Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2018 Apr 19.
Published in final edited form as: Cell Rep. 2018 Apr 3;23(1):100–111. doi: 10.1016/j.celrep.2018.03.038

Multifaceted Impact of MicroRNA 493-5p on Genome-Stabilizing Pathways Induces Platinum and PARP Inhibitor Resistance in BRCA2-Mutated Carcinomas

Khyati Meghani 1, Walker Fuchs 1,6, Alexandre Detappe 2,6, Pascal Drané 1, Ewa Gogola 3, Sven Rottenberg 3,4, Jos Jonkers 3, Ursula Matulonis 2, Elizabeth M Swisher 5, Panagiotis A Konstantinopoulos 2,*, Dipanjan Chowdhury 1,7,*
PMCID: PMC5908239  NIHMSID: NIHMS958973  PMID: 29617652

SUMMARY

BRCA1/2-mutated ovarian cancers (OCs) are defective in homologous recombination repair (HRR) of double-strand breaks (DSBs) and thereby sensitive to platinum and PARP inhibitors (PARPis). Multiple PARPis have recently received US Food and Drug Administration (FDA) approval for treatment of OCs, and resistance to PARPis is a major clinical problem. Utilizing primary and recurrent BRCA1/2-mutated carcinomas from OC patients, patient-derived lines, and an in vivo BRCA2-mutated mouse model, we identified a microRNA, miR-493-5p, that induced platinum/PARPi resistance exclusively in BRCA2-mutated carcinomas. However, in contrast to the most prevalent resistance mechanisms in BRCA mutant carcinomas, miR-493-5p did not restore HRR. Expression of miR-493-5p in BRCA2-mutated/depleted cells reduced levels of nucleases and other factors involved in maintaining genomic stability. This resulted in relatively stable replication forks, diminished single-strand annealing of DSBs, and increased R-loop formation. We conclude that impact of miR-493-5p on multiple pathways pertinent to genome stability cumulatively causes PARPi/platinum resistance in BRCA2 mutant carcinomas.

In Brief

Meghani et al. find that increased expression of miR-493-5p induces resistance to platinum and PARP inhibitors in patient cells harboring BRCA2 mutations by targeting repair pathways involved in maintaining genome stability.

graphic file with name nihms958973u1.jpg

INTRODUCTION

Large-scale genomic studies have demonstrated that approximately 50% of high-grade serous ovarian carcinomas (HGSOCs) harbor genetic and/or epigenetic alterations in homologous recombination repair (HRR) pathway genes (Cancer Genome Atlas Research Network, 2011), most commonly in BRCA1 and BRCA2 (Konstantinopoulos et al., 2015; Lord and Ashworth, 2016). Loss of HRR causes genomic instability, hyper-dependence on alternative DNA repair mechanisms, and enhanced sensitivity to certain types of DNA-damaging chemotherapy, such as platinum analogs and topoisomerase inhibitors (Evers et al., 2010; Konstantinopoulos et al., 2015). HRR-deficient cancers are also exquisitely sensitive to PARP inhibitors (PARPis), which exhibit synthetic lethality to cells with defective HRR. This synthetic lethal interaction is being exploited therapeutically in ovarian carcinoma whereby three PARPis, i.e., olaparib, rucaparib, and niraparib, have received US Food and Drug Administration (FDA) approval as monotherapy in patients with germline or somatic BRCA1/2 mutations or as maintenance therapy after platinum chemotherapy in platinum-sensitive recurrent ovarian carcinoma (Konstantinopoulos et al., 2015; Matulonis et al., 2016; Mirza et al., 2016; Swisher et al., 2017). The efficacy of PARPis against HRR-deficient cells can be explained by several mechanisms, including inhibition of base excision repair (BER), trapping of PARP-DNA complexes at the replication fork, enhancement of toxic classic non-homologous end joining (NHEJ), and inhibition of PARP1/Polθ-mediated alternative end joining (alt-EJ) (Konstantinopoulos et al., 2015).

Despite their predicted synthetic lethality, a large fraction of carcinomas eventually become resistant to these therapies. Underlying HRR deficiency is important for the cytotoxicity of PARPis and platinum agents, and this is highlighted by the fact that the most prevalent mechanisms of resistance to these therapies are secondary somatic BRCA1/2 mutations that restore the open reading frame and re-establish HRR proficiency (Sakai et al., 2008; Swisher et al., 2008). Besides reversion mutations, there are few clinically relevant mechanisms that have been identified. In BRCA1-mutated carcinomas, PARPi and platinum resistance may also occur via suppression of NHEJ, which also restores HRR proficiency. Loss of NHEJ confers resistance only to BRCA1 mutant carcinomas as BRCA1 is required in the early steps of HRR, and it may be “bypassed” either by loss of 53BP1 or loss of REV7 or via downregulation of the Ku70/Ku80 complex, which has been shown to restore competent HRR in BRCA1-deficient cells (Aly and Ganesan, 2011; Bouwman et al., 2010; Bunting et al., 2010; Xu et al., 2015). Identifying the mechanism of platinum and PARPi resistance in BRCA2-mutated carcinomas has been a challenge as HRR is not restored in cells expressing mutant BRCA2. However, few recent studies have revealed that BRCA2 mutant carcinomas might still develop platinum and PARPi resistance without restoration of HRR proficiency via a complex mechanism where stalled DNA replication fork is protected from degradation by nucleases by downregulation of proteins such as PTIP, CHD4, or EZH2 (Guillemette et al., 2015; Lai et al., 2017; Patch et al., 2015; Ray Chaudhuri et al., 2016; Rondinelli et al., 2017). Importantly, it is not clear how these factors would be downregulated in BRCA2 mutant cancers.

We have been systematically studying the role of microRNAs (miRNAs) in HRR and their role in mediating PARPi sensitivity (Choi et al., 2014, 2016; Moskwa et al., 2011). In this regard, using a candidate-based approach, we have recently shown that overexpression of a miRNA, miR-622, induces resistance to PARPi and platinum-based drugs in BRCA1 mutant ovarian carcinomas (Choi et al., 2016). We observed that miR-622 regulated the expression of the Ku complex and suppressed NHEJ, thereby rescuing the HRR deficiency of BRCA1 mutant ovarian carcinomas and induced resistance to PARPi and platinum-based drugs.

To systematically identify clinically relevant miRNAs that mediate platinum and PARPi resistance in BRCA1/2-mutated cancers, we performed next-generation sequencing of small RNAs extracted from the tumors of 38 patients with primary and recurrent BRCA1/2-mutated ovarian carcinomas. The results of the small RNA sequencing were independently validated in The Cancer Genome Atlas (TCGA) dataset and revealed a miRNA, miR-493-5p, as a mediator of resistance to platinum and PARPis exclusively in BRCA2-mutated ovarian carcinomas. We have characterized the functional impact of miR-493-5p in BRCA2-mutated cancer cells and demonstrated that it induces platinum and PARPi resistance by influencing multiple genome-stabilizing pathways that include single-strand annealing (SSA), R-loops, and replication fork stability.

RESULTS

Small RNA Sequencing of BRCA1/2-Mutated Ovarian Carcinomas Identifies Several miRNAs as Possible Mediators of Platinum Resistance

We performed next-generation sequencing of small RNAs extracted from the tumors of 38 patients with primary and recurrent BRCA1/2-mutated ovarian carcinomas. None of these carcinomas harbored BRCA1/2 reversion mutations, as we wanted to focus on mechanisms of resistance that were unrelated to secondary BRCA1/2 mutations. Our analysis focused on miRNAs that fulfilled two criteria: (1) were differentially expressed between platinum-resistant/refractory and platinum-sensitive BRCA1/2-mutated carcinomas and (2) their expression was concordantly associated with outcome after platinum therapy among BRCA1/2-mutated carcinomas.

Eight miRNAs, miR-139-5p, miR-493-5p, miR-378a-5p and miR-491-5p, miR-5000-3p, miR-369-3p, miR-3188, and miR-141-3p were identified to fulfill these criteria. Five of these miRNAs, miR-139-5p, miR-493-5p, miR-3188, miR-369-3p, and miR-5000-3p were overexpressed (p < 0.05) in platinum-resistant/refractory BRCA1/2-mutated carcinomas compared to platinum-sensitive BRCA1/2-mutated carcinomas and were associated with worse outcome after platinum therapy (Figures 1A and S1A). Conversely, the other three miRNAs, miR-141-3p, miR-378a-5p, and miR-491-5p, were under-expressed (p < 0.05) in platinum-resistant/refractory BRCA1/2-mutated carcinomas compared to platinum-sensitive BRCA1/2-mutated carcinomas and were associated with better outcome after platinum therapy (Figures 1A and S1A).

Figure 1. Expression of miR-493-5p Correlates with Platinum-Resistant/Refractory Disease Specifically in BRCA2 Mutant Ovarian Carcinomas.

Figure 1

Open in a new tab

(A) Volcano plot representing differentially expressed miRNAs in platinum-sensitive versus platinum-resistant/refractory carcinomas. x axis represents mean difference in miRNA expression (sensitive versus resistant), and y axis represents ANOVA p value (−log10).

(B) Overall survival (OS) for patients with BRCA1- or BRCA2-mutated ovarian carcinomas based on above or below median expression values of miR-493-5p. Left panel denotes overall survival for BRCA1-mutated tumors. Right panel denotes overall survival for BRCA2-mutated tumors. Statistical significance was assessed by the log rank test.

(C) Progression-free survival (PFS) for patients with BRCA1- or BRCA2-mutated HGSOCs based on quartile cutoff expression values of miR-493-5p. Left panel denotes progression-free survival for BRCA1-mutated carcinomas. Right panel denotes progression-free survival for BRCA2-mutated carcinomas. Statistical significance was assessed by the log rank test.

For all panels, n.s. represents p value > 0.05, *p value < 0.05, **p value < 0.01, ***p value < 0.001, and ****p value < 0.0001. See also Figure S1.

We then explored whether the impact of each of these 8 miRNAs was specific for BRCA1- or BRCA2-mutated carcinomas. Strikingly, the effect of miR-493-5p (Figure 1B) and miR-491-5p (Figure S1B) on outcome was only evident in BRCA2-mutated carcinomas, whereas the effect of miR-378a-5p, miR-3188, and miR-141-3p was evident only in BRCA1-mutated carcinomas (Figure S1B). Effect of miR-5000-3p, miR-139-5p, and miR-369-3p was not specific for BRCA1- or BRCA2-mutated carcinomas (Figure S1B).

Independent Validation of Small RNA Sequencing Findings for miR-493-5p in TCGA Dataset

TCGA dataset was queried to independently validate the find-ings of the small RNA sequencing. All patients included in TCGA cohort were diagnosed with HGSOC and underwent surgery followed by platinum-based chemotherapy. miR-139-5p, miR-493-5p, miR-378a-5p and miR-491-5p, miR-369-3p, and miR-141-3p were queried for their impact on survival in BRCA1- and BRCA2-mutated HGSOC using quartile cutoff to segregate carcinomas with high, intermediary, and low miRNA expression. (TCGA miRNA expression data were not available for miR-3188 and miR-5000-3p). HGSOC with miRNA expression levels below 25% were classified as low expression, HGSOC with levels between 25% and 75% quartile were classified as intermediary expression, and HGSOC with miRNA levels above 75% quartile were classified as high expression.

Of the 6 miRNAs identified in the small RNA sequencing, only miR-493-5p was associated with outcome in TCGA dataset. Specifically, in resonance with the observations from the RNA sequencing, overexpression of miR-493-5p (Figure 1C) was associated with worse outcome after platinum chemotherapy in BRCA2-mutated carcinomas of TCGA dataset, but not in BRCA1-mutated carcinomas. We did not observe an association between miR-139-5p, miR-378a-5p and miR-491-5p, miR-369-3p, and miR-141-3p levels and survival outcome in either the BRCA1-mutated or the BRCA2-mutated HGSOCs of TCGA dataset (Figure S1C).

To evaluate the impact of miR-493-5p on tumor regression, we queried miR-493-5p expression levels in carcinomas classified into 2 groups based on the amount of residual tumors detected post-debulking surgery (group A: cases with no residual tumors detected, 1–10 mm residual tumors; group B: cases with 11–20 mm and >20 mm residual tumors detected). We did not observe a significant difference in miR-493-5p expression levels between the two groups. Furthermore, multivariate survival analysis with miR-493-5p expression levels and amount of tumor detected post-surgery as covariates in BRCA2-mutated carcinomas showed significant impact of miR-493-5p expression on survival but no association between disease-free survival and the amount of residual tumor detected. In BRCA1-mutated tumors, no significant association was observed with miR-493-5p expression levels and amount of residual tumor (Figure S1D). Taken together, the results from the small RNA sequencing and TCGA dataset suggest that miR-493-5p may be a mediator of platinum resistance in BRCA2-mutated ovarian carcinomas.

miR-493-5p Mediates Resistance to Platinum and PARPi in BRCA2 Mutant, but Not BRCA1 Mutant, Models In Vitro

We evaluated the impact of miR-493-5p on PARPi and platinum sensitivity in a panel of patient-derived BRCA1-mutated (COV362 and UWB1.289) and BRCA2-mutated ovarian cancer cell lines (OVSAHO and Kuramochi) and in BRCA2 mutant VU423 fibroblast cells. As shown in Figure 2A, overexpression of miR-493-5p is associated with cisplatin and olaparib resistance, causing significant increase in the half maximal inhibitory concentration (IC50) for cisplatin and olaparib in BRCA2 mutant OVSAHO, Kuramochi, and VU423 cells. miR-493-5p overexpression is also associated with resistance to PARPi rucaparib and alkylating agent carboplatin in BRCA2 mutant VU423 cells (Figure S2A). Conversely, in agreement with the small RNA sequencing data and TCGA findings, overexpression of miR-493-5p had no effect on cisplatin and olaparib sensitivity in BRCA1-mutated COV362 and UWB1.289 cells (Figure 2B). Additionally, antagonizing endogenous miR-493-5p significantly sensitized BRCA2 mutant OVSAHO, Kuramochi, and VU423 cells to cisplatin and olaparib (Figure S2B).

Figure 2. Expression of miR-493-5p Causes PARPi and Platinum Resistance in BRCA2 Mutant Cells In Vitro and In Vivo.

Figure 2

Open in a new tab

(A) Survival assays to examine the impact of miR-493-5p overexpression in BRCA2 mutant KURAMOCHI, OVSAHO, and VU423 cells exposed to the indicated DNA-damaging agents.

(B) Survival assays to examine the impact of miR-493-5p overexpression in BRCA1 mutant COV362 and UWB1.289 cells exposed to the indicated DNA-damaging agents.

(C) Schematic for KB2P (p53−/− Brca2−/− mouse model) PARPi intervention study.

(D) miR-493-5p expression levels in matched PARPi-naive and resistant KB2P p53−/− Brca2−/− mammary mouse models (derived from independent spontaneous tumor donors). Expression was normalized using U6SnRNA as reference.

For all panels, data are represented as mean ± SEM from three different experiments, n.s. represents p value > 0.05, *p value < 0.05, **p value < 0.01, ***p value < 0.001, and ****p value < 0.0001. See also Figure S2.

miR-493-5p Is Upregulated in a Brca2-Mutated Mammary Tumor Model with Acquired PARPi Resistance In Vivo

To determine whether overexpression of miR-493-5p could be a possible mechanism of acquired resistance in BRCA2-mutated cancers, we utilized the unique genetically engineered mouse (GEM) KB2P mouse model for Brca2-deficient breast cancer (Jaspers et al., 2015; Jonkers et al., 2001). This model harbors large intragenic deletion in Brca2; therefore, acquired resistance to PARPis in this model cannot occur via secondary Brca2 mutations. Tumors from KB2P mouse donors were transplanted orthotopically into wild-type syngeneic mice, and when the tumor reached a volume >200 mm3, mice were treated with the PARPi AZD2461 for 28 consecutive days. Of note, PARPi AZD2461 is not a P-glycoprotein (Pgp) substrate, and therefore, acquired resistance to AZD2461 cannot be mediated by Pgp upregulation (Oplustil O’Connor et al., 2016). After an initial phase of response, the tumors eventually relapsed and were allowed to regrow to 100% volume, following which another treatment cycle was started. Eventually, upon repeated exposure, mouse models with acquired resistance to PARPi AZD2461 were generated. Each untreated naive tumor had either one or more matched resistant counterparts (Figure 2C). Out of 40 resistant tumor models generated from 19 untreated naive tumors, we observed a statistically significant increase in miR-493-5p levels in 13 of them (32.5%; 90% confidence interval [CI]: 20.4%–40.6%; Figure 2D).

Microarray Profiling to Identify Gene Targets of miR-493-5p

Given the potential of miRNAs to regulate multiple mRNA transcripts, we utilized an unbiased approach to identify gene targets for miR-493-5p. Accordingly, we used the HTA2.0 (Affymetrix) microarray platform to profile whole transcriptome changes in BRCA2-mutated Kuramochi cells, transfected with either control-miRNA or miR-493-5p mimics (Figure 3A). Comparison was performed between gene expression levels in control versus miR-493-5p transfected cells, with a statistical significance criterion of p value < 0.05 and a false discovery rate cutoff of <0.2. We performed gene set enrichment analysis (GSEA) on the significant hits and identified several pathways that play a key role in DNA replication and repair among the top hits to be downregulated in miR-493-5p-overexpressing cells (Table S1). To better define miR-493-5p-responsive pathways, we performed miRNA-mRNA correlation analysis for BRCA2-mutated tumors in TCGA dataset and identified 256 genes (Figure 3B) that were both (1) significantly overexpressed in control-miRNA transfected compared to miR-493-5p mimic transfected Kuramochi cells and (2) inversely correlated with miR-493-5p levels among the BRCA2-mutated carcinomas in the TCGA dataset. A few genes that fit these criteria (FEN1, SSRP1, and EME1) have been implicated in maintenance of genome stability. However, there were also several genes (MRE11, BLM, EXO1, and CHD4) that had a very striking difference in our transcriptomic analysis but did not meet the statistical significance cutoff for inverse correlation with miR-493-5p in TCGA (Figure S3). To delineate the mechanism behind the observed decrease in transcript levels, we queried publicly available databases and identified miRNA binding sites for these genes (Table 1). Subsequently, we assessed the impact of miR-493-5p on the protein levels of all these genes (SSRP1, FEN1, EXO1, RNASEH2A, BLM, and CHD4) in three BRCA2 mutant cell lines. Consistent with our mRNA analysis, we observed a decrease in protein levels of these factors in multiple BRCA2 mutant cell lines transfected with the miR-493-5p mimic (Figure 3C). Having established the impact of miR-493-5p on these transcripts, next we decided to investigate the relevance of our identified targets by querying the impact of miR-493-5p on different repair pathways where these factors are known to play an important role.

Figure 3. miR-493-5p Significantly Downregulates Expression of Multiple Genes Involved in Genomic Stability.

Figure 3

Open in a new tab

(A) Volcano plot depicting differentially expressed genes in control-miR versus miR-493-5p-overexpressing Kuramochi cells. x axis represents log2 expression fold change in control-miR versus miR-493-5p-mimic-transfected cells, and the y axis represents ANOVA p value (−log10).

(B) Quadrant-based segregation to identify genes that are significantly differentially expressed in the microarray and significantly correlate to levels of miR-493-5p in BRCA2-mutated carcinomas in the TCGA dataset. Highlighted quadrant four represents 245 genes that are significantly downregulated in the microarray and correlate significantly to miR-493-5p levels in the TCGA cohort of 34 BRCA2-mutated tumors.

(C) Quantification of protein levels in miR-493-5p-transfected cells normalized to control-miR-transfected cells.

For (C), data are represented as mean ± SEM from two different experiments, n.s. represents p value > 0.05, *p value < 0.05, **p value < 0.01, ***p value < 0.001, and ****p value < 0.0001. See also Figure S3.

Table 1.

miR-493-5p Binding Sites in the Genomic Sequences of the Indicated Genes Predicted Using the RNA 22 Version 2.0 Algorithm

U U A C U U U C G G A U G G U A C A U G U U hsa-mir-493-5p
| | | | | | | | | | | : | |
U C C A C A A G C C - A C C - U G U G C A C SSRP1
U U A C U U U C G G A U G G U A C A U G U U hsa-miR-493-5p
| : | : | | | | | | | |
G G G G G A G A C A A A A G A U G U A C A G FEN1
U U A C U U U C G G A U G G U A C A U G U U hsa-miR-493-5p
| | : | | | | | : | | :
A G C G C U G G C - - G C C A U C U G C A G CHD4
U U A C U U U C G G A U G G U A C A U G U U hsa-miR-493-5p
| | | : | | | | | | | :
C C C C A C A G C U - - C C U G G U A C A G EME1
U U A C U U U C G G A U G G U A C A U G U U hsa-miR-493-5p
| | : | | | | | | | | :
A A G G A G A A C C - - A C A C G U A G G G RNASEH2A
U U A C U U U C G G A U G G U A C A U G U U hsa-miR-493-5p
| : | | | | : | | | | | | | |
A G U G U U A C U G C A U U U U G U A C A A RPA2
U U A C U U U C G G - - A U G G U A C A U G U U hsa-miR-493-5p
| | : | : | | | | | | | | |
A U A A C U U G C U G U U G C C A U G U A C A U MRE11A
U U A C U U U C G G A U G - - G U A C A U G U U hsa-miR-493-5p
| | | | | | | | | | : |
A A A A A U A G A A U A C A U U U U G U A U A U EXO1
U U A C U U U C - G G A U G - G U A C A U G U U hsa-miR-493-5p
: | | | | | | | | | | | |
A G A A G A A G A A A U A C A C A U G C U C A U BLM
Open in a new tab

miR-493-5p Decreases SSA in BRCA2-Mutated Cells and Does Not Rescue HRR

The primary mechanism by which BRCA mutant ovarian carcinomas develop platinum or PARPi resistance is by the restoration of HRR (Norquist et al., 2011; Sakai et al., 2008, 2009). Additionally, a recent study (Feng and Jasin, 2017) has used separation-of-function BRCA2 mutants to demonstrate that the impact of BRCA2 on cell viability is primarily mediated by it function in HRR and not replication fork stability. Therefore, we explored the impact of miR-493-5p on HRR using the HDR reporter substrate (DR-GFP) reporter assay. BRCA2 knockdown in the DR-GFP system showed a decrease in HRR efficiency as expected; however, we did not observe a rescue in HRR upon overexpression of miR-493-5p after BRCA2 knockdown (Figure 4A). As an additional readout for HRR, we performed Rad51 foci formation assay in BRCA1/2-wild-type U2OS cells (Figure 4B) and in BRCA2 mutant VU423 and Kuramochi cells (Figures S4A and S4B). As with the results obtained with the DR-GFP system, overexpression of miR-493-5p caused a moderate decrease in Rad51 foci in wild-type U2OS cells but did not rescue HRR in BRCA2-mutated VU423 and Kuramochi cells. The SSA repair pathway is distinct as it distinguishes BRCA1 and BRCA2 mutant cells. BRCA1 mutant cells exhibit diminished HRR and SSA, whereas BRCA2 mutant cells have impaired HHR but a hyperactive SSA repair pathway, which is responsible for increased chromosomal aberrations in these cells (Stark et al., 2004). To study SSA, we utilized a previously reported SSA reporter pathway system (Bennardo et al., 2008; Stark et al., 2004). In agreement with published reports, we observed a significant escalation in SSA upon BRCA2 loss (Figure 4A). However, in cells with silenced BRCA2, overexpression of miR-493-5p was associated with a significant decrease in SSA (Figure 4A). As an additional readout for SSA, we created a stable VU423 cell line expressing mCherry-tagged Rad52. In concordance with the results in reporter cells, we also observed a significant decrease in Rad52 foci upon overexpression of miR-493-5p (Figure 4C). We also assessed whether miR-493-5p affects the other DSB repair pathways, C-NHEJ and alt-EJ, using the EJ5 and EJ2 reporter system, respectively (Figure 4A). BRCA2 silencing did not have a significant impact on C-NHEJ or alt-EJ. We did not observe a change in alt-EJ in BRCA2-silenced cells overexpressing miR-493-5p. However, we did observe a modest but statistically significant increase in total NHEJ measured by the EJ5 reporter assay system in BRCA2-silenced cells overexpressing miR-493-5p, although there was no difference compared to non-BRCA2-silenced cells (Figure 4A). The decrease in HRR and SSA by expression of miR-493-5p is consistent with its impact on the DNA end resection machinery (EXO1, MRE11, and BLM). These results led us to hypothesize that miR-493-5p might potentiate PARPi and platinum resistance in BRCA2 mutant cells, not by restoring HRR but by muting the otherwise hyperactive SSA pathway and promoting repair by NHEJ.

Figure 4. miR-493-5p Has an Impact on SSA, DNA Replication Fork Stability in BRCA2 Mutant, or Depleted Cells.

Figure 4

Open in a new tab

(A) DR-GFP, SA-GFP, EJ-2, and EJ-5 assay in U2OS cells transfected with indicated siRNA or miRNA.

(B) Quantification of Rad51 foci dynamics in U2OS cells transfected with the indicated miRNA.

(C) Quantification of Rad52 foci dynamics in VU423 cells stably expressing mCherry-Rad52 reporter transfected with the indicated miRNA.

(D) Quantification of Idu/Cldu lengths in Kuramochi cells transfected with control-miR or miR-493-5p mimics with or without hydroxyurea treatment (left panel). Schematic of labeling cells with Cldu and Idu to study replication fork degradation (right panel) is shown.

For all panels, data are represented as mean ± SEM from three different experiments, n.s. represents p value > 0.05, *p value < 0.05, **p value < 0.01, ***p value < 0.001, and ****p value < 0.0001. See also Figure S4.

miR-493-5p Stabilizes Replication Fork in BRCA2 Mutant Cells

Stabilization of DNA replication fork has recently emerged as a mechanism of PARPi and platinum resistance in BRCA2 mutant cells. CHD4 (Guillemette et al., 2015), MRE11 (Ding et al., 2016; Schlacher et al., 2011), and EXO1 (Lemaç on et al., 2017) are factors that contribute to destabilizing the replication fork in BRCA2 mutant cells and are recruited/stabilized at the fork by PTIP (Ray Chaudhuri et al., 2016). It is worth noting that silencing PTIP causes resistance to olaparib and cisplatin in Kuramochi and OVSAHO cells at a scale comparable to the impact of miR-493-5p (Figure S4C). Because top hits from our transcriptomic analysis include nucleases, in particular MRE11 and EXO1, we proceeded to quantify the effect of miR-493-5p on replication fork stability using DNA fiber analysis. To study replication fork dynamics after overexpression of miR-493-5p in BRCA2-mutated Kuramochi cells, cells were labeled with Cldu for 1.5 hr and Idu for 2 hr followed by hydroxyurea (HU) exposure for 3 hr. In BRCA2 mutant Kuramochi cells treated with control miRNA, HU significantly decreased the ratio of Idu/Cldu consistent with shortening of the Idu replication tract (Figure 4D). However, in Kuramochi cells overexpressing miR-493-5p, HU exposure did not cause any significant change in Idu/Cldu ratio, suggesting a potential role for miR-493-5p in regulating genes responsible for replication fork protection in BRCA2-mutated cells (Figure 4D). Results from our microarray profiling (Figure 3A) and DNA fiber analysis provide strong evidence that PARPi and platinum resistance induced by miR-493-5p in BRCA2 mutant cells may be a result of DNA replication fork stabilization achieved through downregulation of MRE11 and CHD4.

miR-493-5p May Impact Multiple Genome-Stabilizing Pathways

As stated above, top hits from our bioinformatics analysis identified targets for miR-493-5p like FEN1, SSRP1, and RNASEH2A that are known to play a role in R-loop processing and ribonucleotide excision repair (RER) pathway (Figure 5A; Herrera-Moyano et al., 2014; Teasley et al., 2015; Williams et al., 2016) To investigate the impact of miR-493-5p on R-loop processing, we used a monoclonal S9.6 antibody that specifically detects RNA-DNA hybrids. We measured S9.6 signal intensity in miR-493-5p-overexpressing BRCA2-mutated VU423 cells and detected a significant increase in R-loops (Figure 5B), which was abolished upon transient overexpression of GFP-tagged RNaseH1.

Figure 5. miR-493-5p Has an Impact on Pathways Regulating R-Loop Processing and Ribonucleotide Excision Repair Pathway.

Figure 5

Open in a new tab

(A) Plot showing correlation of miR-493-5p with different pathways.

(B) Quantification of R-loops measured as S9.6 intensity in BRCA2 mutant VU423 cells transfected with control-miR or miR-493-5p post-transfection with RNaseH1-GFP.

(C) Survival assays to assess the impact of BRCA2 mutant Kuramochi, OVSAHO, and VU423 cells transfected with the indicated siRNA and treated with the indicated DNA-damaging agents.

(D) Progression-free survival for BRCA2-mutated HGSOC in the TCGA dataset segregated based on the median expression levels of RNASEH2A, SSRP1, and FEN1. Statistical significance was assessed by the log rank test.

For Figures 5B and 5C, data are represented as mean ± SEM from three different experiments, n.s. represents p value > 0.05, *p value < 0.05, **p value < 0.01, ***p value < 0.001, and ****p value < 0.0001. See also Figure S5.

To determine whether RER pathway members identified from our analysis play a role in mediating chemoresistance in BRCA2 mutant cells, we silenced RNASEH2A, SSRP1, or FEN1 in BRCA2 mutant cells. Loss of these genes induces PARPi and platinum resistance (Figure 5C). Finally, we analyzed the correlation of RNASEH2A, FEN1, and SSRP1 expression with disease-free survival after platinum chemotherapy in BRCA2 mutant carcinomas in TCGA. Consistent with the notion that miR-493-5p-mediated suppression of these factors promotes platinum resistance in BRCA2 mutant carcinomas, we observe a striking inverse correlation of RNASEH2A, FEN1, and SSRP1 with outcome after platinum chemotherapy only in BRCA2 mutant carcinomas and not in BRCA1 mutant carcinomas (Figures 5D and S5A). Together, these results suggest that miR-493-5p may mediate response to PARPi and platinum-based drugs in BRCA2-mutated tumors by regulating genes that play an important role in diverse repair pathways.

DISCUSSION

We report miR-493-5p as a mediator of platinum and PARPi resistance in BRCA2-mutated ovarian carcinoma. mir-493-5p has been previously implicated in the process of carcinogenesis by regulating a number of target genes, including c-MET, EGFR (Wang et al., 2017), integrin subunit beta 1 (ITGB1) (Liang et al., 2017), and fucosyltransferase IV (FUT4) (Zhao et al., 2016) in various tumor types, including breast, prostate, and lung cancers. However, no previous implication of miR-493-5p in DNA repair or responsiveness to chemotherapy has been reported. We identified miR-493-5p by next-generation sequencing of small RNAs extracted from primary and recurrent BRCA1/2-mutated ovarian carcinomas, which was then validated in the TCGA ovarian cancer dataset (Cancer Genome Atlas Research Network, 2011). None of these tumors harbored secondary BRCA1/2 mutations, suggesting that the association between miR-493-5p and platinum resistance could not have been confounded by presence of secondary BRCA1/2 mutations. In addition to the findings from patient tumor samples, miR-493-5p conferred platinum and PARPi resistance in BRCA2-mutated, but not BRCA1-mutated, cell lines in vitro and was found to be significantly overexpressed in approximately one-third of Brca2-deficient KB2P mammary tumor models (13 of 40 resistant models) with acquired in vivo resistance to PARPi AZD2461 compared to paired naive untreated tumors. It is important to underscore that secondary Brca2 mutations or Pgp overexpression cannot explain the acquired resistance of KB2P model to AZD2461 because the KB2P model harbors biallelic deletion in Brca2 and PARPi AZD2461 is not a P-glycoprotein (Pgp) substrate.

Mechanistically, to identify clinically relevant gene targets of miR-493-5p, we performed gene expression profiling to identify genes that were significantly downregulated in BRCA2-mutated ovarian cancer cells transfected with miR-493-5p. The downregulated transcripts included many key genes required for genome stability, and several of these inversely correlated with expression of miR-493-5p in BRCA2-mutated ovarian carcinomas from TCGA dataset, thereby ensuring the clinical relevance of this interaction. Diminished transcript levels do not always lead to significant decrease in protein; therefore, we validated by immunoblot that indeed miR-493-5p downregulates the expression of these factors involved in DNA repair/replication and genomic stability. This approach identified several miR-493-5p targets that are involved in pathways that are relevant to the biology of BRCA2-mutated carcinomas as well as the development of platinum and PARPi resistance.

Stabilizing the replication fork is a recently identified mechanism of platinum and PARPi resistance in BRCA2-mutated carcinomas (Ray Chaudhuri et al., 2016). Beyond their role in DSB repair via HRR, BRCA1 and BRCA2 occupy an important role in limiting access of nucleases (such as MRE11) to single-strand DNA at stalled replication forks, thereby leading to replication fork protection. Recently, loss of PTIP, CHD4, and EZH2 have been identified as a mechanism of resistance in BRCA2-deficient cells (Ding et al., 2016; Guillemette et al., 2015; Ray Chaudhuri et al., 2016; Rondinelli et al., 2017). Specifically, deficiency in PTIP and CHD4 impedes recruitment of MRE11, thereby protecting stalled replication forks from nucleolytic degradation in BRCA2 mutant cells. Two clinically relevant questions that emerge from these studies are (1) are these factors downregulated in BRCA2 mutant carcinomas? (2) What is the mechanism by which the factors are suppressed? Here, we observed that miR-493-5p significantly downregulated MRE11, CHD4, and another nuclease EXO1 in BRCA2 mutant cells. Most importantly, consistent with these results, miR-493-5p preserved replication fork stability in BRCA2-mutated ovarian cancer cells.

We also show that miR-493-5p plays a role in regulating DSB repair pathway choice in BRCA2 mutant cells. miR-493-5p decreased SSA and in consonant also significantly decreased levels of BLM and EXO1 along with MRE11, which are key actors in DNA end resection, a critical step in SSA. Additionally, miR-493-5p did not rescue HRR, thereby eliminating restoration of HRR as a possible explanation of the observed platinum and PARPi resistance. These observations distinctly indicate that miR-493-5p impacts DNA repair pathway choice in BRCA2 mutant cells and may mediate platinum and PARPi resistance by suppression of the highly mutagenic and genome-destabilizing SSA, which is otherwise hyperactive in BRCA2 mutant cells.

Finally, our analysis identified RNASEH2A, FEN1, and SSRP1 as miR-493-5p targets; these genes are known to be implicated in multiple genome-stabilizing pathways, including the degradation of transcriptionally generated R-loops (Herrera-Moyano et al., 2014; Teasley et al., 2015) and RER pathway. R-loops are an established source of genome instability and a potential driver of tumorigenesis (Aguilera and García-Muse, 2012; Aguilera and Gómez-González, 2017; Santos-Pereira and Aguilera, 2015; Sollier and Cimprich, 2015). The precise molecular mechanisms by which R-loops promote tumorigenesis remain unclear. A genome-wide examination of R-loop dynamics in different cell types from BRCA1 mutation carriers revealed BRCA1-mutation-associated R-loops preferentially accumulate in luminal epithelial cells and at specific genomic loci leading to tumorigenesis (Zhang et al., 2017). Furthermore, in BRCA1-deficient carcinomas, there is a significant enrichment of mutations at precise locations where BRCA1 is predicted to suppress R-loops (Hatchi et al., 2015). BRCA2 also plays a key role in removal of R-loops that are formed in transcriptionally active regions of the genome (Bhatia et al., 2014). So far, there is no information on whether R-loops impact response of BRCA2-deficient carcinomas to platinum drugs and PARPis. Based on our results, we speculate that an increase in R-loops might be a contributing factor to the chemoresistance of BRCA2-deficient carcinomas.

Although both BRCA1 and BRCA2 are involved in HRR and loss of these factors confers PARPi sensitivity, expression of miR-493-5p induces platinum and PARPi resistance exclusively in BRCA2-mutated cells. It is noteworthy that the genomic landscape of BRCA1 and BRCA2 tumors is very different with very distinct chromosomal aberrations and mutational signatures (Nik-Zainal et al., 2016). Therefore, it is conceivable that, even if miR-493-5p targets the same pathways in BRCA1 mutant carcinomas, it doesn’t cause platinum and PARPi resistance due to other genetic/epigenetic differences with BRCA2 mutant carcinomas. In conclusion, we report miR-493-5p as a mediator of platinum and PARPi resistance in BRCA2-mutated ovarian carcinomas. Our data suggest that miR-493-5p mediates chemotherapeutic response by targeting several genes in pathways that play an important role in the maintenance of genome stability. Our study highlights a previously unrecognized role for miR-493-5p as a potential biomarker of responsiveness to platinum and PARPis as well as a target for reversing platinum and PARPi resistance in BRCA2-mutated ovarian carcinomas.

EXPERIMENTAL PROCEDURES

miRNA Profiling and Survival Analysis

Exiqon miRNA profiling was used to identify miRNAs that are differentially expressed in 38 BRCA1/2-mutated carcinomas with known response to platinum therapy obtained from the University of Washington Gynecologic Oncology Tissue Bank, in which tissues are obtained from patients undergoing surgery for primary or recurrent ovarian carcinoma who provide informed consent according to an institutional review board (IRB)-approved protocol. These carcinomas were confirmed to not harbor BRCA1/2 reversion mutations by sequencing. Normalized sequencing data counts for 953 miRNAs were available from Exiqon. Any miRNAs that were not detected in more than 19 of the carcinomas were not included in the final analysis. Expression values were standardized, following which miRNA levels were queried in refractory versus sensitive tumors. Independent samples t test with p value significance <0.05 was used as a statistical cutoff. 48 miRNAs were differentially expressed in refractory versus sensitive carcinomas (both directions). Overall survival data were queried for the available carcinomas, and log rank (Mantel-Cox) p value < 0.05 was used as a statistical cutoff to identify miRNAs that have an effect on overall survival. We queried overall survival data for 38 carcinomas based on median cutoff of miRNA expression. 8 miRNAs significantly affect overall survival in 38 BRCA1/2-mutated tumors. Next, we queried the survival analysis for the 8 miRNAs identified to be differentially expressed and causing a significant effect on overall survival in BRCA1/2-mutated carcinomas in 2 subgroups: BRCA1-mutated carcinomas and BRCA2-mutated carcinomas. We utilized the TCGA cohort for validating our results observed in the University of Washington cohort. We queried the survival analysis for the 8 miRNA hits in 38 BRCA1-mutated carcinomas and 34 BRCA2-mutated carcinomas.

Cell Survival Assays

For assessing cellular toxicity, cells were transfected with the indicated small interfering RNA (siRNA) or miRNA for 48 hr before plating cells into 96-well plates. The next day, DNA-damaging agents were added at the indicated concentrations. Cells were incubated with the drug containing media for 5 or 6 days before media was removed and replaced with drug-free media. Cells were incubated in drug-free media for 3 days before viability was measured using Cell-titer Glo reagent and assayed using a luminescence plate reader. Untreated and treated conditions were repeated in triplicates for each experiment, and each experiment was repeated at least three times. Viability for each drug concentration was normalized using untreated condition. Graphs represent percentage of surviving cells for each condition ± SEM.

mir-493-5p Levels in KB2P Tumor Models

RNA extracted from 19 naive and 40 resistant KB2P p53−/− Brca2−/− mammary tumor models using Trizol reagent (Invitrogen) was reverse transcribed using Universal cDNA synthesis kit II (Exiqon). Resulting cDNA was used to query miR-493-5p levels using ExiLENT SYBR Green master mix and LNA qPCR primers designed to accurately detect mmu-miR-493-5p in an Applied Biosystems qPCR machine. All reagents were used according to manufacturer instructions. miR-493-5p expression level was normalized to expression of U6 small nuclear RNA (snRNA) using the ΔCt method. Graphs represent expression values of miR-493-5p for each resistant tumor relative to miR-493-5p levels for its naive tumor counterpart and are indicated as average ± SEM. Each reaction had at least 4 replicates. LNA qPCR primer target sequence is as described on Exiqon’s website.

The U6snRNA target sequence (targets hsa, mmu U6snRNA) is as follows: GUGCUCGCUUCGGCAGCACAUAUACUAAAAUUGGAACGAUACAGAGAA GAUUAGCAUGGCCCCUGCGCAAGGAUGACACGCAAAUUCGUGAAGCGU UCCAUAUUUUU.

The miR-493-5p target sequence (targets mmu miR-493-5p) is as follows: UUGUACAUGGUAGGCUUUC.

Microarray Profiling and Data Analysis

RNA was extracted from BRCA2 mutant Kuramochi cells transfected twice with either control-miR or miR-493-5p and submitted for whole-transcriptome profiling to theMolecular BiologyCoreFacilities at Dana-Farber Cancer Institute. Affymetrix Human Transcriptome Array (HTA) 2.0 platform was used for quantification of transcripts. Pre-processing of Affymetrix CEL files was performed using Expression Console software application (Affymetrix) using the robust multi-chip analysis (RMA) algorithm, which performs background adjustment, quantile normalization, and probe-level summarization. A total of 67,528 transcripts were detected in the microarray, of which 44,699 were probed in coding regions of genome and 22,829 were probed in non-codingregions of genome. Fold change (linear and log 2) for each transcript detected was calculated for control versus miR-493-5p-transfected cells from raw values. For the purpose of our analysis, we focused on transcripts queried in the coding regions of the genome. (ANOVA p value < 0.05 and false discovery rate [FDR] p value < 0.20 [Benajmini-Hochberg method] were used for statistical significance). For every gene that passed the statistical significance tests, publicly available TCGA mRNA expression Z score data along with the microRNA expression Z scores for miR-493-5p were downloaded from http://cBioportal.org. Clinical characteristics for carcinomas in the TCGA dataset along with BRCA1 and BRCA2 mutational information was also downloaded from http://cBioportal.org. Thirty-four carcinomas harboring a BRCA2 mutation were isolated from the cohort (two tumors: TCGA-13-1512-01 and TCGA-23-1026-01 have both a BRCA1 and BRCA2 mutation and are considered to be hyper-mutated and not included in the analysis). Non-parametric Spearman correlation coefficient and one-tailed p value (95% confidence interval) was calculated for each gene and miR-493-5p pair for the 34 BRCA2-mutated samples. Quadrant-based scatterplot was created by plotting log2 fold change (x axis; control versus miR493 transfected) against Spearman r correlation coefficient values for genes with a significant correlation to miR-493-5p in the TCGA dataset. Each quadrant (labeled in Figure 3B) was classified based on the direction and magnitude of change or correlation for each gene. All necessary calculations were performed using Microsoft Excel, SPSS Statistics v24, and Graph Pad Prism v7.0.c.

Reporter Assays

HRR, SSA, alt-EJ, and total NHEJ were measured using U2OS-based reporter assay systems as described previously. Briefly, cells were seeded in 6-well plates and reverse transfected with the indicated siRNA, miRNA, or combination of both. 24 hr after transfection, cells were incubated with Isce1 adenovirus for 1 hr in FBS-free media, following which cells are incubated for 48 hr in FBS-containing media before harvesting for flow cytometry analysis. Activity of each reporter system was determined by fluorescence-activated cell sorting (FACS) quantification of GFP-positive cells. Each graph represents relative mean values ± SEM for each condition calculated by normalizing each condition to control transfected cells. Each experiment was repeated at least three times.

Cell Line Construction

pEF1α-mcherry-Rad52 plasmid was kindly provided by Dr. Galit Lahav. Stable cell line expressing the plasmid was generated by transfecting VU423 cells using Fugene 6 followed by selection in hygromycin-containing media.

Immunofluorescence

For Rad51 foci experiments, cells were transfected with indicated siRNA or miRNA or combination of both 48 hr before irradiation 5 Gy (gamma-IR). Cells were fixed 6 hr post-irradiation with 1% paraformaldehyde and 0.5% Triton X-100 for 30 min. Bovine serum albmin-Triton X-100-goat serum (BTG) buffer containing 1 mg/mL BSA, 0.1% Triton X-100, 3% goat serum, and 1 mM EDTA in PBS was used for blocking and to dilute primary (1°) and secondary (2°) antibodies. Coverslips containing cells were blocked in BTG buffer for 1 hr (room temperature), followed by overnight incubation in 1° antibody (4°C), three PBS washes, 1-hr incubation with 2° antibody (room temperature), and three washes. Coverslips were mounted with DAPI-containing mounting media (Southern Biotech). Number of foci per cell was quantified using publicly available cell image analysis software Cell Profiler (Broad Institute). More than 200 cells were imaged and quantified for number of foci for each condition. Graphs represent the raw values for number of foci for each condition. Error bars represented are SEM for each condition.

DNA Fiber Assay

DNA fiber analysis was performed as described before (Nieminuszczy et al., 2016). Briefly, BRCA2 mutant Kuramochi cells were transfected with either control-miR or miR-493-5p for 48 hr followed by incubation with chlorodeoxyuridine (Cldu) for 1.5 hr followed by incubation with iododeoxyuridine (Idu) for 2 hr followed by treatment with either DMSO or 4 mM hydroxyurea for 3 hr. Cells were spotted on a slide followed by lysis with lysis buffer (200 mM Tris-HCl [pH 5.5], 50 mM EDTA, and 0.5% SDS), followed by 120-min incubation with 2.5 M hydrochloric acid. After three washes in water, slides are processed for immunofluorescence. Slides were incubated with blocking buffer (1% BSA in PBS) for 1 hr at room temperature followed by incubation with primary antibody for 1 hr at 37°C. Slides were washed three times in PBS followed by incubation with secondary antibody for 1 hr at 37°C. Coverslips were mounted on slides with DAPI-containing mounting media (Southern Biotech). At least 100 fibers were counted per condition. Images were analyzed using ImageJ software. Ratio of Idu fiber length/Cldu fiber length was used as a measure of fiber degradation. Primary antibodies used for this experiment were as follows: rat anti-bromodeoxyuridine (BrdU) specific to Cldu (Abcam; ab6326; 1:125) and mouse anti-BrdU specific to Idu (BD Biosciences; 347580; 1:50). Secondary antibodies used for this experiment were as follows: goat anti-rat immunoglobulin G (IgG) Alexa 488 (Life Technologies; A-11006; 1:250) and donkey anti-mouse IgG Alexa Fluor 594 (Life Technologies; A-21203; 1:250).

Supplementary Material

1
2
3

Highlights.

  • miR-493-5p induces resistance to PARPi and platinum in BRCA2 mutant cells

  • miR-439-5p expression correlates with disease-free survival in BRCA2 mutant patients

  • miR-493-5p overexpression protects replication fork from nuclease degradation

  • High miR-493-5p expression decreases repair by the mutagenic SSA repair pathway

Acknowledgments

D.C. is supported by R01CA208244 (NCI) and R01CA142698-07 (NCI), a Leukemia and Lymphoma Society Scholar Grant, the Claudia Adams Barr Program for Innovative Cancer Research, the Robert and Deborah First Family Fund Award, and Tina’s Wish Foundation. D.C. and P.K. are supported by DOD W81XWH-15-0564/OC140632.

Footnotes

AUTHOR CONTRIBUTIONS

K.M. conducted most of the experiments with assistance from W.F. K.M., A.D., and P.D. conducted microscopy experiments and intensity quantifications. K.M., P.A.K., and D.C. conducted all of the statistical analyses. E.G. conducted the experiments with the Brca2 mouse model under the supervision of S.R. and J.J. The clinical samples were provided by E.M.S., and U.M. helped with analysis and interpretation of clinical data. K.M., D.C., and P.A.K. wrote the manuscript. D.C. and P.A.K. conceived the study.

DECLARATION OF INTERESTS

The authors declare no competing interests.

SUPPLEMENTAL INFORMATION

Supplemental Information includes five figures and one table and can be found with this article online at https://doi.org/10.1016/j.celrep.2018.03.038.

References

  1. Aguilera A, García-Muse T. R loops: from transcription byproducts to threats to genome stability. Mol Cell. 2012;46:115–124. doi: 10.1016/j.molcel.2012.04.009. [DOI] [PubMed] [Google Scholar]
  2. Aguilera A, Gómez-González B. DNA-RNA hybrids: the risks of DNA breakage during transcription. Nat Struct Mol Biol. 2017;24:439–443. doi: 10.1038/nsmb.3395. [DOI] [PubMed] [Google Scholar]
  3. Aly A, Ganesan S. BRCA1, PARP, and 53BP1: conditional synthetic lethality and synthetic viability. J Mol Cell Biol. 2011;3:66–74. doi: 10.1093/jmcb/mjq055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bennardo N, Cheng A, Huang N, Stark JM. Alternative-NHEJ is a mechanistically distinct pathway of mammalian chromosome break repair. PLoS Genet. 2008;4:e1000110. doi: 10.1371/journal.pgen.1000110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bhatia V, Barroso SI, García-Rubio ML, Tumini E, Herrera-Moyano E, Aguilera A. BRCA2 prevents R-loop accumulation and associates with TREX-2 mRNA export factor PCID2. Nature. 2014;511:362–365. doi: 10.1038/nature13374. [DOI] [PubMed] [Google Scholar]
  6. Bouwman P, Aly A, Escandell JM, Pieterse M, Bartkova J, van der Gulden H, Hiddingh S, Thanasoula M, Kulkarni A, Yang Q, et al. 53BP1 loss rescues BRCA1 deficiency and is associated with triple-negative and BRCA-mutated breast cancers. Nat Struct Mol Biol. 2010;17:688–695. doi: 10.1038/nsmb.1831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bunting SF, Callén E, Wong N, Chen HT, Polato F, Gunn A, Bothmer A, Feldhahn N, Fernandez-Capetillo O, Cao L, et al. 53BP1 inhibits homologous recombination in Brca1-deficient cells by blocking resection of DNA breaks. Cell. 2010;141:243–254. doi: 10.1016/j.cell.2010.03.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cancer Genome Atlas Research Network. Integrated genomic analyses of ovarian carcinoma. Nature. 2011;474:609–615. doi: 10.1038/nature10166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Choi YE, Pan Y, Park E, Konstantinopoulos P, De S, D’Andrea A, Chowdhury D. MicroRNAs down-regulate homologous recombination in the G1 phase of cycling cells to maintain genomic stability. eLife. 2014;3:e02445. doi: 10.7554/eLife.02445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Choi YE, Meghani K, Brault ME, Leclerc L, He YJ, Day TA, Elias KM, Drapkin R, Weinstock DM, Dao F, et al. Platinum and PARP inhibitor resistance due to overexpression of microRNA-622 in BRCA1-mutant ovarian cancer. Cell Rep. 2016;14:429–439. doi: 10.1016/j.celrep.2015.12.046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Ding X, Ray Chaudhuri A, Callen E, Pang Y, Biswas K, Klarmann KD, Martin BK, Burkett S, Cleveland L, Stauffer S, et al. Synthetic viability by BRCA2 and PARP1/ARTD1 deficiencies. Nat Commun. 2016;7:12425. doi: 10.1038/ncomms12425. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Evers B, Helleday T, Jonkers J. Targeting homologous recombination repair defects in cancer. Trends Pharmacol Sci. 2010;31:372–380. doi: 10.1016/j.tips.2010.06.001. [DOI] [PubMed] [Google Scholar]
  13. Feng W, Jasin M. BRCA2 suppresses replication stress-induced mitotic and G1 abnormalities through homologous recombination. Nat Commun. 2017;8:525. doi: 10.1038/s41467-017-00634-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Guillemette S, Serra RW, Peng M, Hayes JA, Konstantinopoulos PA, Green MR, Cantor SB. Resistance to therapy in BRCA2 mutant cells due to loss of the nucleosome remodeling factor CHD4. Genes Dev. 2015;29:489–494. doi: 10.1101/gad.256214.114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hatchi E, Skourti-Stathaki K, Ventz S, Pinello L, Yen A, Kamieniarz-Gdula K, Dimitrov S, Pathania S, McKinney KM, Eaton ML, et al. BRCA1 recruitment to transcriptional pause sites is required for R-loop-driven DNA damage repair. Mol Cell. 2015;57:636–647. doi: 10.1016/j.molcel.2015.01.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Herrera-Moyano E, Mergui X, García-Rubio ML, Barroso S, Aguilera A. The yeast and human FACT chromatin-reorganizing complexes solve R-loop-mediated transcription-replication conflicts. Genes Dev. 2014;28:735–748. doi: 10.1101/gad.234070.113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Jaspers JE, Sol W, Kersbergen A, Schlicker A, Guyader C, Xu G, Wessels L, Borst P, Jonkers J, Rottenberg S. BRCA2-deficient sarcomatoid mammary tumors exhibit multidrug resistance. Cancer Res. 2015;75:732–741. doi: 10.1158/0008-5472.CAN-14-0839. [DOI] [PubMed] [Google Scholar]
  18. Jonkers J, Meuwissen R, van der Gulden H, Peterse H, van der Valk M, Berns A. Synergistic tumor suppressor activity of BRCA2 and p53 in a conditional mouse model for breast cancer. Nat Genet. 2001;29:418–425. doi: 10.1038/ng747. [DOI] [PubMed] [Google Scholar]
  19. Konstantinopoulos PA, Ceccaldi R, Shapiro GI, D’Andrea AD. Homologous recombination deficiency: exploiting the fundamental vulnerability of ovarian cancer. Cancer Discov. 2015;5:1137–1154. doi: 10.1158/2159-8290.CD-15-0714. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Lai X, Broderick R, Bergoglio V, Zimmer J, Badie S, Niedzwiedz W, Hoffmann JS, Tarsounas M. MUS81 nuclease activity is essential for replication stress tolerance and chromosome segregation in BRCA2-deficient cells. Nat Commun. 2017;8:15983. doi: 10.1038/ncomms15983. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Lemaçon D, Jackson J, Quinet A, Brickner JR, Li S, Yazinski S, You Z, Ira G, Zou L, Mosammaparast N, Vindigni A. MRE11 and EXO1 nucleases degrade reversed forks and elicit MUS81-dependent fork rescue in BRCA2-deficient cells. Nat Commun. 2017;8:860. doi: 10.1038/s41467-017-01180-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Liang Z, Kong R, He Z, Lin LY, Qin SS, Chen CY, Xie ZQ, Yu F, Sun GQ, Li CG, et al. High expression of miR-493-5p positively correlates with clinical prognosis of non small cell lung cancer by targeting oncogene ITGB1. Oncotarget. 2017;8:47389–47399. doi: 10.18632/oncotarget.17650. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Lord CJ, Ashworth A. BRCAness revisited. Nat Rev Cancer. 2016;16:110–120. doi: 10.1038/nrc.2015.21. [DOI] [PubMed] [Google Scholar]
  24. Matulonis UA, Penson RT, Domchek SM, Kaufman B, Shapira-Frommer R, Audeh MW, Kaye S, Molife LR, Gelmon KA, Robertson JD, et al. Olaparib monotherapy in patients with advanced relapsed ovarian cancer and a germline BRCA1/2 mutation: a multistudy analysis of response rates and safety. Ann Oncol. 2016;27:1013–1019. doi: 10.1093/annonc/mdw133. [DOI] [PubMed] [Google Scholar]
  25. Mirza MR, Monk BJ, Herrstedt J, Oza AM, Mahner S, Redondo A, Fabbro M, Ledermann JA, Lorusso D, Vergote I, et al. ENGOT-OV16/ NOVA Investigators. Niraparib maintenance therapy in platinum-sensitive, recurrent ovarian cancer. N Engl J Med. 2016;375:2154–2164. doi: 10.1056/NEJMoa1611310. [DOI] [PubMed] [Google Scholar]
  26. Moskwa P, Buffa FM, Pan Y, Panchakshari R, Gottipati P, Muschel RJ, Beech J, Kulshrestha R, Abdelmohsen K, Weinstock DM, et al. miR-182-mediated downregulation of BRCA1 impacts DNA repair and sensitivity to PARP inhibitors. Mol Cell. 2011;41:210–220. doi: 10.1016/j.molcel.2010.12.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Nieminuszczy J, Schwab RA, Niedzwiedz W. The DNA fibre technique - tracking helicases at work. Methods. 2016;108:92–98. doi: 10.1016/j.ymeth.2016.04.019. [DOI] [PubMed] [Google Scholar]
  28. Nik-Zainal S, Davies H, Staaf J, Ramakrishna M, Glodzik D, Zou X, Martincorena I, Alexandrov LB, Martin S, Wedge DC, et al. Landscape of somatic mutations in 560 breast cancer whole-genome sequences. Nature. 2016;534:47–54. doi: 10.1038/nature17676. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Norquist B, Wurz KA, Pennil CC, Garcia R, Gross J, Sakai W, Karlan BY, Taniguchi T, Swisher EM. Secondary somatic mutations restoring BRCA1/2 predict chemotherapy resistance in hereditary ovarian carcinomas. J Clin Oncol. 2011;29:3008–3015. doi: 10.1200/JCO.2010.34.2980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Oplustil O’Connor L, Rulten SL, Cranston AN, Odedra R, Brown H, Jaspers JE, Jones L, Knights C, Evers B, Ting A, et al. The PARP inhibitor AZD2461 provides insights into the role of PARP3 inhibition for both synthetic lethality and tolerability with chemotherapy in preclinical models. Cancer Res. 2016;76:6084–6094. doi: 10.1158/0008-5472.CAN-15-3240. [DOI] [PubMed] [Google Scholar]
  31. Patch AM, Christie EL, Etemadmoghadam D, Garsed DW, George J, Fereday S, Nones K, Cowin P, Alsop K, Bailey PJ, et al. Australian Ovarian Cancer Study Group. Whole-genome characterization of chemoresistant ovarian cancer. Nature. 2015;521:489–494. doi: 10.1038/nature14410. [DOI] [PubMed] [Google Scholar]
  32. Ray Chaudhuri A, Callen E, Ding X, Gogola E, Duarte AA, Lee JE, Wong N, Lafarga V, Calvo JA, Panzarino NJ, et al. Replication fork stability confers chemoresistance in BRCA-deficient cells. Nature. 2016;535:382–387. doi: 10.1038/nature18325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Rondinelli B, Gogola E, Yücel H, Duarte AA, van de Ven M, van der Sluijs R, Konstantinopoulos PA, Jonkers J, Ceccaldi R, Rottenberg S, D’Andrea AD. EZH2 promotes degradation of stalled replication forks by recruiting MUS81 through histone H3 trimethylation. Nat Cell Biol. 2017;19:1371–1378. doi: 10.1038/ncb3626. [DOI] [PubMed] [Google Scholar]
  34. Sakai W, Swisher EM, Karlan BY, Agarwal MK, Higgins J, Friedman C, Villegas E, Jacquemont C, Farrugia DJ, Couch FJ, et al. Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers. Nature. 2008;451:1116–1120. doi: 10.1038/nature06633. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Sakai W, Swisher EM, Jacquemont C, Chandramohan KV, Couch FJ, Langdon SP, Wurz K, Higgins J, Villegas E, Taniguchi T. Functional restoration of BRCA2 protein by secondary BRCA2 mutations in BRCA2-mutated ovarian carcinoma. Cancer Res. 2009;69:6381–6386. doi: 10.1158/0008-5472.CAN-09-1178. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Santos-Pereira JM, Aguilera A. R loops: new modulators of genome dynamics and function. Nat Rev Genet. 2015;16:583–597. doi: 10.1038/nrg3961. [DOI] [PubMed] [Google Scholar]
  37. Schlacher K, Christ N, Siaud N, Egashira A, Wu H, Jasin M. Double-strand break repair-independent role for BRCA2 in blocking stalled replication fork degradation by MRE11. Cell. 2011;145:529–542. doi: 10.1016/j.cell.2011.03.041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Sollier J, Cimprich KA. Breaking bad: R-loops and genome integrity. Trends Cell Biol. 2015;25:514–522. doi: 10.1016/j.tcb.2015.05.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Stark JM, Pierce AJ, Oh J, Pastink A, Jasin M. Genetic steps of mammalian homologous repair with distinct mutagenic consequences. Mol Cell Biol. 2004;24:9305–9316. doi: 10.1128/MCB.24.21.9305-9316.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Swisher EM, Sakai W, Karlan BY, Wurz K, Urban N, Taniguchi T. Secondary BRCA1 mutations in BRCA1-mutated ovarian carcinomas with platinum resistance. Cancer Res. 2008;68:2581–2586. doi: 10.1158/0008-5472.CAN-08-0088. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Swisher EM, Lin KK, Oza AM, Scott CL, Giordano H, Sun J, Konecny GE, Coleman RL, Tinker AV, O’Malley DM, et al. Rucaparib in relapsed, platinum-sensitive high-grade ovarian carcinoma (ARIEL2 Part 1): an international, multicentre, open-label, phase 2 trial. Lancet Oncol. 2017;18:75–87. doi: 10.1016/S1470-2045(16)30559-9. [DOI] [PubMed] [Google Scholar]
  42. Teasley DC, Parajuli S, Nguyen M, Moore HR, Alspach E, Lock YJ, Honaker Y, Saharia A, Piwnica-Worms H, Stewart SA. Flap endonuclease 1 limits telomere fragility on the leading strand. J Biol Chem. 2015;290:15133–15145. doi: 10.1074/jbc.M115.647388. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Wang S, Wang X, Li J, Meng S, Liang Z, Xu X, Zhu Y, Li S, Wu J, Xu M, et al. c-Met, CREB1 and EGFR are involved in miR-493-5p inhibition of EMT via AKT/GSK-3β/Snail signaling in prostate cancer. Oncotarget. 2017;8:82303–82313. doi: 10.18632/oncotarget.19398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Williams JS, Lujan SA, Kunkel TA. Processing ribonucleotides incorporated during eukaryotic DNA replication. Nat Rev Mol Cell Biol. 2016;17:350–363. doi: 10.1038/nrm.2016.37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Xu G, Chapman JR, Brandsma I, Yuan J, Mistrik M, Bouwman P, Bartkova J, Gogola E, Warmerdam D, Barazas M, et al. REV7 counteracts DNA double-strand break resection and affects PARP inhibition. Nature. 2015;521:541–544. doi: 10.1038/nature14328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Zhang X, Chiang HC, Wang Y, Zhang C, Smith S, Zhao X, Nair SJ, Michalek J, Jatoi I, Lautner M, et al. Attenuation of RNA polymerase II pausing mitigates BRCA1-associated R-loop accumulation and tumorigenesis. Nat Commun. 2017;8:15908. doi: 10.1038/ncomms15908. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Zhao L, Feng X, Song X, Zhou H, Zhao Y, Cheng L, Jia L. miR-493-5p attenuates the invasiveness and tumorigenicity in human breast cancer by targeting FUT4. Oncol Rep. 2016;36:1007–1015. doi: 10.3892/or.2016.4882. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS958973-supplement-1.pdf (1.1MB, pdf)
2
NIHMS958973-supplement-2.xlsx (39.4KB, xlsx)
3
NIHMS958973-supplement-3.pdf (4.5MB, pdf)

RESOURCES