The human transcript induced in spermatogenesis 50

Abstract

Background and Aims: Recently, a number of genes that are expressed specifically in the testis have been identified in rat and mouse. In 2002, 80 transcript induced in spermatogenesis (Tisp) genes with this specific expression were isolated in mice. In the human, however, the number of such genes isolated is much lower. The aim of this study therefore was the isolation of human genes specifically expressed in testis.

Methods: We searched for human genome region with homology to the mouse Tisp gene family at the amino acid level using GenBank. The primers were made in human homologous regions, and polymerase chain reaction analysis was performed with templates using cDNA libraries of a range of human tissues. The cDNA specifically expressed in testis were isolated and detailed expression analysis was performed.

Results: The 28 human TISP related genes were analyzed. Five of these genes were not expressed in testis and only three, TISP50, TISP15 and TISP43 related gene, were expressed specifically in testis. The cDNA of these three genes were isolated.

Conclusion: Expression analysis demonstrated that there is some discrepancy between human and mouse for the TISP gene family. From expression patterns and amino acid sequences, it is suggested that the human TISP50, TISP15 and TISP43 related genes play some critical roles in spermatogenesis. (Reprod Med Biol 2004; 3: 237 – 243)

INTRODUCTION

SPERMATOGENESIS IS THE process whereby male germ cells mature and undergo precisely timed structural and functional changes. It can be divided into three main stages. First, after many rounds of mitotic division, the spermatogonia enter meiosis and generate the primary spermatocytes; second, the primary spermatocytes undergo two consecutive meiotic divisions and produce four round spermatids; and finally, spermiogenesis, which consists of a series of complex morphogenetic events, occurs. ¹ , ² Spermatogenesis in testis is an excellent model system with which to study regulation of gene expression during cell differentiation. Previously, more than 100 cDNA fragments, which include several novel as well as previously identified genes with developmentally up‐regulated expression in rat testis, were cloned using differential display method. ³ , ⁴ In a previous study, the 25 genes that are expressed in only male germ cells were identified by a systematic search for genes expressed in mouse spermatogonia but not in somatic tissues. ⁵ In addition, 153 cDNA fragments whose expression is dramatically up‐regulated during mouse spermatogenesis, were isolated in 2002. ¹ This last work was carried out using a novel variation of the subtractive hybridization technique, called stepwise subtraction, in which the subtraction process is systematically repeated in a stepwise manner. The isolated fragments produced were named transcript induced in spermiogenesis (TISP) genes. The transcription of 80 of these TISP genes is shown to be almost completely specific to the mouse testis by Northern blot hybridization. DNA sequence analysis revealed that approximately half the TISP genes were novel and uncharacterized genes. However, while numerous genes associated with spermatogenesis are known in mice, the application of this information to the human has been slow. ⁶ Previously, we isolated several human genes, synaptonemal complex protein 3 (SYCP3), ribonuclease inhibitor 2 (RNH2), stimulated by retinoic acid gene 8 (STRA8), spermatogenic cell‐specific gene‐1 (SPERGEN‐1) and OPPO1, that are specifically expressed in the testis. ⁷ , ⁸ , ⁹ , ¹⁰ , ¹¹ It was shown that the mutation of the human SYCP3 gene, in particular, causes human azoospermia by meiotic arrest. ⁷ It is also known that the mutations of the human DAZ (deleted in azoospermia), RBMY (for RNA‐binding motif gene, Y chromosome) and USP9Y (also known as DFFRY) genes cause human azoospermia. ¹² , ¹³ , ¹⁴

Previous studies have reported the cases of male infertility related to genetic syndromes associated with chromosomal abnormalities. In contrast, there are relatively few reports of specific gene defects resulting in disruptions of spermatogenesis and infertility in otherwise healthy men. In the mouse, more information on the mechanism of spermatogenesis is available than in the human. It is necessary therefore to obtain further information on spermatogenesis in the human and to isolate the relevant genes. In this present study, we tried to isolate those human TISP genes that are expressed specific to the human testis.

MATERIALS AND METHODS

Expression analysis of the human TISP gene family

OF THE 80 TISP genes expressed in the testis, almost all isolated TISP cDNA were partial fragments. Therefore, we searched for the mouse full‐length cDNA by homology search using the Genome database (NCBI, Bethesda, MD, USA) and then tried to find the human genome regions with homology to mouse TISP gene family at amino acid level with human genome database. Twenty‐eight of the 80 mouse TISP cDNA could be found with homologous regions in the human. Thus, we made primers within the human homologous regions. PCR were carried out with various adult human cDNA libraries as templates, using the Advantage 2 PCR Enzyme System (Clontech, Palo Alto, CA, USA). The analyzed human cDNA libraries were: spleen, thymus, prostate, testis, ovary, small intestine, colon, leukocytes, heart, brain, lung, liver, kidney, pancreas and placenta (Clontech). All PCR were performed according to the manufacture's protocol. The first PCR were performed as follows: initial denaturation at 95°C for 150 s, followed by 32 cycles of denaturation at 95°C for 15 s, and then annealing and extension at 68°C for 90 s. Some were performed as nested‐PCR reactions using 10 × dilution of the first PCR products as templates. All nested PCR reactions were carried out with the same conditions as first PCR, except the number of cycles was 15. The following cDNA were carried out as only first PCR reactions: TISP2, TISP21, TISP24, TISP25, TISP32, TISP33, TISP34, TISP36, TISP41, TISP42, TISP45, TISP59, TISP66, TISP74, TISP79, TISP7, TISP15, TISP16, TISP26, TISP27 and TISP31. The following cDNA were carried out as nested PCR reactions: TISP4, TISP17, TISP20, TISP39, TISP63, TISP43, and TISP50.

Isolation of the human TISP50, TISP15 and TISP43 cDNA

The mouse Tisp50 cDNA was isolated in 2002 (AB067773 in GenBank). ¹ However, the isolated Tisp50 cDNA is actually partial cDNA. Thus, by searching GenBank for the homology, we found that the mouse Tisp50 is identical to the mouse Shippo1 (AB067773 in GenBank). ¹⁵ Using the mouse SHIPPO1 amino acid sequences, we found the region with homology at amino acid level in human genome sequences (AC131930.1 in GenBank). The primers encompassing introns, TISP50F1, TISP50F2, TISP50R1, and TISP50R2 were made using the homology. The oligonucleotides used were the following: TISP50F1; 5′‐TGACGGAGGAGGTATGGATG‐3′, TISP50F2; 5′‐CCCATCATGGCCCTCTACAG‐3′, TISP50R1; 5′‐CTTGAGGGTCTTGTCCCCTG‐3′ and TISP50R2; 5′‐TTGAACTTGGTCACCCGCAC‐3′. First, PCR was performed using a human testis cDNA library (Clontech) as a template with TISP50F1/TISP50R1 primer set. Nested PCR was carried out using the TISP50F2/TISP50R2 primer set. All PCR reactions for isolating the human TISP cDNA were carried out under the same conditions. First PCR was carried out as follows: initial denaturation at 95°C for 150 s, followed by 32 cycles of denaturation at 95°C for 15 s and then annealing and extension at 68°C for 90 s. Nested‐PCR reaction used 10 × dilution of the first PCR products as template and all nested PCR reactions were carried out under the same conditions as first PCR, except the number of cycles was 20. The nested‐PCR product was subcloned into a T‐Easy vector (Promega, Madison, WI, USA) and representative clones were sequenced. 5′RACE and 3′RACE were carried out with the primers, 5RACE1TISP50, 5RACE2TISP50, 3RACE1TISP50, 3RACE2TISP50, AP1 (Clontech) and AP2 (Clontech). The oligonucleotides used were: 5RACE1TISP50; 5′‐GCCCCAGGATGGAGTAGGCAGGGCCAAG‐3′ and 5RACE2TISP50; 5′‐AAGCTGTAGGCCGGTGCACGCAGCTTGG‐3′ and 3RACE1TISP50; 5′‐GCAGCCCTGGACCCAAGTACCTGATTCC‐3′ and 3RACE2TISP50; 5′‐CGTGTTCGACTCAGCACCCAGCCACTCC‐3′. First PCR was carried out with 5RACE1TISP50/AP1 primer set, and nested‐PCR was carried out using 10 × dilution of the first PCR products as template with 5RACE2TISP50/AP2 primer set. First PCR was carried out with 3RACE1TISP50/AP1 primer set, and nested PCR was carried out with 3RACE2TISP50/AP2 primer set with the same conditions of 5′RACE reactions (3′RACE). Both RACE products were subcloned into T‐Easy vector (Promega) and sequenced. The isolated cDNA sequences were compared to human genome sequences.

The mouse Tisp15 cDNA was also isolated in 2002 (AB045835 in GenBank). ¹ However, the isolated Tisp15 cDNA was partial. Homology search for full‐length cDNA was carried out using GenBank. We found that the mouse TISP15 is completely identical to the mouse Oaz3 (NM 016901 in GenBank). ¹⁶ Using the mouse OAZ3 amino acid sequences, we found the region with homology at amino acid level in human genome sequences (AC068971 in GenBank). The primers encompassing introns, TISP15F1, TISP15F2, TISP15R1 and TISP15R2, were made using the homology. The oligonucleotides used were: TISP15F1; 5′‐TCTTGTAAGAGGTGTCGCCC‐3′ and TISP15R1; 5′‐GGAGAGTGATCCGGTACTTG‐3′. PCR was performed using a human testis cDNA library as a template with TISP15F1/TISP15R1 primer set. The PCR product was subcloned into a T‐Easy vector (Promega) and representative clones sequenced in both directions. 5′RACE and 3′RACE were carried out with the primers 5RACE1TISP15, 5RACE2TISP15, 3RACE1TISP15, 3RACE2TISP15, AP1 and AP2. The oligonucleotides used were the following: 5RACE1TISP15; 5′‐ACCGTCAAGTTCCCAGCCGAATACAG‐3′ and 5RACE2TISP15; 5′‐TTAAGCTGGTCGTGGTTACCCTGCTC‐3′ and 3RACE1TISP15; 5′‐CACGTAACTACCTCTACCCGATCTGG‐3′ and 3RACE2TISP15; 5′‐TCTGGTCACCATACGCCTATTACC‐3′. First PCR was carried out with 5RACE1TISP15/AP1 primer set, and nested PCR used 5RACE2TISP15/AP2 primer set (5′RACE). First PCR was carried out with 3RACE1TISP15/AP1 primer set, and nested PCR was carried out with 3RACE2TISP15/AP2 primer set (3′RACE). All PCR reactions were carried out under the same conditions as PCR of TISP50. Both RACE products were sequenced in both directions. The isolated cDNA sequences were also compared to human genome sequences.

The mouse Tisp43 cDNA was also isolated in 2002 (AB046304in GenBank). ¹ However, the isolated Tisp43 cDNA was also only partial. Homology search found that the mouse TISP43 is identical to the mouse Tesp1 (NM 009355 in GenBank). ¹⁷ Using the mouse TESP1 amino acid sequences, we found the region with homology at amino acid level with human genome sequences (AC140481 in GenBank). The primers encompassing introns, TISP43F1, TISP43F2, TISP43R1 and TISP43R2, were made using the homology. The following oligonucleotides were used: TISP43F1; 5′‐AACAGGTCCACTAACCCATC‐3′ and TISP43F2; 5′‐TCCTGCTTGGGTATGACCAG‐3′ and TISP43R1; 5′‐AGCAGGAGGAACATGTGAGC‐3′ and TISP43R2; 5′‐GATGCCCTGAGAGGTCATGC‐3′. First PCR was performed using a human testis cDNA library as a template with TISP43F1/TISP43R1 primer set. Nested PCR was carried out using the TISP43F2/TISP43R2 primer set. The nested‐PCR product was subcloned into a T‐Easy vector (Promega) and representative clones sequenced in both directions. 5′RACE and 3′RACE were carried out with the primers, 5RACE1TISP43, 5RACE2TISP43, 3RACE1TISP43, 3RACE2TISP43, AP1 and AP2. The used oligonucleotides are following: 5RACE1TISP43; 5′‐GGGTACTGGGGCTGGAAAAAGGATCCGC‐3′, 5RACE2TISP43; 5′‐GTGGGAGCTGAATTCCACATGACGGTGC‐3′, 3RACE1TISP43; 5′‐ACCAGCAAAGCCATCCCACAGAGCACAG‐3′ and 3RACE2TISP43; 5′‐CCAGCCCCAGTACCCCGGCCAGCCAAGC‐3′. First PCR was carried out with 5RACE1TISP43/AP1 primer set, and nested PCR was carried out with 5RACE2TISP43/AP2 primer set (5′RACE). First PCR was carried out with 3RACE1TISP43/AP1 primer set, and nested PCR was carried out with 3RACE2TISP43/AP2 primer set (3′RACE). All PCR were carried out under the same conditions as those of TISP50 and TISP15. Both RACE products were sequenced in both directions. The isolated cDNA sequences were also compared to human genome sequences.

Expression analysis of the human TISP50, TISP15 and TISP43 cDNA

For the expression analysis of the human TISP50, TISP15 and TISP43, reverse transcription polymerase chain reaction (RT–PCR) were performed with the following primers: TISP50FF1, TISP50RR1 (TISP50), TISP15FF1, TISP15RR1 (TISP15), TISP43FF1 and TISP43RR1 (TISP43). The human cDNA analyzed, using Multiple Tissues cDNA Panels (Clontech), were: spleen, thymus, prostate, testis, ovary, small intestine, colon, leukocyte, heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas. All PCR reactions were carried out under the following conditions: initial denaturation at 95°C for 150 s, followed by 32 cycles of denaturation at 95°C for 15 s, and annealing and extension at 68°C for 90 s.

RESULTS

IN 2002, THE 80 TISP genes were isolated in mice. ¹ All of these are specifically expressed in the testis. Using Genome database, we searched for the mouse full‐length cDNA and found the 28 human genome regions with homology to mouse TISP gene family at amino acids level. Expression analysis using numerous human cDNA libraries was performed on these 28 human TISP cDNA. It was demonstrated that five of them (TISP7, TISP16, TISP26, TISP27 and TISP31) are not expressed in the human testis (Table 1). Only three of them, TISP15, TISP43 and TISP50, have expression specific to the human testis (data not shown). The others are expressed in various human tissues (Table 1). Therefore, we tried to isolate full‐length cDNA of the human TISP15, TISP43 and TISP50. First, three PCR products were subcloned into T‐Easy vector (Promega) and the resultant plasmid clones were sequenced. After confirming that they have homology to mouse cDNA at amino acid level, 5′RACE and 3′RACE were carried out. All six PCR products were subcloned into plasmid vector and sequenced.

Table 1.

Reverse transcription polymerase chain reaction analysis of expression in human tissues using cDNA libraries

	Spleen	Thymus	Prostate	Testis	Ovary	Small intestine	Colon	Leuco‐ cytes	Heart	Brain	Lung	Liver	Kidney	Pancreas	Placenta
TISP2	–	+ –	+ –	+	+ –	–	–	–	–	+	+	–	+	+	–
TISP4	–	+ –	+ –	+ +	+ –	–	–	–	–	+	+	–	+	++	–
TISP17	–	+ –	+ –	+ +	+ –	–	–	–	–	+	+	–	+	++	–
TISP20	+ –	+ –	+–	+	+ –	–	–	–	–	+	+	–	+	+	–
TISP21	+ –	–	+ –	+ +	+	+	–	–	+ –	+ –	+ –	+–	+–	+	+
TISP24	+ +	+ +	+ +	+ +	+	+	–	–	+	+	+	+ +	+ +	+ +	+ +
TISP25	+ +	+	+ +	+ +	+ +	+ +	+ +	+ –	+ +	+ +	+ +	+ +	+ +	+ +	++
TISP32	+ –	–	+ –	+	–	+ –	+ –	+–	–	+	+ –	+ –	–	–	+ –
TISP33	+	+	+	+ +	+	+	+	–	–	+ –	+ –	+ –	+ –	+	+
TISP34	+	+	+ +	+ +	+ +	+	+ –	+–	+ –	+ –	+ –	+ –	+ –	+ +	+ –
TISP36	+ –	–	+ +	+ +	+	+ +	+ +	–	–	+ +	+	–	–	+	+ –
TISP39	+ +	+ +	+ +	+ +	+ +	+ +	+ +	+ +	+ +	+ +	+ +	+	+ +	+ +	+ +
TISP41	+ +	+ +	+ +	+ +	+ +	+ +	+ +	+ +	+ +	+ +	+ +	+ +	+ +	+ +	+ +
TISP42	+ –	+ –	+ +	+ +	+ +	+ –	+ –	–	+ –	+ +	+ +	+ +	+ +	+ +	+ –
TISP45	+ –	+ –	+	+ +	+	+ –	+ –	+ –	+ –	+ +	+ +	+ –	+ +	+ +	–
TISP59	+ –	+ –	+ –	+ +	+ –	–	–	–	–	–	–	–	–	+	–
TISP63	–	–	+ –	+ +	–	–	–	–	–	–	–	–	–	+	–
TISP66	+	+	+ –	+ +	–	–	–	–	–	–	–	–	–	+	–
TISP74	+	+	+	+ +	+	+	+	+ +	–	+	+	+ –	+	+	+
TISP79		–	–	+		–	–	–	–	–	–	–	–	+	–
TISP7	0	0	0	–	0	0	0	0	0	0	0	0	0	0	0
TISP16	0	0	0	–	0	0	0	0	0	0	0	0	0	0	0
TISP26	0	0	0	–	0	0	0	0	0	0	0	0	0	0	0
TISP27	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
TISP31	0	0	0	–	0	0	0	0	0	0	0	0	0	0	0
TISP15	–	–	–	+ +	–	–	–	–	–	–	–	–	–	–	–
TISP43	–	–	–	+ +	–	–	–	–	–	–	–	–	–	+ –	–
TISP50	–	–	–	+ +	–	–	–	–	–	–	–	–	–	+ –	–

–, no signal; + –, weak signal; +, strong signal; + +, very strong signal; 0, not examined.

Sequence analysis and homology search to the mouse cDNA demonstrated that the isolated human TISP50 cDNA is full‐length cDNA. It encodes 254 amino acid sequences and there is 93% homology to the mouse Tisp50 cDNA at amino acid level (AY713299 in GenBank) (Fig. 1). There are no previously known domains, although six Pro‐Gly‐Pro repeats were present. The open reading frame is from 270 nucleotides (nt) to 1034 nt and consists of six exons and five introns. A computer‐assisted search using GenBank demonstrated that the human TISP50 gene is located on human chromosome 11p15.5. To determine the expression pattern in detail, other primer sets were made and PCR was performed on the human TISP50 using Multiple Tissues cDNA Panels (Clontech). Except for a very weak band on the pancreas, the human TISP50 was expressed almost exclusively on the testis (Fig. 4).

Figure 1.

Amino acid sequences of human and mouse TISP43. Upper sequences are human and lower ones are mouse. Vertical lines indicate identical sequences. There is 43% homology between them. Asterisks indicate stop codons.

Figure 4.

Amino acid sequences of human and mouse TISP50. Upper sequences are human and lower ones are mouse. Vertical lines indicate identical sequences. There is 93% homology between them and underlines indicate the positions of Pro‐Gly‐Pro repeats. Asterisks indicate stop codons.

The human TISP43 cDNA was isolated by the same method. It has 43% homology to the mouse cDNA at amino acid level (AY713301) (Fig. 2). The putative amino acid sequences in the region from 32nd to 181st is 59.5% identical to the domain of trypsin‐like serine protease. Again, the expression pattern is almost specific to the testis but for a very weak band on the pancreas (Fig. 4). However, we could not find start codon by 5′RACE analysis, as shown in Figure 2. Therefore, the isolated human TISP43 related cDNA was determined to be partial. The human TISP15 cDNA was isolated by the same method; it has 78% homology to the mouse cDNA at amino acid level (AY713300) (Fig. 3), however, no putative conserved domains have been found in this region. The expression pattern is almost specific to the testis but for a very weak band on the pancreas (Fig. 4). However, we could not detect start codon by 5′RACE analysis, as shown in Fig. 3 so concluded that the isolated human TISP15 cDNA is also partial.

Figure 2.

Amino acid sequences of human and mouse TISP15. Upper sequences are human and lower ones are mouse. Vertical lines indicate identical sequences. There is 78% homology between them. Asterisks indicate stop codons.

Figure 3.

Expression analysis of the human TISP15, TISP43 and TISP50 cDNA with the 16 adult human tissues. G3PDH was used as a positive control.

DISCUSSION

IT WAS DEMONSTRATED that the 80 mouse Tisp genes are specifically expressed in the mouse testis and almost all of the isolated mouse cDNA are partial. ¹ We analyzed 28 human TISP cDNA and found that five of them, TISP7, TISP16, TISP26, TISP27 and TISP31, are not expressed in the human testis, indicating a discrepancy between human TISP genes and mouse Tisp genes. In general, the genes that play critical roles in spermatogenesis are maintained across a number of species. Therefore, it is suggested that the mouse Tisp7, Tisp16, Tisp26, Tisp27 and Tisp31 might not play important roles in the mouse spermatogenesis. In addition, there is further discrepancy between human and mouse. Only three human genes, TISP15, TISP43 and TISP50, are specifically expressed in the testis, with the others expressed in arranged human tissues. Expression analysis of the human TISP genes was carried out by RT–PCR method in this study, whereas that of the mouse Tisp genes was performed by Northern blot analysis. ¹ RT–PCR is more sensitive to weak expression than Northern blot, so if RT–PCR analysis were carried out on the mouse Tisp genes, bands may be detected in tissues apart from the testis.

Partial fragments of the human TISP43 related cDNA were isolated. The encoded protein has 43% homology to the mouse TISP43 (TESP1). The mouse Tesp1 cDNA encodes serine protease. The mouse TESP1 is localized in the sperm acrosome and is released during the acrosome reaction induced by calcium ionophore A23187. ¹⁷ It has been suggested that the mouse Tisp43 (Tesp1) might play some roles in the mechanisms involved in the interaction between sperm and egg, including penetration of the zona pellucida by sperm.

We isolated full‐length TISP50 cDNA. However, while this work was proceeding, an independent report of the human TISP50 (SHIPPO 1) gene was published, ¹⁵ although it only reported the amino acid sequences of the human TISP50 (SHIPPO 1) cDNA. We demonstrated that the human TISP50 expression is also specific to the human testis. No previously described domains could be detected in the human TISP50, so no assumptions can be made about its function, although the expression pattern is interesting. In the mouse, the protein of TISP50 (SHIPPO 1) is localized in the flagella of the elongated spermatids and along the entire length of the tail in mature sperm. ¹⁵ A structural abnormality of the tail can result in alteration of sperm movement and has been associated with human infertility. ¹⁸ , ¹⁹ Therefore, histological and immunohistochemical analysis have to be performed and more detailed information about expression patterns is needed. The human TISP50 is located on chromosome 11p15.5, a region known to contain the cluster of genomic imprinting genes, including the following imprinted genes: IGF2, INS2, LIT1, PEG8, MTR1, IPL, IMPT1, P57, KVLQT1 and H19. ²⁰ Further investigation is required to determine whether the human TISP50 gene is imprinted.

In summary, we isolated the three testis‐specific expressed human cDNA: TISP50, TISP15 and TISP43 related one. From their expression patterns and amino acid sequences, it is suggested that they may play important roles in human spermatogenesis. To examine their functions in detail, further analysis will be needed.