Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (mouse) | B6/J mice | RRID: IMSR_JAX:000664 | bred in the animal facility of the MPIem Goettingen | |
| Strain (mouse) | Piezo2GFP | kind gift of Ardem Patapoutian | bred in the animal facility of the MPIem Goettingen | |
| Cell line (human) | HEK293 | purchased from ATCC | RRID: CVCL_0045 | Cells were not tested for mycoplasma contamination; cells were authenticated by ATCC upon purchase |
| Antibody | Rabbit anti-Mtmr2 (1:100) | Biotechne, #NBP1-33724 | RRID: AB_2147841 | |
| Chicken anti-GFP (1:500) | Thermo Fisher Scientific, #A10262 | RRID: AB_2534023 | ||
| Rabbit anti-GST (1:500) | Santa Cruz, #sc-459 | |||
| Mouse anti-myc (1:750, 1:500) | Santa Cruz, #sc-47694 | RRID: AB_627266 | ||
| Mouse anti-FLAG (1:100) | Sigma Aldrich, #F1804 | RRID: AB_262044 | ||
| Rabbit anti-Piezo2 (1:200) | Novus Biologicals, #NBP1-78624 | RRID: AB_11005294 | ||
| Recombinant DNA reagent | pCMVSport6 Piezo2-GST IRES GFP | kind gift of Ardem Patapoutian | mouse Piezo2 | |
| pCMV6-Entry Mtmr2-myc-DDK | Origene, #MR215223 | mouse Mtmr2 | ||
| Mtmr2C417S-myc-DDK | mouse Mtmr2 C417S | Mutation generated using Q5 Site-Directed Mutagenesis kit (New England BioLabs) | ||
| pCMV Sport6 Piezo1-753-myc-IRES GFP | kind gift of Ardem Patapoutian | mouse Piezo1 | Myc tag was inserted at amino acid 753 as described inCoste et al., 2015. | |
| pGEM-Teasy Kv1.1-HA | mouse Kv1.1 | Custom-made and sequence-verified | ||
| pCMVSport6 | kind gift of ArdemPatapoutian | |||
| pCDNA3.1-myc-His | Invitrogen, #V80020 | |||
| pCNDA3-GST | kind gift of Ardem Patapoutian | |||
| pCMVSport6 Piezo2 P1 mutant-GST IRES GFP | mouse Piezo2 P1 mutant | Mutation generated using Q5 Site-Directed Mutagenesis kit (New England BioLabs) | ||
| pCDNA3.1-myc-His TRPA1 | kind gift of Ardem Patapoutian | mouse TRPA1 | ||
| pCMV6-Vti1b-myc-DDK | Origene | |||
| Sequence-based reagent | Mtmr2 forward primer for qPCR | MPIem DNA Core Facility | TGTACCCCACCATTGAAGAAA | |
| Mtmr2 reverse primer for qPCR | MPIem DNA Core Facility | TAAGAGCCCCTGCAAGAATG | ||
| Piezo2 forward primer for qPCR | MPIem DNA Core Facility | AGGCAGCACATAGGATGGAT | ||
| Piezo2 reverse primer for qPCR | MPIem DNA Core Facility | GCAGGGTCGCTTCAGTGTA | ||
| Actb forward primer for qPCR | MPIem DNA Core Facility | GATCAAGATCATTGCTCCTCCTG | ||
| Actb reverse primer for qPCR | MPIem DNA Core Facility | CAGCTCAGTAACAGTCCGCC | ||
| Gapdh forward primer for qPCR | MPIem DNA Core Facility | CAATGAATACGGCTACAGCAAC | ||
| Gapdh reverse primer for qPCR | MPIem DNA Core Facility | TTACTCCTTGGAGGCCATGT | ||
| Piezo2 mutagenesis forward primer | MPIem DNA Core Facility | GTCTTCTGGTGGCTCGTGGTCATTTATACCATGTTGG | ||
| Piezo2 mutagenesis reverse primer | MPIem DNA Core Facility | ACGCAGCAGCTTCCTCCACCACTCGTAGTGCAC | ||
| Mtmr2 mutagenesis forward primer | MPIem DNA Core Facility | GTGGTACACTCCAGTGATGGATG | ||
| Mtmr2mutagenesis reverse primer | MPIem DNA Core Facility | CACAGACGTCTTCCCAGA | ||
| Peptide, recombinant protein | Piezo2-FLAG tagged | Custom-made by GenScript | EWWRKILKYFWMSVVIDYKDDDDKQNN | |
| Piezo2 3Q-FLAG tagged | Custom-made by GenScript | EWWQQILQYFWMSVVIDYKDDDDKQNN | ||
| Piezo1-FLAG tagged | Custom-made by GenScript | TLWRKLLRVFWWLVDYKDDDDKQNN | ||
| Chemical compound, drug | Wortmannin | Sigma Aldrich | ||
| Apilimod | Bertin Pharma | |||
| PI(3,5)P2 | Echelon | |||
| PI(3)P | Echelon | |||
| Software, algorithm | Fitmaster | HEKA Electronik GmbH | ||
| Patchmaster | HEKA Electronik GmbH | |||
| ImageJ | NIH (Schindelin et al., 2015) | RRID: SCR_003070 | ||
| GraphPad Prism 6.01 | GraphPad Software | RRID: SCR_015807 |