Effect of relaxin on the decidual cell reaction in the Mongolian gerbil (Meriones unguiculatus)

Abstract

Purpose

Differentiation of endometrial stromal cells into decidual cells occurs during embryo implantation and pregnancy. Recently, it has been reported that relaxin affects the decidualization of cultured human endometrial cells in vitro; however, there has been no study on the decidualization of the Mongolian gerbil (Meriones unguiculatus). The authors demonstrated artificially induced decidualization, and the effect of relaxin on decidualization in gerbils.

Methods

Ten‐to‐twelve‐week‐old female Mongolian gerbils were ovariectomized, treated with estradiol, progesterone, and relaxin, and the uterine horn was stimulated. On day 10, uterine horns were measured for weight, protein concentration, and the incorporation of ¹⁴C‐methionine; tissue sections were examined. Interleukin‐11 (IL‐11) primers were used for RT‐PCR to confirm decidualization.

Results

Decidualization can be induced artificially in gerbils. In general, the histological observations of gerbil decidual cells were very similar to those of rats. The uterine horn weight, protein content, and protein synthesis from ¹⁴C‐methionine significantly increased in the relaxin‐treated gerbils (P < 0.05). Mast cells in the relaxin‐treated uterus had proliferated more than those of the non‐relaxin‐treated group, which was confirmed by IL‐11 expression.

Conclusions

We conclude that decidualization can be induced artificially, and relaxin increased weight of uterine horn, protein concentration, protein synthesis and IL‐11 expression in gerbils.

Introduction

Differentiation of endometrial stromal cells into decidual cells occurs during embryo implantation and pregnancy. Decidual cells express interleukin‐11 (IL‐11), prolactin, and insulin‐like growth factor binding protein‐1 (IGFBP‐1), and trophoblasts are able to invade the maternal side. In rodents, endometrial stromal cells are not induced to undergo decidualization without embryo gluing. Infiltration of the embryo is facilitated by this dramatic change of environment in the uterus.

Relaxin is a 6‐kDa peptide hormone member of the insulin superfamily, which was first observed in 1926 by Hisaw [1]. It is an important hormone related to mammalian reproduction, and its main function is to widen the reproductive tract for successful parturition. Relaxin is a pleiotropic hormone, and it was recently reported that relaxin has an effect on many tissues and organs such as the uterus [2, 3], blood vessels [4], heart [5], lungs [6], and oocytes [7]. The uterus was especially influenced and, in rats, the protein and collagen content in the uterus was increased by relaxin treatment [8]. In humans, the relaxin‐binding region was recognized in decidual cells in vivo [9].

In the authors’ unpublished data, the effect of relaxin on the decidual cell reaction was investigated in rats. It was found that rats treated with a combination of relaxin, progesterone (P₄), and estradiol (E₂) had increased protein content, collagen content, uterine horn weight, and IGFBP‐1 compared to those treated with only P₄, and the interaction of relaxin and E₂ influenced the decidual cell reaction in rats.

Although decidualization was able to be induced artificially in mouse and rat cells [10, 11], there has been no report on this process in the Mongolian gerbil (Meriones unguiculatus). As a prospective laboratory animal, there is a paucity of data on the gerbil's reproductive system including the estrous cycle and pregnancy duration. In this report, the effects of relaxin on artificially induced decidualized uterus weight, tissue, and protein synthesis and content were observed in the gerbil.

Materials and methods

Animals and decidualization

Ten‐to‐twelve‐week‐old adult virgin female gerbils were used at unselected times of their estrous cycles. The animals were maintained and studied in accordance with the Guidelines for Regulation of Animal Experimentation, Shinshu University. They were maintained under controlled light conditions (12 h light/12 h dark; lights on at 6:00 a.m.) and allowed free access to a pellet diet and tap water.

The gerbils were treated with 0.2 μg E₂ on days −2 to 0. They received 0.1 mg P₄ and were ovariectomized under ether anesthesia on day 0. On days 2–4, 4 mg P₄ was administered, and on day 4, 0.3 μg E₂ was injected. On day 5, the artificial stimulus given to the gerbils was a unilateral intrauterine injection of 100 μl of olive oil administered into the uterine lumen caudal to the utero‐tubal junction of the left uterine horn under ether anesthesia. On days 5–10, the gerbils received 0.1 μg E₂ and 4 mg P₄ [12]. The relaxin group was also injected s.c. with 0.1 μg relaxin in 0.1 ml 1% benzopurpurin solution; the control group received only the solvent [13]. The relaxin used in this experiment was extracted from the ovaries of pregnant pigs and was provided by Prof. Kohsaka, Shizuoka University, Japan.

Tissue collection and weight measurement

Gerbils were euthanized by decapitation following weight measurement on day 10. Uterine horns were immediately collected and washed in saline. The decidualized uterine horn was then separated for each analysis, and the weight of each tissue was measured.

Soluble protein assay

Tissues were homogenized in 0.15 M NaCl and centrifuged at 10,000×g for 30 min. Fifty microliter of supernatant was added to 3 ml of Color Producing Solution in a Protein Assay Rapid Kit (Wako Pure Chemical Industries Ltd, Japan), and was color developed at room temperature for 20 min. Absorbance was then measured at 600 nm with the spectrophotometer PD‐303S (APEL Co., Ltd., Japan).

Incorporation of ¹⁴C‐methionine in decidual cells

¹⁴C‐methionine (specific activity 370 MBq/ml, Moravek Biochemicals Inc., USA) was added to Krebs‐Ringer buffer (final concentration, 9.25 kBq/ml) and preincubated at 37°C in a water bath. Decidual cells were incubated for 1 h, and the reaction was stopped by adding 10% TCA. The cells were recovered by using a membrane filter (Millipore Co., USA) and washed with 5% TCA. After dry‐up, the filter was examined using a liquid scintillation counter (Beckman Coulter Inc., USA).

RT‐PCR

The decidualized uterus was immediately frozen in liquid nitrogen. Total RNA from the decidual cells was extracted with ISOGEN (Nippon Gene Co., Ltd., Japan). cDNA was synthesized using an oligo primer and SuperScript™ First‐Strand Synthesis System for RT‐PCR (Invitrogen Corporation, USA). To examine decidualization, the IL‐11 primers IL‐11 forward, 5′‐GCTGCACAGATGAGAGACAAA‐3′; IL‐11 reverse, 5′‐ GCCGAGTCTTTAACAACAGCA‐3′; G3PDH forward, 5′‐GTGAAGGTCGGAGTCAACGGAT‐3′; G3PDH reverse, 5′‐CCAAATTCATTGTCATACCAGGA‐3′ were derived from rats, which generated a 427‐bp product in the rat. G3PDH primers were used to assess the quality of cDNA pools. PCR was conducted as follows and repeated for 30 cycles: 95°C × 1 min, 58°C × 1 min, and 72°C × 1 min. Two 2% agarose (Takara Bio Inc., Japan) gels were used for the electrophoresis of PCR products. Uteri without any hormonal treatments were also analyzed to assess decidualization.

Histological assay

Uteri were excised, cleaned of adhering fat, and immersed in Bouin's fixative. Approximately 0.5‐cm sections were obtained from the mid‐region of the uterus and embedded in paraffin. Where applicable, thickened portions of the uterus were cut to ensure that areas of the uterus undergoing decidualization were obtained. Transverse sections (8 μm) were cut on a microtome and stained with H&E (Nacalai Tesque, Inc., Japan). Three sections per animal that were several millimeters apart were examined under an optical microscope in order to determine the endometrial stromal cell number.

Statistical analysis

The data are expressed as the mean ± SEM of values. Student's t test was used to assess the significance of differences among the different groups. Statcel 2 software (OMS Publishing Inc., Japan) was used for statistical analysis. P < 0.05 was considered to be significant.

Results

The effect of relaxin on the weight of the uterine horn, on soluble protein, and ¹⁴C‐methionine incorporation is shown in Table 1. The uterine weight and ratio of the oil‐stimulated uterine horn of relaxin‐treated gerbils were significantly higher than those of the controls (P < 0.05). The relaxin group was significantly higher than the control group for the ratio of the oil‐stimulated uterine horn to the non‐stimulated uterine horn (P < 0.05). In the relaxin (P₄ + E₂ + relaxin) group, the protein content was higher than in the control group (P₄ + E₂) (P < 0.01). The protein concentration in the uterine tissue of the relaxin group was also higher than that in the control group (P < 0.05). In the relaxin‐treated gerbils, incorporation of ¹⁴C‐methionine by the decidualized cells was higher that in the control group (P < 0.05). This tendency was observed not only in the uterine horn but also in the tissue.

Table 1.

Effect of relaxin on the uterine horn weight, soluble protein, and ¹⁴C‐methionine incorporation in the decidualized uterine horn

	Uterine horn weight		Protein concentration (mg/g)	14C‐methionine incorporation concentration (pmol/g)
	Oil‐stimulated uterine horn (mg)	Stimulated/non‐stimulated
Control	97.0 ± 8.7	1.23 ± 0.07	50.5 ± 2.7	3.8 ± 0.1
Relaxin	165.5 ± 13.9*	2.43 ± 0.69*	60.7 ± 2.4*	5.3 ± 0.6*

Values represent the mean ± SEM. For weight examination, 12 animals were used, and for the soluble protein assay, 5 animals were used. The lumen of the oil‐stimulated uterine horns was injected with olive oil

Asterisk within the same column indicates a significant difference (*P < 0.05)

The expression levels of IL‐11 in the gerbil uterine cells assessed using RT‐PCR analysis are shown in Fig. 1. All of the experimental groups expressed G3PDH in the decidual cells. The decidual uterine horn of both the control and relaxin groups expressed IL‐11. In the relaxin (P₄ + E₂ + relaxin) group, the expression of IL‐11 was higher than that in the control group (P₄ + E₂); whereas, IL‐11 was not expressed in the uterine cells that did not receive hormone injection or oil‐stimulation.

Figure 1.

Expression levels of IL‐11 in the gerbil uterus as assessed by RT‐PCR analysis with specific primers. Column 1 Did not receive any hormonal treatment. Column 2 control (P₄ + E₂). Column 3 relaxin (P₄ + E₂ + relaxin)

The histological observations in decidualized uterine tissues are shown in Fig. 2. More complex structures and cavities were formed in the uteri of the relaxin group than in those of the control group. The increase in the endometrial stromal cell number was greater in the relaxin group (375.0 ± 17.4 × 10² cells/mm²) than in the control group (213.3 ± 14.2 × 10² cells/mm²) (P < 0.001). However, there was no difference in the control and treatment group with regard to the thickness and histological form of circular muscle. In general, the histological observations in gerbil decidual cells were very similar to those obtained in rats. The effect of relaxin was the proliferation of mast cells in the myometrium.

Figure 2.

Decidualized uterus tissues were stained using H&E staining. a Control (P₄ + E₂), b relaxin (P₄ + E₂ + relaxin). Bar indicates 100 μm: right side is the lumen side. MM Myometrium, EM endometrium, MC mast cell

Discussion

In this study, the authors artificially induced the decidualization of the Mongolian gerbil. In both the relaxin and control groups, the gerbil uterine horn was stimulated by P₄ and E₂ administration and oil. Several studies provide abundant evidence that relaxin is a potent regulator of the differentiated function of human endometrial cells in vitro [9, 13, 14]. Relaxin stimulates the production of prolactin [13, 15, 16, 17], an insulin‐like growth factor [17], and IGFBP‐1 [16], in progestin‐primed endometrial stromal cells. As prolactin and IGFBP‐1 are considered to be the major secretory proteins of decidual cells [18], induction of the expression of these proteins has been widely used as a biochemical marker of the decidualization of endometrial stromal cells in vitro [19]. Detailed studies of the regulation of IGFBP‐1 promoter activity in endometrial stromal cells demonstrate that relaxin, not P₄, is the major inducer of IGFBP‐1 gene transcription [20]. In this study, the relaxin‐treated uterine horn increased in weight and expressed IL‐11, which is the decidualization marker. Furthermore, relaxin treatment amplified decidualization in the gerbil and increased protein content and protein synthesis. In addition, the endometrial stromal cells increased in number and developed complex tissues. Relaxin promotes proliferation and inhibits apoptosis through LGR7, which is the relaxin receptor [15, 17]. It is possible that decidual cell increase occurs through a similar process.

In this study, relaxin increased the weight of the uterine horn, as well as protein concentration, protein synthesis, and DNA expression in gerbils. In the authors’ unpublished data, decidualized rat uterus showed similar results. Thus, the present result is in agreement with that obtained in rats.

This study demonstrates IL‐11 mRNA expression in gerbil decidualized uterine horn. In vitro, decidualization can be induced in endometrial stromal cells by P₄ after E₂ priming [21], as well as by receptor ligands that are coupled to the cAMP pathway, such as prostaglandin E₂, the lutenizing hormone, and human chorionic gonadotropin [22]. Dimitriadis et al. [20] demonstrated that relaxin and prostaglandin E₂ regulated IL‐11 in human uterus epithelial cells in vitro; decidualization in these cells was induced artificially. In both rats and mice, IL‐11 mRNA was expressed in the primary decidual zone, while mRNA for the receptor components IL‐11Rα and gp130 was expressed during the peri‐implantation period [18, 19]. In the in vitro study, when relaxin was added to the cultured decidualized human endometrial stromal cells, the cAMP concentration increased and induced IL‐11 expression as decidualization progressed [20].

Relaxin stimulates the production of prolactin [21, 23], IGFBP‐1 [24], and vascular epithelial growth factor in progestin‐primed endometrial stromal cells. Prolactin and IGFBP‐1 are considered to be the major secretory proteins of decidual cells [25], and induction of the expression of these proteins has been widely used as a biochemical marker of decidualization of endometrial stromal cells in vitro [14]. Detailed studies of the regulation of IGFBP‐1 promoter activity in endometrial stromal cells demonstrate that relaxin, not P₄, is the major inducer of IGFBP‐1 gene transcription [26]. In the in vitro study, combined treatments of relaxin and E + P also resulted in levels of prolactin and IL‐11 that were significantly higher than those achieved by either treatment alone [20]. The authors suggest that in conjunction with E + P, the IGFBP‐1 level was significantly elevated over that with E + P alone. This study showed first that a combination treatment of P₄, E₂, and relaxin stimulated IGFBP‐1 protein in the decidualized uterine horn in gerbils. Relaxin may regulate the factors necessary to grow endometrial stroma that is suited for embryo implantation. Previously, the authors reported that relaxin had an effect on gerbil embryos in an in vitro culture system during the pre‐implantation process [27]. Relaxin stimulated the proliferation of cells and improved embryo development [27]. Therefore, it may synergistically influence the maternal side and embryonic side, which subsequently improves implantation when embryos are transferred into the uterus.

From the histological examination, it was determined that decidualization could be induced artificially, and relaxin increased the number of stromal cells in the Mongolian gerbil. The endometrial stroma was stained blue, and the luminal and glandular epithelium was stained red [28]. The blue‐stained areas in the endometrial stroma increased to a greater extent in the relaxin group than in the control group. The decidual cells in the mesometrial deciduoma remained large and contained conspicuous amounts of glycogen [28].

In conclusion, relaxin participates in the decidual reaction of gerbils, which is similar to that of mice and rats. Relaxin plays a predominant role in the stimulation of uterus growth, protein synthesis, protein accumulation, and proliferation of the uterine horn and blastocysts at the time of implantation in the Mongolian gerbil.

Acknowledgments

The authors would like to thank Prof. T. Kohsaka, Shizuoka University, Japan for providing the relaxin used in this study.