Transferrin and inhibin mRNA in mature pig Sertoli cells

Abstract

Aims:  There is increasing concern about the effect of environmental toxins and endocrine disrupters on human spermatogenesis but ethical considerations prohibit direct research. Therefore, we developed a method of isolating mature pig Sertoli cells and studying the levels of mRNA of transferrin and inhibin, markers of Sertoli cell function, using real‐time polymerase chain reaction analysis.

Methods:  Sertoli cells from mature Meishan boars were isolated and cultured. The mRNA was isolated from the cells after 3 days of treatment with follicle‐stimulating hormone (FSH), testosterone and β‐estradiol. The amounts of transferrin and inhibin mRNA were analyzed by real‐time polymerase chain reaction and the relative level of mRNA was calculated.

Results:  FSH tended to increase the levels of transferrin and inhibin mRNA, as did the combinations of FSH and the steroids. The effect of testosterone and β‐estradiol alone on the level of mRNA was less than that of FSH. Beta‐estradiol treatment resulted in a dose‐dependent decrease in mRNA.

Conclusion:  The Sertoli cell culture used in the present study appears to have a normal secretory function because the mRNA levels of both markers increased after FSH treatment. The suppressive effect of β‐estradiol on inhibin mRNA level suggests that β‐estradiol has an effect on the function of Sertoli cells. (Reprod Med Biol 2005; 4: 259 –264)

INTRODUCTION

CONCERN IS INCREASING worldwide about the effects of reproductive toxins and endocrine disruptors on human male infertility. Although understanding of the effects of reproductive toxins on the fetus has advanced gradually, it is difficult to examine their direct influence on human tissues for obvious ethical reasons. Therefore, experimental animals are necessary for studies of the gonads. Because their physiology and the size of the organs are similar to humans, pigs are frequently used in clinical studies and as a new xenogeneic source of organ and tissue transplants. ¹ , ² Many studies have used miniature pigs, but the duration until puberty and body size after puberty vary according to the breed of pig, which needs to be taken into consideration when choosing an animal model of male reproduction. In additional, handling adult boars of common European breeds is difficult and sometimes dangerous. For the present study, we selected the Meishan pig, which is a Chinese breed with a placid nature, large litters and early sexual maturity; it reaches puberty (20–30 kg) in less than 12 weeks. ³

Sertoli cells play a key role in spermatogenesis. ⁴ , ⁵ They secrete many proteins, such as transferrin, which appears to be an important marker of the functional integrity of the testis because its synthesis and secretion directly affect iron transport to the germ cells. ⁶ Inhibin, another protein secreted by Sertoli cells, is used as an endocrine marker of spermatogenesis. ⁷ Inhibins are dimeric proteins consisting of a common α‐subunit and one of two β‐subunits and the two forms, inhibin A (α/βA) and inhibin B (α/βB), are secreted into the circulation by the testes. ⁸ , ⁹ , ¹⁰ , ¹¹

The Sertoli cells of the Meishan pig assist spermatogenesis more than those of conventional breeds. Their daily sperm production per Sertoli cell is approximately twice that of European pigs. ¹² In the present study, we developed a method of isolating mature Sertoli cells and quantitatively analyzing the levels of transferrin and inhibin mRNA in the cells using real‐time polymerase chain reaction (PCR).

MATERIALS AND METHODS

Reagents

COLLAGENASE S‐1 (260 U/mg) was obtained from Nitta Gelatin (Osaka, Japan). Gentamicin and Ham's F12/DME medium were purchased from Invitrogen Corp. (Carlsbad, CA, USA). Fetal calf serum (FCS) was purchased from MP Biomedicals (Irvine, CA, USA). Hanks’ balanced salt solution (HBSS), insulin, transferrin, vitamin E, testosterone and β‐estradiol were obtained from Sigma‐Aldrich (St Louis, MO, USA). Testosterone and β‐estradiol were prepared as 1 mg/mL stock in 99.5% ethanol and diluted in Ham's F12/DME medium. Porcine follicle‐stimulation hormone (FSH; Biogenesis, Poole, UK) was prepared as 5 µg/mL in phosphate‐buffered saline (PBS) with 0.1% bovine serum albumin.

Animals

Sixteen sexually mature Meishan boars (12–14 weeks of age) were used. They were weaned at 4 weeks and housed in natural conditions of daylength and temperature. The boars were electrocuted and bled immediately. All studies were conducted in strict accordance with the Guide for the Care and Use of Experimental Animals (Animal Care Committee, National Institute of Livestock and Grassland Science).

Isolation and culture of Sertoli cells

Sertoli cells were isolated using modifications and combination of the methods described by Perrard‐Sapori et al. and Jaillard et al. ¹³ , ¹⁴ Decapsulated testes were minced and incubated for 90 min with shaking at 33°C in HBSS containing collagenase (0.5 mg/mL) and gentamicin (20 µg/mL). The container was shaken vigorously before the incubation to cause the seminiferous tubules to unwind. At the end of the incubation, the tubule fragments were filtered through surgical gauze, followed by twice dilution with HBSS. After being left at room temperature for 20 min, the sedimented portion was washed. The tubule fragments were treated with 1 mol/L glycine buffer (pH 7.2), pipetted for 20 min, diluted 10‐fold with HBSS and left to settle for 30 min. After further washing, the tubule fragments were subjected to a second collagenase digestion (0.5 mg/mL, 20 min, 33°C), filtration and washing. The cell clusters obtained underwent a third collagenase digestion (0.5 mg/mL, 20 min, 33°C). These procedures led to a purified coculture of Sertoli cells with germ cells, free from contamination by Leydig cells and containing less than 1% peritubular myoid cells. The existence of Leydig cells was confirmed by 3β‐hydroxysteroid dehydrogenase staining. ¹⁵ Peritubular cells were identified routinely by alkaline phosphatase reaction, with Oil Red O staining for Sertoli cells (Fig. 1). ¹⁶

Figure 1.

Light micrograph of Sertoli cells stained with Oil Red O. The nuclei are counter‐stained with hematoxylin.

The resulting Sertoli cells and germ cells were washed several times, counted and plated at a density of 1–10 × 10⁶ per 100 mm dish. They were cultured at 33°C in a 5% CO₂ atmosphere in Ham's F12/DME medium supplemented with gentamicin (50 µg/mL), transferrin (5 µg/mL), insulin (5 µg/mL), vitamin E (5 µg/mL), and 10% FCS (Fig. 2). The medium was changed after 24 h (i.e. day 2) and 48 h (day 3). Before the change on day 3, the cultures underwent a hypotonic treatment with Ham's F12/DME medium diluted to 1/10, which selectively removed the germ cells. ¹⁷ , ¹⁸

Figure 2.

Light micrograph of coculture. There are many germ cells (arrowheads) on Sertoli cells (arrows).

Experimental protocol

Follicle stimulating hormone (FSH, n = 8), testosterone (n = 6) and β‐estradiol (n = 8) were added to the medium from the beginning of the culture (day 1) to the end (day 4). The total exposure time to the hormones was approximately 60 h. In experiment 1, 50 ng/mL of FSH, testosterone, and β‐estradiol were added to each dish. ¹³ , ¹⁹ , ²⁰ , ²¹ And the effects of the combinations of FSH and testosterone (n = 4), and FSH and β‐estradiol (n = 4) were also examined. In experiment 2, the effects of testosterone (50, 100, 200 ng/mL, n = 3) and β‐estradiol (50, 100, 200, 500 ng/mL, n = 3) were investigated. All experiments had a control of cells cultured in absence of the hormones, and the effects of the hormones were calculated as a ratio to the value of the control.

mRNA isolation and cDNA synthesis

On day 4, the isolated Sertoli cells were washed with PBS and removed with trypsin‐ethylene diamine tetra acetic acid (EDTA) solution (0.05% trypsin and 0.5 mmol/L EDTA). After neutralization with FCS‐supplemented medium, cells were washed and counted. Messenger RNA was extracted using the QuickPrep mRNA purification kit (Amersham Biosciences UK, Buckinghamshire, UK), and then cDNA was made from the mRNA using the First‐strand cDNA synthesis kit (Amersham Biosciences UK, Buckinghamshire, UK).

Design and synthesis of polymerase chain reaction primer

The sets of primers were designed according to the reported nucleotide sequences for the porcine genes of inhibin α, inhibin βA, and inhibin βB subunits and transferrin. Porcine ribosomal protein L7 (RPL7) was adopted as a standard. ²² The sequences and expected PCR product sizes are shown in Table 1. The oligonucleotides were synthesized by Sigma Genosys (Ishikari, Japan).

Table 1.

Primers of transferrin, inhibin α, inhibin βA and inhibin βB subunits, and porcine ribosomal protein L7

Gene	Primer	Sequence (5’−3’)	PCR cycle	Annealing temp (°C)	Product size (bp)
Transferrin	Sense	AGAAGGGCAGCAACTTCCAGTGGAAC	55	65	100
	Antisense	AGTAATCCCATGGGGATGATCCATCC
Inhibin α	Sense	CACCTCGGATGGAGGTTACTCTTTCA	50	60	213
	Antisense	ATTGTCACATTACCCATGGGACAGGG
Inhibin βA	Sense	GACGGCAAGGTCAACATCTGCTGTAA	50	60	289
	Antisense	ATGATGTTCTGCCCGTCGTCGTAGTA
Inhibin βB	Sense	CCTGTACTTCTTCATCTCCAACGAGG	50	60	137
	Antisense	TGGAAGTACACCTTGACCCGAACCTT
RPL7	Sense	GTCATCAGGATCAGAGGTATCAATGGTGTG	40	60	111
	Antisense	AGCCTTGTTGAGCTTCACAAAGGTGCCA

PCR, polymerase chain reaction.

Real‐time polymerase chain reaction

The quantification of each DNA was carried out with a LightCycler system (Roche, Mannheim, Germany). PCR was carried out with the QuantiTect SYBR Green PCR kit (Qiagen K.K., Tokyo, Japan) using 1 µL of cDNA, corresponding to 20 µL of total RNA in a 33 µL final volume and 0.3 µmol/L each primer (final concentration). Amplification involved one cycle at 95°C for 15 min for initial denaturation and then the number of cycles shown in Table 1 at 94°C for 20 s, followed by annealing at the temperatures shown in Table 1 for 20 s and 72°C for 10 s.

The PCR products were separated by electrophoresis on agarose gels and stained with ethidium bromide. The specificity of amplification was confirmed by sequencing using a DNA analyzer (Applied Biosystem, Foster City, CA, USA).

RESULTS

Experiment 1

THE EXISTENCE OF transferrin and inhibin βB subunit mRNA in pig Sertoli cells is shown for the first time (Fig. 3). The effects of the hormones on mRNA levels of transferrin, inhibin α, inhibin βA and inhibin βB subunits are shown in Table 2. The ratio of mRNA/number of cells in the control that were cultured without hormones was arbitrarily defined as 1. The levels of mRNA from Sertoli cells cultured with FSH were higher than those of the control, except for the inhibin βB subunit. The combination of FSH and testosterone (F + T), and FSH and β‐estradiol (F + E) showed higher levels of all mRNA than the control. The effects of testosterone and β‐estradiol alone were less than that of FSH alone or the combinations.

Figure 3.

Expression of the genes in mature Meishan pig Sertoli cells with the primer set detailed in Table 1. Products were separated by electrophoresis on agarose gels and stained with ethidium bromide. DNA marker is in the extreme right lane.

Table 2.

Effects of hormones on Sertoli cell mRNA levels of transferrin, inhibin α, inhibin βA and inhibin βB subunits (50 ng/mL)

	Transferrin	Inhibin α	Inhibin βA	Inhibin βB
F (n = 8)	2.0 ± 1.1	1.3 ± 0.2	1.2 ± 0.3	0.8 ± 0.2
F + T (n = 4)	1.6 ± 0.4	1.2 ± 0.3	2.2 ± 1.4	2.2 ± 1.2
F + E (n = 4)	5.3 ± 2.8	1.6 ± 0.5	1.4 ± 0.7	2.0 ± 1.1
T (n = 6)	0.8 ± 0.2	0.9 ± 0.1	1.3 ± 0.7	1.0 ± 0.2
E (n = 8)	1.1 ± 0.4	1.1 ± 0.1	1.1 ± 0.4	0.7 ± 0.1

The ratio of mRNA/number of cells in control (without hormone) is arbitrarily defined as 1. Values are means ± SEM.

E, β‐estradiol; F, follicle stimulating hormone; T, testosterone.

Compared with the control, the levels of transferrin and inhibin α subunit mRNA were lower levels with the addition of testosterone, and higher with FSH, F + T, F + E, and β‐estradiol. The level of inhibin βA subunit was higher than that of the control with the addition of any hormones. After the addition of testosterone, the level of inhibin βB subunit mRNA was almost the same as that of the control, but was lower than that of the control with FSH and β‐estradiol.

Experiment 2

As in experiment 1, the dose of testosterone did not show obvious effects on the levels of mRNA (Fig. 4). There was no correlation between the dose and the levels of transferrin and inhibin βA subunit mRNA, although inhibin α and inhibin βB subunit mRNA levels showed a dose‐dependent increase. With the addition of 200 ng/mL, inhibin βB subunit mRNA was approximately twice that after the addition of 50 ng/mL.

Figure 4.

Effect of testosterone on the mRNA levels of transferrin (TF), inhibin α (INHα), inhibin βA (INHβA) and inhibin βB subunits (INHβB) in pig Sertoli cells. The ratio of mRNA/number of cells in control (without hormone treatment) is arbitrarily defined as 1. Histograms represent the mean ± SE of three experiments. (□) 50ng/mL; (▪) 100 ng/mL; () 200 ng/mL.

In the experiment with β‐estradiol, there were dose‐dependent decreases in the levels of mRNA (Fig. 5). After the addition of 500 ng/mL β‐estradiol, the levels of transferrin, inhibin βA and inhibin βB subunits mRNA were not detected. The levels of the inhibin βA and inhibin βB subunits mRNA decreased with increasing dosage. The dose of 100 ng/mL decreased the levels of transferrin, inhibin βA and inhibin βB subunits mRNA to approximately half that of 50 ng/mL. There was little difference between the addition of 200 ng/mL and 100 ng/mL.

Figure 5.

Effect of β‐estradiol on mRNA levels of transferrin (TF), inhibin α (INHα), inhibin βA (INHβA) and inhibin βB subunits (INHβB) in pig Sertoli cells. The ratio of mRNA/number of cells in control (without hormone treatment) is arbitrarily defined as 1. Histograms represent the mean ± SE of three experiments. ND, not detected. (□) 50ng/mL; () 100 ng/mL; (▪) 200 ng/mL; (▧) 500 ng/mL.

DISCUSSION

TRANSFERRIN AND INHIBIN are used as the marker of functional integrity in spermatogenesis. ⁷ , ⁸ Their measurement has advanced the study of male physiology, both in vivo and in vitro. Experiments using gene expression in laboratory animals have become popular, but we have succeeded in showing for the first time the expression of transferrin and inhibin βB mRNA in pig Sertoli cells.

It has been reported that transferrin mRNA levels increase with FSH and testosterone treatment as well as secretion. ²³ The levels of transferrin mRNA from Sertoli cells cultured with FSH tended to be higher than those of the control in the present study (Table 2). However, the changes in mRNA levels after the addition of testosterone or β‐estradiol were small compared with those after FSH treatment. These results also corresponded to a previous report on rats, which showed that the mRNA level after steroid hormone treatment was not very high and that combination treatment with FSH achieved a higher level. ²³ Therefore, our experimental system seems to exhibit normal secretory function because higher levels than the control were also achieved after F + T and F + E treatments.

Inhibin secretion increased with both FSH and the combination of F + T in a rat study. ²¹ Another report showed that FSH, but not testosterone, increased inhibin α subunit mRNA expression and the secretion, whereas the inhibin βB subunit mRNA was not influenced by either FSH or testosterone. ²⁰ The levels of inhibin α and inhibin βA subunit mRNAs in the present study tended to increase with FSH and its combinations (Table 2). Inhibin βA subunit mRNA indicated higher levels than in the control with any treatment; in particular the level of inhibin α and inhibin βB subunit mRNA showed a dose‐dependent increase with testosterone (Fig. 4), which suggests that testosterone has an effect on mature pig Sertoli cells and that the effect is less than that of FSH.

In contrast, there are reports that estrogens produce dysfunction in the male reproductive system. ²⁴ , ²⁵ In the present study, we found a tendency of β‐estradiol to suppress the level of inhibin βB subunit mRNA (Table 2, Fig. 5). Inhibin B (α/βB) is thought to be the major form of circulating inhibin in humans, primates, rats and pigs, ²⁶ , ²⁷ although it has been reported that estradiol has no effect on the level of circulating inhibin. ²⁸ The role of inhibin in the regulation of spermatogenesis has not been investigated as thoroughly as that of FSH and the steroid hormones. ⁵ The stimulation mechanisms of inhibin and transferrin synthesis in Sertoli cells have not been clarified other than the cAMP‐mediated pathway. ²⁹ , ³⁰ Recently, some cytokines were suggested to be important in FSH regulation of Sertoli cells. ³⁰ , ³¹ Therefore, the production mechanisms of these markers in Sertoli cells need to be further investigated.

Sertoli cells are termed ‘nurse’ cells for the germ cells because they directly provide nutrients and protection. ⁵ , ⁶ , ⁷ However, experiments using Sertoli cells purified from healthy human testes are uncommon and there are different experimental results from humans and rats, even concerning the action mechanism of FSH in spermatogenesis. ⁵ Physiological research on pigs has advanced in other medical fields. The present study showed that pig Sertoli cells are also a good experimental material for reproductive system research and that the analysis of mRNA by quantitative RT–PCR will become a useful tool for investigating male fertility.