points.

Whole-mount in-situ hybridization (WISH)

This study assessed expression of oxt, sim1, pou3f2, otp, avp, trh, crh, tsh, prl, fezf2, lhx5, myt1l, and lef1 using WISH. WISH procedures were performed as previously described (Eaton and Glasgow, 2006). WISH was repeated at least two times using eight to 12 embryos per group. Control and experimental groups were processed in the same reaction, marking the sibling controls by cutting their tails. Synthesis of oxt, sim1, pou3f2, otp, avp, lhx5, myt1la, and lef1 riboprobes have been described previously (Unger and Glasgow, 2003; Eaton and Glasgow, 2006, 2007; Kasher et al., 2016; Toyama et al., 1995; Eaton et al., 2008; Blanchet et al., 2017; Dorsky et al., 1999). The trh and crh probes were generated by PCR using F1 and T7 primers; forward and reverse primers were designed and purchased (Sigma-Aldrich) with the below sequences:

TRH_F1: 5′ CGAAGCGACAGTTCAAAGCC

TRH_R1-T7: 5′ TAATACGACTCACTATAGGGGCAAAAGTGCGAGATCCGTG

CRH_F1: 5′ TACGCACAGATTCTCCTCGC

CRH_R1-T7: 5′ TAATACGACTCACTATAGGGCTGATGGGTTCGCTTGTGGTT

Embryo cDNA was synthesized by reverse transcription from 2 dpf embryo RNA as per protocol for oligo dT20 primed Superscript kit (Invitrogen). PCR reactions [1 µl cDNA; 0.4 µM TRH-F1 or CRH_F1; 0.4 µM TRH-R1-T7 OR CRH-R1-T7; 1× PCR mix (Thermo Fisher Scientific)] were amplified using the following parameters for TRH: 94, 2 min; 15 cycles of 94, 30 s; 62, 10 s; 72, 1 min; 72, 10 min; 4, hold and for CRH: 94, 2 min; 30 cycles of 94, 30 s; 60, 30 s; 68, 30 s; 68, 10 min; 4, hold. Amplified product was purified using QIAquick PCR purification kit as per the manufacturer's instructions, followed by ethanol precipitation and resuspension in dH2O for subsequent DIG-labeled in vitro transcription (Roche, Basel, Switzerland). The tsh and prl riboprobes were synthesized from cDNA that has been described previously (Herzog et al., 2003). tsh was linearized with HindIII and prl with Kpn1. Both were ethanol precipitated and re-suspended in dH2O for DIG labeled in vitro transcription. The fezf2 clone from Musahiko Hibii, Riken Center, Kobe, Japan, was subcloned into Bluesript II SK- (Stratagene, La Jolla, USA). Antisense riboprobe was made by linearizing the plasmid with SalI and performing DIG-labeled in vitro transcription with T3 RNA polymerase.

RNA isolation and real time quantitative RT-qPCR

RNA was isolated from groups of 50 embryos using TRIzol Reagent (Invitrogen) and the Direct-zol RNA MiniPrep kit (Zymo Research, Irvine, USA). 1 µg RNA was then reverse transcribed using SensiFAST cDNA Synthesis kit (Bioline, Boston, USA). Reactions containing Fast SYBR Green master mix (Applied Biosystems), cDNA, and primers were amplified using an Applied Biosystems StepOnePlus PCR machine according to the manufacturer's protocol. The following primers were used:

TSHBA_F1 5′- CTGTCAACACCACCATCTGC

TSHBA_R1 5′- GTGCATCCCCTCTGAACAAT

PRL_F1 5′- ACATCAACAGTCTGGGAGCA

PRL_R1 5′- AAGACGAGCCCATCTTGTGT

OXT_F1 5′- GGTGTCAGCCTTGGTGAATAAT

OXT_R1 5′- GTTTGAGATGTAGCAGGCCG

Relative Quantitation was analyzed in RQ Manager 2.3 software using the Comparative CT method.

Microscopy

To obtain images of WISH staining, each embryo was mounted under a coverslip in a 1.5% agarose, 70% glycerol solution. For lateral views, eyes were removed from embryos prior to mounting. Images were acquired using a Zeiss Axioplan2 microscope fitted with an AxioCam camera using AxioVision software. To obtain images of transgenic embryos, live embryos were arranged on a slide in a 3% solution of methyl cellulose, and images were acquired using an Olympus IX-71 inverted microscope. Fluorescence and area measurements were made using Fiji (Schindelin et al., 2012).

Statistics

Two-tailed unpaired Student's t-tests were used to analyze tail curvature and melanophore counts in wild-type and mutant embryos. A Chi-square Goodness-of-Fit test was performed to analyze the result of the apchu745/+, med12y82/+ in-cross. For RT-qPCR, ΔCt values were used for statistical analysis, and analyzed by two-tailed paired t-tests.

Supplementary Material

Supplementary information

Acknowledgements

We thank Dr Masha Reider for providing riboprobes, Dr Sung-Kook Hong and Dr Igor Dawid for zebrafish mutant lines, Dr Matthew Swift for molecular biology guidance, Eileen Cahill for assistance with LiCl treatments, and the Georgetown Lombardi Animal Model Shared Resource for zebrafish.

Footnotes

Competing interests

The authors declare no competing or financial interests.

Author contributions

Conceptualization: E.D.S., E.G.; Methodology: E.D.S., E.G.; Validation: E.D.S., E.G.; Formal analysis: E.D.S.; Investigation: E.D.S., E.G.; Resources: E.G.; Writing - original draft: E.D.S.; Writing - review & editing: E.D.S., E.G.; Visualization: E.D.S.; Supervision: E.G.; Project administration: E.G.; Funding acquisition: E.G.

Funding

This work was supported in part by a grant from the National Cancer Institute (P30 CA51008) and by the Georgetown University HHMI Program.

Supplementary information

Supplementary information available online at http://bio.biologists.org/lookup/doi/10.1242/bio.031229.supplemental

References

  1. Acampora D., Postiglione M. P., Avantaggiato V., Di Bonito M., Vaccarino F. M., Michaud J. and Simeone A. (1999). Progressive impairment of developing neuroendocrine cell lineages in the hypothalamus of mice lacking the Orthopedia gene. Genes Dev. 13, 2787-2800. 10.1101/gad.13.21.2787 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Berberoglu M. A., Dong Z., Mueller T. and Guo S. (2009). fezf2 expression delineates cells with proliferative potential and expressing markers of neural stem cells in the adult zebrafish brain. Gene Expr. Patterns 9, 411-422. 10.1016/j.gep.2009.06.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bhagwat A. S., Roe J. S., Mok B. Y., Hohmann A. F., Shi J. and Vakoc C. R. (2016). BET bromodomain inhibition releases the mediator complex from select cis-regulatory elements. Cell Rep. 15, 519-530. 10.1016/j.celrep.2016.03.054 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Biran J., Tahor M., Wircer E. and Levkowitz G. (2015). Role of developmental factors in hypothalamic function. Front. Neuroanat. 9, 47 10.3389/fnana.2015.00047 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Blanchet P., Bebin M., Bruet S., Cooper G. M., Thompson M. L., Duban-Bedu B., Gerard B., Piton A., Suckno S., Deshpande C. et al. (2017). MYT1L mutations cause intellectual disability and variable obesity by dysregulating gene expression and development of the neuroendocrine hypothalamus. PLoS Genet. 13, e1006957 10.1371/journal.pgen.1006957 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Blechman J., Borodovsky N., Eisenberg M., Nabel-Rosen H., Grimm J. and Levkowitz G. (2007). Specification of hypothalamic neurons by dual regulation of the homeodomain protein Orthopedia. Development 134, 4417-4426. 10.1242/dev.011262 [DOI] [PubMed] [Google Scholar]
  7. Borodovsky N., Ponomaryov T., Frenkel S. and Levkowitz G. (2009). Neural protein Olig2 acts upstream of the transcriptional regulator Sim1 to specify diencephalic dopaminergic neurons. Dev. Dyn. 238, 826-834. 10.1002/dvdy.21894 [DOI] [PubMed] [Google Scholar]
  8. Carrera I., Janody F., Leeds N., Duveau F. and Treisman J. E. (2008). Pygopus activates Wingless target gene transcription through the mediator complex subunits Med12 and Med13. Proc. Natl. Acad. Sci. USA 105, 6644-6649. 10.1073/pnas.0709749105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Coffey C. M., Solleveld P. A., Fang J., Roberts A. K., Hong S.-K., Dawid I. B., Laverriere C. E. and Glasgow E. (2013). Novel oxytocin gene expression in the hindbrain is induced by alcohol exposure: transgenic zebrafish enable visualization of sensitive neurons. PLoS ONE 8, e53991 10.1371/journal.pone.0053991 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Del Giacco L., Sordino P., Pistocchi A., Andreakis N., Tarallo R., Di Benedetto B. and Cotelli F. (2006). Differential regulation of the zebrafish orthopedia 1 gene during fate determination of diencephalic neurons. BMC Dev. Biol. 6, 50 10.1186/1471-213X-6-50 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Delisi L. E., Smith A. B., Razi K., Stewart J., Wang Z., Sandhu H. K. and Philibert R. A. (2000). Investigation of a candidate gene for schizophrenia on Xq13 previously associated with mental retardation and hypothyroidism. Am. J. Med. Genet. 96, 398-403. [DOI] [PubMed] [Google Scholar]
  12. Dodge M. E., Moon J., Tuladhar R., Lu J., Jacob L. S., Zhang L.-S., Shi H., Wang X., Moro E., Mongera A. et al. (2012). Diverse chemical scaffolds support direct inhibition of the membrane-bound o-acyltransferase porcupine. J. Biol. Chem. 287, 23246-23254. 10.1074/jbc.M112.372029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Dorsky R. I., Snyder A., Cretekos C. J., Grunwald D. J., Geisler R., Haffter P., Moon R. T. and Raible D. W. (1999). Maternal and embryonic expression of zebrafish lef1. Mech. Dev. 86, 147-150. 10.1016/S0925-4773(99)00101-X [DOI] [PubMed] [Google Scholar]
  14. Dorsky R. I., Sheldahl L. C. and Moon R. T. (2002). A transgenic Lef1/beta-catenin-dependent reporter is expressed in spatially restricted domains throughout zebrafish development. Dev. Biol. 241, 229-237. 10.1006/dbio.2001.0515 [DOI] [PubMed] [Google Scholar]
  15. Eaton J. L. and Glasgow E. (2006). The zebrafish bHLH PAS transcriptional regulator, single-minded 1 (sim1), is required for isotocin cell development. Dev. Dyn. 235, 2071-2082. 10.1002/dvdy.20848 [DOI] [PubMed] [Google Scholar]
  16. Eaton J. L. and Glasgow E. (2007). Zebrafish orthopedia (otp) is required for isotocin cell development. Dev. Genes Evol. 217, 149-158. 10.1007/s00427-006-0123-2 [DOI] [PubMed] [Google Scholar]
  17. Eaton J. L., Holmqvist B. and Glasgow E. (2008). Ontogeny of vasotocin-expressing cells in zebrafish: selective requirement for the transcriptional regulators orthopedia and single-minded 1 in the preoptic area. Dev. Dyn. 237, 995-1005. 10.1002/dvdy.21503 [DOI] [PubMed] [Google Scholar]
  18. Ebstein R. P., Knafo A., Mankuta D., Chew S. H. and Lai P. S. (2012). The contributions of oxytocin and vasopressin pathway genes to human behavior. Horm. Behav. 61, 359-379. 10.1016/j.yhbeh.2011.12.014 [DOI] [PubMed] [Google Scholar]
  19. Elmlund H., Baraznenok V., Lindahl M., Samuelsen C. O., Koeck P. J. B., Holmberg S., Hebert H. and Gustafsson C. M. (2006). The cyclin-dependent kinase 8 module sterically blocks Mediator interactions with RNA polymerase II. Proc. Natl. Acad. Sci. USA 103, 15788-15793. 10.1073/pnas.0607483103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Fernandes A. M., Beddows E., Filippi A. and Driever W. (2013). Orthopedia transcription factor otpa and otpb paralogous genes function during dopaminergic and neuroendocrine cell specification in larval zebrafish. PLoS ONE 8, e75002 10.1371/journal.pone.0075002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Guo S., Wilson S. W., Cooke S., Chitnis A. B., Driever W. and Rosenthal A. (1999). Mutations in the zebrafish unmask shared regulatory pathways controlling the development of catecholaminergic neurons. Dev. Biol. 208, 473-487. 10.1006/dbio.1999.9204 [DOI] [PubMed] [Google Scholar]
  22. Heisenberg C.-P., Houart C., Take-Uchi M., Rauch G. J., Young N., Coutinho P., Masai I., Caneparo L., Concha M. L., Geisler R. et al. (2001). A mutation in the Gsk3-binding domain of zebrafish Masterblind/Axin1 leads to a fate transformation of telencephalon and eyes to diencephalon. Genes Dev. 15, 1427-1434. 10.1101/gad.194301 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Herget U., Wolf A., Wullimann M. F. and Ryu S. (2014). Molecular neuroanatomy and chemoarchitecture of the neurosecretory preoptic-hypothalamic area in zebrafish larvae. J. Comp. Neurol. 522, 1542-1564. 10.1002/cne.23480 [DOI] [PubMed] [Google Scholar]
  24. Herget U., Gutierrez-Triana J. A., Salazar Thula O., Knerr B. and Ryu S. (2017). Single-cell reconstruction of oxytocinergic neurons reveals separate hypophysiotropic and encephalotropic subtypes in larval zebrafish. eNeuro 4 10.1523/ENEURO.0278-16.2016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Herzog W., Zeng X., Lele Z., Sonntag C., Ting J.-W., Chang C.-Y. and Hammerschmidt M. (2003). Adenohypophysis formation in the zebrafish and its dependence on sonic hedgehog. Dev. Biol. 254, 36-49. 10.1016/S0012-1606(02)00124-0 [DOI] [PubMed] [Google Scholar]
  26. Herzog W., Sonntag C., Walderich B., Odenthal J., Maischein H. M. and Hammerschmidt M. (2004). Genetic analysis of adenohypophysis formation in zebrafish. Mol. Endocrinol. 18, 1185-1195. 10.1210/me.2003-0376 [DOI] [PubMed] [Google Scholar]
  27. Hong S.-K. and Dawid I. B. (2011). The transcriptional mediator component Med12 is required for hindbrain boundary formation. PLoS ONE 6, e19076-e19076 10.1371/journal.pone.0019076 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Hong S.-K., Haidin C. E., Lawson N. D., Weinstein B. M., Dawid I. B. and Hukriede N. A. (2005). The zebrafish kohtalo/trap230 gene is required for the development of the brain, neural crest, and pronephric kidney. Proc. Natl. Acad. Sci. USA 102, 18473-18478. 10.1073/pnas.0509457102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Hurlstone A. F. L., Haramis A.-P. G., Wienholds E., Begthel H., Korving J., van Eeden F., Cuppen E., Zivkovic D., Plasterk R. H. A. and Clevers H. (2003). The Wnt/beta-catenin pathway regulates cardiac valve formation. Nature 425, 633-637. 10.1038/nature02028 [DOI] [PubMed] [Google Scholar]
  30. Izumi K., Housam R., Kapadia C., Stallings V. A., Medne L., Shaikh T. H., Kublaoui B. M., Zackai E. H. and Grimberg A. (2013). Endocrine phenotype of 6q16.1-q21 deletion involving SIM1 and Prader-Willi syndrome-like features. Am. J. Med. Genet. A 161A, 3137-3143. 10.1002/ajmg.a.36149 [DOI] [PubMed] [Google Scholar]
  31. Kapsimali M., Caneparo L., Houart C. and Wilson S. W. (2004). Inhibition of Wnt/Axin/beta-catenin pathway activity promotes ventral CNS midline tissue to adopt hypothalamic rather than floorplate identity. Development 131, 5923-5933. 10.1242/dev.01453 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Kasher P. R., Schertz K. E., Thomas M., Jackson A., Annunziata S., Ballesta-Martinez M. J., Campeau P. M., Clayton P. E., Eaton J. L., Granata T. et al. (2016). Small 6q16.1 deletions encompassing POU3F2 cause susceptibility to obesity and variable developmental delay with intellectual disability. Am. J. Hum. Genet. 98, 363-372. 10.1016/j.ajhg.2015.12.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Kawakami Y., Rodriguez Esteban C., Raya M., Kawakami H., Marti M., Dubova I. and Izpisua Belmonte J. C. (2006). Wnt/beta-catenin signaling regulates vertebrate limb regeneration. Genes Dev. 20, 3232-3237. 10.1101/gad.1475106 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Kim S., Xu X., Hecht A. and Boyer T. G. (2006). Mediator is a transducer of Wnt/beta-catenin signaling. J. Biol. Chem. 281, 14066-14075. 10.1074/jbc.M602696200 [DOI] [PubMed] [Google Scholar]
  35. Kimmel C. B., Ballard W. W., Kimmel S. R., Ullmann B. and Schilling T. F. (1995). Stages of Embryonic-Development of the Zebrafish. Dev. Dyn. 203, 253-310. 10.1002/aja.1002030302 [DOI] [PubMed] [Google Scholar]
  36. Kudoh T., Wilson S. W. and Dawid I. B. (2002). Distinct roles for Fgf, Wnt and retinoic acid in posteriorizing the neural ectoderm. Development 129, 4335-4346. [DOI] [PubMed] [Google Scholar]
  37. Kumsta R. and Heinrichs M. (2013). Oxytocin, stress and social behavior: neurogenetics of the human oxytocin system. Curr. Opin. Neurobiol. 23, 11-16. 10.1016/j.conb.2012.09.004 [DOI] [PubMed] [Google Scholar]
  38. Lee J. E., Wu S. F., Goering L. M. and Dorsky R. I. (2006). Canonical Wnt signaling through Lef1 is required for hypothalamic neurogenesis. Development 133, 4451-4461. 10.1242/dev.02613 [DOI] [PubMed] [Google Scholar]
  39. Lin X., Rinaldo L., Fazly A. F. and Xu X. (2007). Depletion of Med10 enhances Wnt and suppresses Nodal signaling during zebrafish embryogenesis. Dev. Biol. 303, 536-548. 10.1016/j.ydbio.2006.11.034 [DOI] [PubMed] [Google Scholar]
  40. Löhr H. and Hammerschmidt M. (2011). Zebrafish in endocrine systems: recent advances and implications for human disease. Annu. Rev. Physiol. 73, 183-211. 10.1146/annurev-physiol-012110-142320 [DOI] [PubMed] [Google Scholar]
  41. Löhr H., Ryu S. and Driever W. (2009). Zebrafish diencephalic A11-related dopaminergic neurons share a conserved transcriptional network with neuroendocrine cell lineages. Development 136, 1007-1017. 10.1242/dev.033878 [DOI] [PubMed] [Google Scholar]
  42. Machluf Y., Gutnick A. and Levkowitz G. (2011). Development of the zebrafish hypothalamus. Ann. N. Y. Acad. Sci. 1220, 93-105. 10.1111/j.1749-6632.2010.05945.x [DOI] [PubMed] [Google Scholar]
  43. Malik S. and Roeder R. G. (2010). The metazoan Mediator co-activator complex as an integrative hub for transcriptional regulation. Nat. Rev. Genet. 11, 761-772. 10.1038/nrg2901 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Manoli M. and Driever W. (2014). nkx2.1 and nkx2.4 genes function partially redundant during development of the zebrafish hypothalamus, preoptic region, and pallidum. Front. Neuroanat. 8, 145 10.3389/fnana.2014.00145 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Mcquaid R. J., Mcinnis O. A., Abizaid A. and Anisman H. (2014). Making room for oxytocin in understanding depression. Neurosci. Biobehav. Rev. 45, 305-322. 10.1016/j.neubiorev.2014.07.005 [DOI] [PubMed] [Google Scholar]
  46. Michaud J. L., Rosenquist T., May N. R. and Fan C.-M. (1998). Development of neuroendocrine lineages requires the bHLH-PAS transcription factor SIM1. Genes Dev. 12, 3264-3275. 10.1101/gad.12.20.3264 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Nakai S., Kawano H., Yudate T., Nishi M., Kuno J., Nagata A., Jishage K., Hamada H., Fuj H. II and Kawamura K. (1995). The POU domain transcription factor Brn-2 is required for the determination of specific neuronal lineages in the hypothalamus of the mouse. Genes Dev. 9, 3109-3121. 10.1101/gad.9.24.3109 [DOI] [PubMed] [Google Scholar]
  48. Nambiar R. M. and Henion P. D. (2004). Sequential antagonism of early and late Wnt-signaling by zebrafish colgate promotes dorsal and anterior fates. Dev. Biol. 267, 165-180. 10.1016/j.ydbio.2003.11.019 [DOI] [PubMed] [Google Scholar]
  49. Olson L. E., Tollkuhn J., Scafoglio C., Krones A., Zhang J., Ohgi K. A., Wu W., Taketo M. M., Kemler R., Grosschedl R. et al. (2006). Homeodomain-mediated beta-catenin-dependent switching events dictate cell-lineage determination. Cell 125, 593-605. 10.1016/j.cell.2006.02.046 [DOI] [PubMed] [Google Scholar]
  50. Pearson C. A. and Placzek M. (2013). Development of the medial hypothalamus: forming a functional hypothalamic-neurohypophyseal interface. Curr. Top. Dev. Biol. 106, 49-88. 10.1016/B978-0-12-416021-7.00002-X [DOI] [PubMed] [Google Scholar]
  51. Peng G. and Westerfield M. (2006). Lhx5 promotes forebrain development and activates transcription of secreted Wnt antagonists. Development 133, 3191-3200. 10.1242/dev.02485 [DOI] [PubMed] [Google Scholar]
  52. Pogoda H. M. and Hammerschmidt M. (2009). How to make a teleost adenohypophysis: molecular pathways of pituitary development in zebrafish. Mol. Cell. Endocrinol. 312, 2-13. 10.1016/j.mce.2009.03.012 [DOI] [PubMed] [Google Scholar]
  53. Risheg H., Graham J. M., Clark J. R., Rogers R. D., Opitz R. C., Moeschler J. M., Peiffer J. B., May A. P., Joseph M., Jones S. M. J.R., et al. (2007). A recurrent mutation in MED12 leading to R961W causes Opitz-Kaveggia syndrome. Nat. Genet. 39, 451-453. 10.1038/ng1992 [DOI] [PubMed] [Google Scholar]
  54. Robertson J. K., Danzmann K., Charles S., Blake K., Olivares A., Bamikole S., Olson M. and Van Raay T. J. (2014). Targeting the Wnt pathway in zebrafish as a screening method to identify novel therapeutic compounds. Exp. Biol. Med. (Maywood) 239, 169-176. 10.1177/1535370213514322 [DOI] [PubMed] [Google Scholar]
  55. Rocha P. P., Scholze M., Bleiss W. and Schrewe H. (2010). Med12 is essential for early mouse development and for canonical Wnt and Wnt/PCP signaling. Development 137, 2723-2731. 10.1242/dev.053660 [DOI] [PubMed] [Google Scholar]
  56. Russek-Blum N., Gutnick A., Nabel-Rosen H., Blechman J., Staudt N., Dorsky R. I., Houart C. and Levkowitz G. (2008). Dopaminergic neuronal cluster size is determined during early forebrain patterning. Development 135, 3401-3413. 10.1242/dev.024232 [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Sabatier N., Leng G. and Menzies J. (2013). Oxytocin, feeding, and satiety. Front. Endocrinol. (Lausanne) 4, 35 10.3389/fendo.2013.00035 [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Schindelin J., Arganda-Carreras I., Frise E. et al. (2012). Fiji: an open-source platform for biological-image analysis. Nature Methods 9, 676-682. 10.1038/nmeth.2019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Schonemann M. D., Ryan A. K., Mcevilly R. J., O'connell S. M., Arias C. A., Kalla K. A., Li P., Sawchenko P. E. and Rosenfeld M. G. (1995). Development and survival of the endocrine hypothalamus and posterior pituitary gland requires the neuronal POU domain factor Brn-2. Genes Dev. 9, 3122-3135. 10.1101/gad.9.24.3122 [DOI] [PubMed] [Google Scholar]
  60. Schwartz C. E., Tarpey P. S., Lubs H. A., Verloes A., May M. M., Risheg H., Friez M. J., Futreal P. A., Edkins S., Teague J. et al. (2007). The original Lujan syndrome family has a novel missense mutation (p.N1007S) in the MED12 gene. J. Med. Genet. 44, 472-477. 10.1136/jmg.2006.048637 [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Spaniol P., Bornmann C., Hauptmann G. and Gerster T. (1996). Class III POU genes of zebrafish are predominantly expressed in the central nervous system. Nucleic Acids Res. 24, 4874-4881. 10.1093/nar/24.24.4874 [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Spikol E. D., Laverriere C. E., Robnett M., Carter G., Wolfe E. and Glasgow E. (2016). Zebrafish models of prader-willi syndrome: fast track to pharmacotherapeutics. Diseases 4, 13 10.3390/diseases4010013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Thisse C. and Thisse B. (2005). High Throughput Expression Analysis of ZF-Models Consortium Clones. ZFIN Direct Data Submission (http://zfin.org).
  64. Toyama R., Curtiss P. E., Otani H., Kimura M., Dawid I. B. and Taira M. (1995). The LIM class homeobox gene lim5: implied role in CNS patterning in Xenopus and zebrafish. Dev. Biol. 170, 583-593. 10.1006/dbio.1995.1238 [DOI] [PubMed] [Google Scholar]
  65. Unger J. L. and Glasgow E. (2003). Expression of isotocin-neurophysin mRNA in developing zebrafish. Gene Expr. Patterns 3, 105-108. 10.1016/S1567-133X(02)00064-9 [DOI] [PubMed] [Google Scholar]
  66. Wang W. and Lufkin T. (2000). The murine Otp homeobox gene plays an essential role in the specification of neuronal cell lineages in the developing hypothalamus. Dev. Biol. 227, 432-449. 10.1006/dbio.2000.9902 [DOI] [PubMed] [Google Scholar]
  67. Wang X., Yang N., Uno E., Roeder R. G. and Guo S. (2006). A subunit of the mediator complex regulates vertebrate neuronal development. Proc. Natl. Acad. Sci. USA 103, 17284-17289. 10.1073/pnas.0605414103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Westerfield M. (1995). The Zebrafish Book, Eugene. Oregon: University of Oregon Press. [Google Scholar]
  69. Wu S., Jia M., Ruan Y., Liu J., Guo Y., Shuang M., Gong X., Zhang Y., Yang X. and Zhang D. (2005). Positive association of the oxytocin receptor gene (OXTR) with autism in the Chinese Han population. Biol. Psychiatry 58, 74-77. 10.1016/j.biopsych.2005.03.013 [DOI] [PubMed] [Google Scholar]
  70. Wu S.-Y., De Borsetti N. H., Bain E. J., Bulow C. R. and Gamse J. T. (2014). Mediator subunit 12 coordinates intrinsic and extrinsic control of epithalamic development. Dev. Biol. 385, 13-22. 10.1016/j.ydbio.2013.10.023 [DOI] [PubMed] [Google Scholar]
  71. Xie Y. and Dorsky R. I. (2017). Development of the hypothalamus: conservation, modification and innovation. Development 144, 1588-1599. 10.1242/dev.139055 [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Yoda A., Kouike H., Okano H. and Sawa H. (2005). Components of the transcriptional Mediator complex are required for asymmetric cell division in C-elegans. Development 132, 1885-1893. 10.1242/dev.01776 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary information

Articles from Biology Open are provided here courtesy of Company of Biologists

RESOURCES